Method for preparing a targeted co-delivery system based on pMMP-1 and hydroxychloroquinoline and applications thereof

Abstract

The application provides a preparation method and application of a targeting co-delivery system based on pMMP-1 and hydroxychloroquine. Retinol with specific targeting for activated hepatic stellate cells is selected as a modification group, a targeting nano drug delivery system is obtained after modification of a delivery carrier, and pMMP-1 with negative electricity is electrostatically adsorbed by using the positive electricity of PR, HCQ, an autophagy inhibitor, is wrapped at the same time of electrostatic adsorption, and a targeting co-delivery system based on pMMP-1 and HCQ with active targeting effect for aHSCs is obtained. The application inhibits autophagy of aHSCs, reduces energy supply for activation of aHSCs, reduces expression of fibrosis related proteins, promotes degradation of ECM, and blocks the promotion effect of mechanical force generated by ECM on activation of HSCs. The application not only inhibits activation of HSCs but also degrades ECM deposited outside HSCs, so that a synergistic anti-hepatic fibrosis treatment effect is better achieved, the problem of complex causes of hepatic fibrosis and poor effect of single treatment method is solved, and the application has a good clinical application prospect.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of targeted drug delivery, in particular, the preparation method of a targeted co-delivery system loaded with autophagy inhibitor hydroxychloroquine (HCQ) and plasmid MMP-1 (pMMP-1) promoting matrix degradation, and modified with retinol (ROL), which can be used for the treatment of liver fibrosis. BACKGROUND

[0002] Liver fibrosis is a chronic pathological damage of the liver caused by alcohol, viruses and drugs, which can lead to the activation of hepatic stellate cells (HSCs) and the excessive deposition of extracellular matrix (ECM). If not treated in time, liver fibrosis can develop into cirrhosis and even liver cancer. At present, there is no effective drug approved for the treatment of liver fibrosis in clinical practice. Due to the complex pathological mechanism of liver fibrosis, treating liver fibrosis in a synergistic manner is an important strategy.

[0003] During the development of liver fibrosis, activated hepatic stellate cells are the main driving cells. Studies have shown that autophagy in other types of liver cells can maintain cell homeostasis and reduce the occurrence of liver fibrosis. However, autophagy in HSCs promotes the metabolism of lipid droplets (LDs) and provides energy for the activation of HSCs, thus promoting the activation of HSCs [Li-Shuang Hou et al. Pharmacol Ther, 2022; 234: 108117]. Activated hepatic stellate cells (aHSCs) synthesize and secrete a large amount of ECM deposited in the extracellular matrix, and the reactivation of HSCs triggered by the mechanical traction of ECM can promote the occurrence of liver fibrosis, forming a vicious cycle of liver fibrosis development. Previous studies have found that targeting the inhibition of autophagy in aHSCs can reverse the activation of HSCs and improve liver fibrosis, but the degradation effect of ECM already formed in the liver is not satisfactory, which still leads to the continuous deterioration of liver fibrosis. Therefore, inhibiting autophagy in HSCs alone cannot completely solve the fundamental problem of liver fibrosis, and it is necessary to promote the degradation of ECM at the same time. It is of great significance to use the strategy of co-delivery of drugs targeting aHSCs to reduce the vicious cycle of liver fibrosis development.

[0004] Our previous studies have shown that hydroxychloroquine (HCQ), as an autophagy inhibitor, has a potent effect in inhibiting autophagy and activation in HSCs [Li-Shuang Hou et al. Liver Int, 2024;44:1937-1951]. This has laid the experimental foundation for the development of anti-hepatic fibrosis therapeutics. Given the enormous potential of gene therapy in disease treatment, it is expected to become an important therapeutic approach for liver fibrosis. In this study, the pcDNA3.1-MMP-1 (pMMP-1) plasmid was used to promote MMP-1 expression, increase ECM degradation, reduce its deposition, and thus prevent ECM-induced HSC reactivation. However, the plasmid is easily degraded by nucleases, and the plasmid and free HCQ lack cell targeting, which can weaken the therapeutic effect and cause side effects. Therefore, it is necessary to develop a co-delivery system based on pMMP-1 and hydroxychloroquine to ensure targeted drug delivery to aHSCs. This synergistic approach could address the complex etiology of liver fibrosis and the poor efficacy of single treatments, which would be of great significance for the treatment of liver fibrosis. Summary of the Invention

[0005] In order to overcome the deficiencies of the prior art, the present invention provides a preparation method and application of a targeted co-delivery system based on pMMP-1 and hydroxychloroquine. The purpose of the present invention is to use ROL to modify the nano drug delivery system and load HCQ and pMMP-1 to target aHSCs and inhibit their autophagy, thereby reducing the expression of autophagy-related proteins and fibrosis-related proteins, and promoting the degradation of the extracellular matrix, blocking the mechanical force generated by the ECM to cause the reactivation of aHSCs, and preparing a targeted nano drug delivery system that can synergistically treat liver fibrosis. This type of drug delivery system uses ROL to have specific targeted recognition of aHSCs to achieve targeted delivery of drugs. It reduces the accumulation of small molecule drugs HCQ in other parts of the body and the uptake by other cells of the liver, while protecting the plasmid from degradation by nucleases, thereby better achieving the specificity and targeting of autophagy inhibition and ECM degradation, and providing new strategies and ideas for the research of anti-liver fibrosis drugs.

