Bacillus velezensis and application of bacillus velezensis in preparation of biocontrol inoculant and composite agent for preventing and treating tobacco fusarium root rot

Abstract

The invention belongs to the technical field of biological control, and particularly discloses bacillus velezensis and application of the bacillus velezensis to preparation of a biocontrol agent and a composite agent for controlling tobacco fusarium root rot, the strain is bacillus velezensis N4, is preserved in China General Microbiological Culture Collection Center on September 23, 2024, and has the preservation number of CGMCC NO. The preservation number is CGMCC (China General Microbiological Culture Collection Center) NO.32040, and the preservation address is No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The bacillus velezensis N4 provided by the invention has the capability of efficiently antagonizing tobacco root rot fungi F. tobactrum sp. Nov., and has an obvious antibacterial effect on a plurality of plant pathogenic fungi; after the bacillus velezensis N4 wettable powder disclosed by the invention is combined with a chemical agent propiconazole in the field, the bacillus velezensis N4 wettable powder has a good control effect on tobacco root rot and can promote the growth of tobacco plants, and the control effect is improved while the application of chemical pesticides is reduced.

Description

Technical Field

[0001] The invention relates to the technical field of biological control, in particular to Bacillus velez and application of the bacillus velez in the preparation of a biological control agent and a composite agent for controlling tobacco Fusarium root rot. Background Art

[0002] tobacco( Nicotiana tabacum Nicotiana tabacum L.) is an annual or limited perennial herb of the Solanaceae family, with important economic value.

[0003] At present, the main methods used in the prevention and control of tobacco diseases are the application of disease-resistant varieties, agricultural control, chemical control and biological control. However, since the pathogens that harm the root tissues of tobacco are soil-borne pathogens, the use of agricultural control measures such as the application of disease-resistant varieties and crop rotation takes a long time and has a long cycle, which has certain limitations; and the long-term use of chemical pesticides has caused the pathogens to develop drug resistance while destroying the microecological environment of the soil, aggravating the pollution of the environment by pesticides, and causing excessive residues of tobacco toxic substances. Biological