[0006] The application discloses a preparation method and application of a targeting co-delivery system based on pMMP-1 and hydroxychloroquine, and discloses preparation of a drug delivery system of retinol (ROL) targeting modified co-loaded autophagy inhibitor hydroxychloroquine (HCQ) and extracellular matrix degrading plasmid MMP-1 (pMMP-1), and application of the drug delivery system to active targeting treatment of liver fibrosis. The application selects ROL having specific recognition on activated hepatic stellate cells (aHSCs) as a targeting group, and constructs a co-delivery drug delivery system having HSCs active targeting delivery and synergistic treatment. Compared with free drugs or gene drugs, the application realizes HSCs active targeting delivery and synergistic treatment, can better solve problems of complex causes of liver fibrosis and poor effect of single treatment, and has a good clinical application prospect.

[0007] The application adopts the technical scheme that:

[0008] The application adopts the technical scheme that:

[0009] The application further provides a preparation method of the targeting co-delivery system based on pMMP-1 and hydroxychloroquine, and specifically comprises the following steps:

[0010] (1) dissolving retinol succinate in N,N-dimethylformamide (DMF) to obtain a DMF solution of the retinol succinate, a mass ratio of the retinol succinate and the DMF being A1, then adding SH-PEG 2K -NH2, benzotriazol-1-yl-oxytripyrrolidinophosphonium hexafluorophosphate (PyBOP) and N,N-diisopropylethylamine (DIPEA) into the DMF solution of the retinol succinate, a mass ratio of the retinol succinate and the SH-PEG 2K -NH2 being A2, a mass ratio of the retinol succinate and the PyBOP being A3, and a mass ratio of the retinol succinate and the DIPEA being A4; reacting at 25 DEG C for T1 hours, and concentrating to obtain SH-PEG 2K -ROL solution, adding the SH-PEG 2K -ROL solution into ice ether and washing four times, a mass ratio of the SH-PEG 2K -ROL and the ice ether being A5, collecting the precipitate, and vacuum drying to obtain the SH-PEG2K -ROL;

[0011] (2) SH-PEG 2K -ROL and polyethyleneimine PEI-succinimidyl 3-(2-pyridyldithio)propionate (SPDP) (PEI-SPDP, PS) were dissolved in dimethyl sulfoxide (DMSO) respectively, SH-PEG 2K -ROL and DMSO with a mass ratio of B2, and PS and DMSO with a mass ratio of B3. The SH-PEG 2K -ROL was added dropwise to the DMSO solution of PS, and after refluxing at a temperature W1 for a time T2, the reaction obtained PS-SH-PEG 2K -ROL (PR) solution, the reaction mixture was dialyzed in deionized water using a dialysis bag with a molecular weight cut-off of 7000 (molecular weight cut-off 7K, MWCO 7K), and the deionized water was replaced every 6 hours, the mass ratio of PR to deionized water was B4, and after dialysis for a time T3,

[0012] The carrier material PR was obtained by freeze-drying;

[0013] (3) PR, hydroxychloroquine sulfate and pcDNA3.1-MMP-1 (pMMP-1) with a mass ratio of C1 were dissolved in deionized water respectively, the mass ratio of PR to deionized water was C2, the mass ratio of hydroxychloroquine sulfate to deionized water was C3, and the mass ratio of pMMP-1 to deionized water was C4, thus obtaining PR solution, hydroxychloroquine sulfate solution and pMMP-1 solution respectively. After mixing the PR solution and the hydroxychloroquine sulfate solution under stirring, the pMMP-1 solution was added to obtain a mixed solution HCQ / pMMP-1@PR, which was placed in a dialysis bag with a molecular weight cut-off of 7000 after standing at 25℃ for a time T4, and the mixed solution HCQ / pMMP-1@PR was dialyzed in deionized water, the mass ratio of HCQ / pMMP-1@PR to deionized water was C5, and the dialysis time was T5, and the deionized water was replaced every 6 hours; after the dialysis time was reached, freeze-drying was performed to obtain a pMMP-1 and HCQ-based targeted co-delivery system HCQ / pMMP-1@PR.

[0014] In the step (1), the mass ratio A1 is 20:1-1:500, the mass ratio A2 is 30:1-1:100, the mass ratio A3 is 35:1-1:100, the mass ratio A4 is 100:1-1:400, the reaction time T1 is 0.1-40 h, and the mass ratio A5 is 200:1-1:8000.

[0015] In the step (2), the mass ratio B1 is 100:1-1:150, the mass ratio B2 is 600:1-1:300, the mass ratio B3 is 500:1-1:1000, the temperature W1 is 25-300 DEG C, the reflux time T2 is 1-300h, the mass ratio B4 is 500:1-1:250000, and the dialysis time T3 is 1-400h.

[0016] In the step (3), the mass ratio C1 is 1:5:10-900:100:1, the mass ratio C2 is 150:1-1:250, the mass ratio C3 is 100:1-1:200, the mass ratio C4 is 300:1-1:30000, the standing time T4 is 1-200min, the mass ratio C5 is 1000:1-1:5000000, and the dialysis time T5 is 0.5-500h.

[0017] The targeting co-delivery system based on pMMP-1 and hydroxychloroquine is applied to targeted delivery to hepatic stellate cells, and better treatment of liver fibrosis is achieved, and the activity evaluation experiment result shows that compared with free drugs, the drug delivery system can realize targeted drug delivery of aHSCs, reduce the influence on other types of liver cells, inhibit the activation of the main driving cells HSCs of liver fibrosis and promote the degradation of extracellular matrix, effectively play the synergistic anti-liver fibrosis effect of drugs, and have good clinical application prospect.

[0018] The beneficial effects of the present application are that the ROL with specific recognition effect on aHSCs is selected as a targeting modification group, the autophagy inhibitor HCQ and the pMMP-1 promoting the degradation of extracellular matrix are wrapped, and the targeting co-delivery system (HCQ / pMMP-1@PR) based on pMMP-1 and hydroxychloroquine with active targeting effect on aHSCs is obtained. Through the targeted delivery of HCQ, the autophagy of aHSCs is inhibited, the energy supply for the activation of aHSCs is reduced, and the expression of fibrosis-related proteins is reduced. Through the targeted delivery of pMMP-1 to aHSCs, the expression of MMP-1 is enhanced, the degradation of ECM is promoted, and the promotion effect of the mechanical force generated by ECM on the activation of HSCs is blocked. Therefore, the targeting co-delivery system (HCQ / pMMP-1@PR) based on pMMP-1 and hydroxychloroquine not only inhibits the activation of HSCs but also degrades the ECM deposited outside HSCs, so that the synergistic anti-liver fibrosis treatment effect is better achieved, the problem of complex etiology of liver fibrosis and poor effect of single treatment method is solved, and the targeting co-delivery system (HCQ / pMMP-1@PR) based on pMMP-1 and hydroxychloroquine has good clinical application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1Preparation and characterization of the targeting co-delivery system based on pMMP-1 and hydroxychloroquine, (a) is a schematic diagram of scanning electron microscopy of the targeting co-delivery system, (b) is a schematic diagram of transmission electron microscopy of the targeting co-delivery system, (c) is a PDI and particle size distribution diagram of the targeting co-delivery system, (d) is a potential distribution diagram of the targeting co-delivery system, (e) is the storage stability of the targeting co-delivery system in different solvents, (f) is a schematic diagram of the loading capacity of the targeting co-delivery system for pMMP-1 at different mass ratios of PR to pMMP-1, (g) is the protection capacity of the targeting co-delivery system for pMMP-1 against nucleases at different mass ratios of PR to pMMP-1.

[0020] Figure 2 In vitro targeting experiment of the targeting co-delivery system based on pMMP-1 and hydroxychloroquine, (a) is the immunofluorescence of aHSCs, AML-12, HUVEC and RAW 264.7 cells, scale = 10 μm; (b) is a statistical analysis of Figure A, aHSCs group vs AML-12, HUVEC and RAW 264.7 groups, n = 3, ***P < 0.001; (c) is a flow cytometry assay of aHSCs, AML-12, HUVEC and RAW 264.7.

[0021] Figure 3 Competitive uptake inhibition experiment of the targeting co-delivery system based on pMMP-1 and hydroxychloroquine, (a) is the cell immunofluorescence of aHSCs treated with or without ROL (scale = 10 μm); (b) is a statistical analysis of Figure A; (c) is a flow cytometry assay of the uptake of the delivery system by aHSCs treated with or without ROL; (d) is a statistical analysis of Figure C; Control group vs ROL group, n = 3, ***P < 0.001.

[0022] Figure 4 Quantitative detection of the expression of plasmid in HSCs by the targeting co-delivery system based on pMMP-1 and hydroxychloroquine, (a) is the mRNA expression level of MMP-1, TGF-β group vs Normal group, n = 3, ### P < 0.001; TGF-β + pMMP-1@PR group, TGF-β + HCQ / pMMP-1@PR group vs TGF-β group, n = 3, ***P < 0.001; (b) is the protein expression and statistical analysis of MMP-1, TGF-β group vs Normal group, n = 3, ###P<0.001; TGF-β+pMMP-1@PR group, TGF-β+HCQ / pMMP-1@PR group, TGF-β+HCQ@PR group vs TGF-β group, n=3, *** P<0.001, TGF-β+pMMP-1@PR group, TGF-β+HCQ@PR group vs TGF-β+HCQ / pMMP-1@PR group, n=3, & P<0.05; (c) Cellular immunofluorescence expression of MMP-1, I: Normal, II: TGF-β, III: TGF-β+HCQ@PR, IV: TGF-β+pMMP-1@PR, V: TGF-β+HCQ / pMMP-1@PR.

[0023] Figure 5 In vivo anti-hepatic fibrosis effect experiment of the targeting co-delivery system based on pMMP-1 and hydroxychloroquine, (a) is a photo of liver (ruler=0.5cm), H&E staining, Masson staining and Sirius red staining of liver (ruler=50μm); (b) is immunohistochemical fluorescence staining of α-SMA, MMP-1 and ATG7 (ruler=50μm).

[0024] Figure 6 Biological safety evaluation of the targeting co-delivery system based on pMMP-1 and hydroxychloroquine. DETAILED DESCRIPTION

[0025] The application will be further described below in conjunction with the drawings and examples.

[0026] Example 1

[0027] Preparation and characterization of the targeting co-delivery system based on pMMP-1 and hydroxychloroquine

[0028] Step (1): 100mg of retinol was dissolved in 4mL of pyridine, then 175mg of succinic anhydride and 21mg of DMAP were added to make it completely dissolved. The reaction mixture was incubated at 25℃ overnight, and evaporated under reduced pressure. 10mL of dichloromethane was added, washed with 10% citric acid for 3 times, and then washed with saturated brine for 2 times. After drying with sodium sulfate, retinol succinate was obtained, which was redissolved in 5mL of DMF, and then 700mg of SH-PEG 2K -NH2, 220mg of PyBOP) and 200μL of DIPEA were completely dissolved, and reacted at 25℃ for 0.5h. The solution was concentrated by rotary evaporation under reduced pressure, and the reaction solution was added to 50mL of ice-ethanol for washing 4 times, and the precipitate was collected and dried under vacuum to obtain SH-PEG 2K -ROL.

[0029] Step (2): 366 mg of SH-PEG 2K - ROL was dissolved in 3 mL of DMSO and added dropwise to 7 mL of a DMSO solution of PEI-SPDP (PS) with a PS content of 1800 mg. After refluxing at a temperature of 65°C for 24 h, the reaction yielded PS-SH-PEG 2K - ROL (PR) solution. The SH-PEG 2K - ROL and PS reaction mixture. The deionized water was replaced every 6 h, 5000 mL of deionized water each time. After dialysis for 72 h, PEI-PEG 2k - ROL (PR).

[0030] Step (3): 60 mg of PR was dissolved in 2 mL of deionized water, and 51 mg of hydroxychloroquine sulfate was dissolved in 1 mL of deionized water. After mixing the PR solution and the hydroxychloroquine sulfate solution, 12 mL of 1 mg / mL pMMP-1 was added under stirring. After standing at a temperature of 25°C for 20 min, the mixture was placed in a dialysis bag (MWCO 7K) and dialyzed with 5000 mL of deionized water for 48 h, with the deionized water being replaced every 6 h. After dialysis was completed, freeze-drying was performed to obtain the pMMP-1 and HCQ-based targeted co-delivery system HCQ / pMMP-1@PR. The single-drug-loaded delivery systems HCQ@PR or pMMP-1@PR were prepared by the same method, respectively.

[0031] The characterization results are shown in Figure 1 As shown in FIGS. a and b, the transmission electron microscopy and scanning electron microscopy results of the HCQ / pMMP-1@PR delivery system show that the shape of the delivery system is uniform spherical, and the particle size is uniform. Figure 1 As shown in FIGS. c and d, the particle size of the delivery system is 128.5 ± 5.0 nm, the dispersion coefficient PDI is 0.194 ± 0.022, and the particle size distribution range is relatively narrow (PDI < 0.3). Thus, a delivery system with small particle size and uniform distribution is obtained, and the zeta potential of the delivery system is 20.7 ± 2.0 mV. The above characterization of the delivery system can meet the requirements of aHSCs targeted delivery. As shown in Figure 1 e, the particle size and PDI of the HCQ / pMMP-1@PR delivery system did not change significantly in deionized water, PBS, DMEM and 10% FBS for 1-28 days, and the stability was good. It was found by gel electrophoresis that when the mass ratio of the carrier PR to pMMP-1 was 1:1, pMMP-1 could be better loaded Figure 1f) The delivery system could protect pMMP-1 from being degraded by DNase I to some extent when the mass ratio of PR to pMMP-1 was 1:1. The loading amount of HCQ in HCQ / pMMP-1@PR delivery system was 20.13% detected by HPLC. Considering the loading amount of HCQ, the clinical dosage of HCQ and the protection ability of PR to pMMP-1, the mass ratio of PR to pMMP-1 was 5:1 in the following experiments.

[0032] Example 2

[0033] In vitro targeting experiment of the pMMP-1 and hydroxychloroquine-based targeted co-delivery system

[0034] Resting HSCs (qHSCs) were seeded on 20 mm diameter cell culture slides and stimulated with transforming growth factor-β (TGF-β) at a concentration of 10 ng / mL for 24 h to transform them into aHSCs. Normal hepatocytes (AML-12), liver sinusoidal endothelial cells (HUVEC) and macrophages (RAW 264.7) were also seeded on 20 mm diameter cell culture slides. After the cells adhered, the four slides were placed together in a 100 mm diameter cell culture dish for co-culture to simulate the in vivo environment. HCQ / pMMP-1@PR was labeled with EFGP green fluorescent protein and added to the culture medium according to the amount of HCQ, which was 12.5 μM. After 4 h of cell culture, the supernatant was discarded and the cells were washed with PBS for 3 times. After the cells were fixed with 4% paraformaldehyde, the fixing solution was discarded and the cell nuclei were stained with DAPI. The cell slides were scanned with a confocal fluorescence microscope to obtain fluorescence imaging.

[0035] The results showed that (as shown in Figure 2 a and b), the green fluorescence intensity of aHSCs was significantly stronger than that of AML-12, HUVEC and RAW 264.7, indicating that HCQ / pMMP-1@PR had good targeting to aHSCs. In addition, the results of flow cytometry also confirmed the above conclusion Figure 2 c). Therefore, ROL-modified HCQ / pMMP-1@PR exhibited good targeting to aHSCs, which could reduce the uptake of HCQ / pMMP-1@PR by other types of cells in the liver, laying a good foundation for the exertion of the therapeutic effect of liver fibrosis in vivo.

[0036] Example 3

[0037] Competitive uptake inhibition experiment of the pMMP-1 and hydroxychloroquine-based targeted co-delivery system

[0038] Firstly, qHSCs were activated by TGF-β for 24 h to transform into aHSCs. Then, aHSCs were incubated with 2 mg / mL ROL for 1 h, and the medium without ROL was used as a control (Control). After that, the supernatant was discarded and the cells were washed with PBS for 3 times to remove the residual free ROL. Then, aHSCs were incubated with HCQ / pMMP-1@PR (HCQ concentration was 12.5 μM and pMMP-1 concentration was 2 μg / mL) for 4 h, and the cells were washed with PBS for 3 times. After that, the cells were fixed with 4% paraformaldehyde for 15 min, and then the paraformaldehyde was discarded. The nuclei were stained with DAPI for 15 min, and then the cells were washed with PBS for 3 times. Finally, the cells were mounted with glycerol.

[0039] The results of the competitive uptake experiment of the delivery system are shown in FIGS. 8a and 8b. Figure 3 As shown in FIGS. 8a and 8b, after the addition of free ROL, the red fluorescence of HCQ / pMMP-1@PR was significantly weakened compared with the Control group, and the red fluorescence intensity of the Control group was strong. This indicated that the HCQ / pMMP-1@PR was significantly inhibited after the addition of ROL, and the HCQ / pMMP-1@PR targeted co-delivery system could enter the cells by binding to the retinol binding protein receptor on the surface of HSCs. Therefore, the free ROL had a competitive inhibitory effect on the HCQ / pMMP-1@PR, and the results of flow cytometry also confirmed the above conclusion. Figure 3 c and d).

[0040] Example 4

[0041] Quantitative detection of plasmid expression in HSCs by pMMP-1 and hydroxychloroquine-based targeted co-delivery system

[0042] qHSCs were seeded in a 6-well plate, and after adhering, qHSCs were activated by TGF-β for 24 h to transform into aHSCs. Then, aHSCs were incubated with HCQ / pMMP-1@PR (pMMP-1 content was 2 μg / mL) for 48 h, and the cells were collected. The RNA of the cells was extracted by using an RNA extraction kit. qRT-PCR analysis was performed by using a QuantStudio 6 Flex system PCR instrument. The primer sequence of MMP-1 was as follows: forward primer

[0043] CTAGGTCTGGATCACTCCAAGG, reverse primer TGAACGTCATCATCAGGAAGC. The primer sequences of the internal reference GAPDH are as follows: forward primer TGAAGGGTGGAGCCAAAAG, reverse primer AGTCTTCTGGGTGGCAGTGAT. In addition, after the cells were treated with TGF-β and HCQ / pMMP-1@PR, the cell proteins were extracted, and the proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The polyvinylidene fluoride membrane was incubated with the primary antibody (MMP-1) overnight at 4°C, and the next day, the secondary antibody was incubated at room temperature for 1 h. Finally, Prism Demo 10 and Image J software were used for quantitative analysis. On the other hand, the transfection effect of HCQ / pMMP-1@PR in HSCs was also detected by cell immunofluorescence. qHSCs were seeded on 20 mm glass slides at a density of 10 3 cells / well, and were stimulated with TGF-β for 24 h to transform them into aHSCs. The supernatant was discarded, and the cells were washed with PBS 3 times. HCQ / pMMP-1@PR, HCQ@PR, and pMMP-

[0044] 1@PR were added to the culture medium, and after the cells were cultured for 48 h, the supernatant was discarded. After the cells were washed with PBS 3 times, the cell slides were incubated with the primary antibody (MMP-1) overnight at 4°C. The next day, the slides were incubated with the secondary antibody at room temperature for 1 h in the dark. The cells were fixed with paraformaldehyde for 15 min, the nuclei were stained with DAPI for 15 min, and the fluorescence imaging was obtained by confocal fluorescence microscopy scanning.

[0045] The experimental results are shown in Figure 4 a. Compared with the normal group of HSCs, TGF-β treatment significantly reduced the mRNA expression of MMP-1. However, after the HSCs were treated with HCQ / pMMP-1@PR loaded with pMMP-1, the mRNA expression of MMP-1 was significantly enhanced in the HCQ / pMMP-1@PR and pMMP-1@PR groups compared with the TGF-β group ( Figure 4 a). In addition, after treatment with TGF-β, the protein expression of MMP-1 was inhibited compared with the normal group. The HCQ / pMMP-1@PR, pMMP-1@PR, and HCQ@PR treatment groups significantly enhanced the expression of MMP-1 compared with the TGF-β group, and the effect of the HCQ / pMMP-1@PR group was significantly better than that of the pMMP-1@PR and HCQ@PR groups ( Figure 4 b). In addition, the cell immunofluorescence results also confirmed the above conclusion ( Figure 4 c). In summary, the HCQ / pMMP-1@PR targeted co-delivery system can promote the mRNA and protein expression of MMP-1 in HSCs, and has good transfection effect.

[0046] Example 5

[0047] In vivo anti-hepatic fibrosis effect experiment of pMMP-1 and hydroxychloroquine-based targeted co-delivery system

[0048] BALB / c mice (male, 5 weeks, 22±2 grams) were randomly divided into 5 groups after free feeding and drinking water for 7 days: normal group, TAA group, TAA+HCQ@PR group, TAA+pMMP-1@PR group and TAA+HCQ / pMMP-1@PR group. The normal group was injected with normal saline, and the rest of the groups were injected with TAA intraperitoneally to establish a hepatic fibrosis model. In the first week, 100 mg / kg of TAA was injected three times. From the second week to the fifth week, 200 mg / kg of TAA was injected twice a week. Except for the TAA group and the normal group, the rest of the groups were injected with therapeutic drugs through the tail vein, 2 times a week. The concentration of HCQ was 10 mg / kg, and the concentration of pMMP-1 was 1 mg / mL. After 5 weeks, the serum and various organs were collected for subsequent experiments. The liver tissue of the hepatic fibrosis mouse was embedded with paraffin and then sectioned and stained. According to the kit instructions, the morphology and structure of the liver tissue were stained by hematoxylin-eosin (H&E) staining. After paraffin embedding, the liver tissue was sectioned, dewaxed with xylene twice, 5 min / time, and then washed with distilled water for 3 min. Stain with hematoxylin for 10 min, differentiate with 1% hydrochloric acid alcohol for 5 s, and then wash with running water for 3 min. Then, stain with 1% eosin for 2 min, wash with distilled water 3 times, dehydrate with 95% alcohol for 1 min, and finally seal with neutral resin. At the same time, according to the Masson staining kit (Beijing Solaybao) instructions, the liver tissue was embedded with paraffin, sectioned, dewaxed with xylene for 10 min, stained with iron hematoxylin staining solution for 8 min, washed with water for 3 min, stained with ponceau red staining solution for 5 min, stained with aniline blue staining solution for 2 min, rapidly dehydrated with 95% ethanol twice, 5 s / time, dehydrated with anhydrous ethanol 3 times, 10 s / time, transparent with xylene 3 times, 2 min / time, and finally sealed with neutral resin. In addition, according to the Sirius red staining kit, the liver tissue was embedded with paraffin, sectioned, dewaxed with xylene for 20 min, dehydrated with anhydrous ethanol for 10 min, dehydrated with 95% alcohol for 5 min, dehydrated with 90% alcohol for 5 min, dehydrated with 80% alcohol for 5 min, dehydrated with 70% alcohol for 5 min, washed with distilled water 3 times, 1 min / time. Stain with 10% Sirius red for 8 min. The section is rinsed with anhydrous alcohol for 2 min, and then sealed with neutral resin. The liver tissue of the hepatic fibrosis mouse was embedded with embedding agent, sectioned, and incubated with the first antibody (α-SMA, ATG7, MMP-1), and stored in the refrigerator at 4°C overnight. The next day, the liver tissue section was incubated with the second antibody at room temperature for 1 h. Finally, fluorescence imaging was performed under a confocal microscope.

[0049] The results are as followsFigure 5 As shown in a, compared with the normal group, the liver photos of TAA-induced liver fibrosis mice had obvious granularity and hard texture. After treatment in each treatment group, the liver regained its rosy luster and soft texture, and the HCQ / pMMP-1@PR group had the best effect. H&E staining showed that TAA-induced liver fibrosis led to disordered liver cell structure, accompanied by infiltration of inflammatory cells. After treatment with HCQ@PR, pMMP-1@PR and HCQ / pMMP-1@PR, the liver cell structure gradually recovered, especially the HCQ / pMMP-1@PR group had the best effect ( Figure 5 a). The results of Masson staining and Sirius red staining showed that compared with the TAA group, the collagen deposition in each treatment group was significantly reduced after treatment, and the HCQ / pMMP-1@PR group had the best effect ( Figure 5 b). In addition, TAA-induced liver fibrosis significantly increased the expression of tissue fluorescence of α-SMA and ATG7 and inhibited the expression of MMP-1. After treatment in each treatment group, the fluorescence expression of α-SMA and ATG7 was significantly reduced, and the fluorescence expression of MMP-1 was enhanced, with the effect of HCQ / pMMP-1@PR group being the most significant ( Figure 5 b) These results indicate that HCQ / pMMP-1@PR treatment significantly reduced liver inflammatory infiltration and improved the pathological damage of liver fibrosis, reduced collagen deposition in the liver, and inhibited autophagy, demonstrating a favorable therapeutic effect in improving liver fibrosis.

[0050] Example 6

[0051] Biosafety evaluation of a targeted co-delivery system based on pMMP-1 and hydroxychloroquine

[0052] Liver tissue was paraffin-embedded and sectioned according to the hematoxylin-eosin (H&E) staining kit instructions. Dewaxed twice with xylene for 5 minutes each time, then rinsed with distilled water for 3 minutes. Stained with hematoxylin for 10 minutes, separated with 1% hydrochloric acid and alcohol for 5 seconds, and rinsed with running water for 3 minutes. Stained with 1% eosin for 2 minutes, washed three times with distilled water, dehydrated with 95% alcohol for 1 minute, and finally mounted with neutral gum.

[0053] The results are as follows Figure 6 As shown, the HCQ / pMMP-1@PR, HCQ@PR, and pMMP-1@PR groups showed no significant damage to the heart, spleen, lungs, and kidneys. This indicates that HCQ / pMMP-1@PR, HCQ@PR, and pMMP-1@PR have good biosafety, can be verified by in vitro and in vivo pharmacodynamics, and have good clinical application prospects.

Claims

1. A targeted co-delivery system based on pMMP-1 and hydroxychloroquine, characterized by: Retinol (ROL) with specific targeting for activated hepatic stellate cells (aHSCs) was selected as a modifying group to modify the delivery vector PS to obtain a targeted nano-drug delivery system PR. The PS is polyethyleneimine (PEI)-succinimide 3-(2-pyridyldisulfide)-propionate (SPDP), and the pMMP-1 is pcDNA3.1-MMP-1. The positive charge of PR is utilized to electrostatically adsorb the negatively charged pMMP-1, and the autophagy inhibitor hydroxychloroquine (HCQ) is simultaneously encapsulated during the electrostatic adsorption, thereby obtaining a targeted co-delivery system HCQ / pMMP-1@PR based on pMMP-1 and HCQ with active targeting for aHSCs. The preparation method is as follows: (1) Dissolve retinol succinate in N,N-dimethylformamide (DMF) to obtain a DMF solution of retinol succinate, wherein the mass ratio of retinol succinate to DMF is A1, and then SH-PEG 2K - NH2, benzotriazole-1-yl-oxytripyrrolidinophosphine hexafluorophosphate PyBOP and N,N-diisopropylethylamine DIPEA were added to the DMF solution of retinol succinate, and retinol succinate and SH-PEG 2K The mass ratio of -NH2 is A2, the mass ratio of retinyl succinate and PyBOP is A3, and the mass ratio of retinyl succinate and DIPEA is A4; the reaction time is T1 at 25°C, and the SH-PEG is obtained by rotary evaporation under reduced pressure. 2K -ROL solution, SH-PEG 2K -ROL solution was added to ice ether and washed 4 times. 2K The mass ratio of -ROL to glacial ether is A5, and the precipitate is collected and vacuum dried to obtain SH-PEG. 2K -ROL; mass ratio A1 is 20:1 to 1:500, mass ratio A2 is 30:1 to 1:100, mass ratio A3 is 35:1 to 1:100, mass ratio A4 is 100:1 to 1:400, reaction time T1 is 0.1 to 40h, and mass ratio A5 is 200:1 to 1:8000; (2) SH-PEG with a mass ratio of B1 2K -ROL and PS were dissolved in dimethyl sulfoxide (DMSO), SH-PEG 2K The mass ratio of -ROL to DMSO is B2, the mass ratio of PS to DMSO is B3, and the SH- PEG 2K -ROL DMSO solution was added dropwise to PS DMSO solution, and after reflux time T2 at temperature W1, the reaction yielded PS-SH-PEG. 2K -ROL solution, dialyzing the reaction mixture in deionized water using a dialysis bag with a molecular weight cutoff of 7000, replacing deionized water every 6 hours, the mass ratio of PR to deionized water is B4, and after dialysis time T3, freeze-drying is performed to obtain a targeted nano drug delivery system PR; the mass ratio B1 is 100:1 to 1:150, the mass ratio B2 is 600:1 to 1:300, the mass ratio B3 is 500:1 to 1:1000, the temperature W1 is 25 to 300°C, the reflux time T2 is 1 to 300h, the mass ratio B4 is 500:1 to 1:250000, and the dialysis time T3 is 1 to 400h; (3) PR, hydroxychloroquinoline sulfate and pMMP-1 were dissolved in deionized water at a mass ratio of C1, C2, C3 and C4, respectively, to obtain PR solution, hydroxychloroquinoline sulfate solution and pMMP-1 solution, respectively; the PR solution and hydroxychloroquinoline sulfate solution were mixed under stirring, and then the pMMP-1 solution was added to obtain a mixed solution HCQ / pMMP-1@PR, which was heated at 25°C. After standing for T4, the mixed solution HCQ / pMMP-1@PR was placed in a dialysis bag with a molecular weight cutoff of 7000, and the mixed solution HCQ / pMMP-1@PR was dialyzed with deionized water. The mass ratio of HCQ / pMMP-1@PR to deionized water was C5, the dialysis time was T5, and the deionized water was replaced once every 6 hours. After the dialysis time was reached, freeze-drying was performed to obtain a targeted co-delivery system HCQ / pMMP-1@PR based on pMMP-1 and HCQ; the mass ratio C1 was 1:5:10~ 900:100:1, mass ratio C2 is 150:1~1:250, mass ratio C3 is 100:1~1:200, mass ratio C4 is 300:1~1:30000, standing time T4 is 1~200min, mass ratio C5 is 1000:1~1: 5000000, dialysis time T5 is 0.5~500h.

2. A method for preparing the targeted co-delivery system based on pMMP-1 and hydroxychloroquine according to claim 1, characterized in that The steps include: (1) Dissolve retinol succinate in N,N-dimethylformamide (DMF) to obtain a DMF solution of retinol succinate, wherein the mass ratio of retinol succinate to DMF is A1, and then SH-PEG 2K - NH2, benzotriazole-1-yl-oxytripyrrolidinophosphine hexafluorophosphate PyBOP and N,N-diisopropylethylamine DIPEA were added to the DMF solution of retinol succinate, and retinol succinate and SH-PEG 2K The mass ratio of -NH2 is A2, the mass ratio of retinyl succinate and PyBOP is A3, and the mass ratio of retinyl succinate and DIPEA is A4; the reaction time is T1 at 25°C, and the SH-PEG is obtained by rotary evaporation under reduced pressure. 2K -ROL solution, SH-PEG 2K -ROL solution was added to ice ether and washed 4 times. 2K The mass ratio of -ROL to glacial ether is A5, and the precipitate is collected and vacuum dried to obtain SH-PEG. 2K -ROL; mass ratio A1 is 20:1 to 1:500, mass ratio A2 is 30:1 to 1:100, mass ratio A3 is 35:1 to 1:100, mass ratio A4 is 100:1 to 1:400, reaction time T1 is 0.1 to 40h, and mass ratio A5 is 200:1 to 1:8000; (2) SH-PEG with a mass ratio of B1 2K -ROL and PS were dissolved in dimethyl sulfoxide (DMSO), SH-PEG 2K The mass ratio of -ROL to DMSO is B2, the mass ratio of PS to DMSO is B3, and the SH- PEG 2K -ROL DMSO solution was added dropwise to PS DMSO solution, and after reflux time T2 at temperature W1, the reaction yielded PS-SH-PEG. 2K -ROL solution, dialyzing the reaction mixture in deionized water using a dialysis bag with a molecular weight cutoff of 7000, replacing deionized water every 6 hours, the mass ratio of PR to deionized water is B4, and after dialysis time T3, freeze-drying is performed to obtain a targeted nano drug delivery system PR; the mass ratio B1 is 100:1 to 1:150, the mass ratio B2 is 600:1 to 1:300, the mass ratio B3 is 500:1 to 1:1000, the temperature W1 is 25 to 300°C, the reflux time T2 is 1 to 300h, the mass ratio B4 is 500:1 to 1:250000, and the dialysis time T3 is 1 to 400h; (3) PR, hydroxychloroquinoline sulfate and pMMP-1 were dissolved in deionized water at a mass ratio of C1, C2, C3 and C4, respectively, to obtain PR solution, hydroxychloroquinoline sulfate solution and pMMP-1 solution, respectively; the PR solution and hydroxychloroquinoline sulfate solution were mixed under stirring, and then the pMMP-1 solution was added to obtain a mixed solution HCQ / pMMP-1@PR, which was heated at 25°C. After standing for T4, the mixed solution HCQ / pMMP-1@PR was placed in a dialysis bag with a molecular weight cutoff of 7000, and the mixed solution HCQ / pMMP-1@PR was dialyzed with deionized water. The mass ratio of HCQ / pMMP-1@PR to deionized water was C5, the dialysis time was T5, and the deionized water was replaced once every 6 hours. After the dialysis time was reached, freeze-drying was performed to obtain a targeted co-delivery system HCQ / pMMP-1@PR based on pMMP-1 and HCQ; the mass ratio C1 was 1:5:10~ 900:100:1, mass ratio C2 is 150:1~1:250, mass ratio C3 is 100:1~1:200, mass ratio C4 is 300:1~1:30000, standing time T4 is 1~200min, mass ratio C5 is 1000:1~1: 5000000, dialysis time T5 is 0.5~500h.

3. A use of a targeted co-delivery system based on pMMP-1 and hydroxychloroquine prepared according to the method of claim 2 in the preparation of a drug for treating liver fibrosis, wherein the targeted co-delivery system based on pMMP-1 and hydroxychloroquine is used for targeted delivery to hepatic stellate cells, thereby exerting a better therapeutic effect on liver fibrosis, achieving targeted drug delivery to aHSCs, reducing the impact on other types of liver cells, inhibiting the activation of HSCs, the main driving cells of liver fibrosis, and promoting the degradation of extracellular matrix, thereby effectively exerting a synergistic anti-liver fibrosis effect of the drug.

Images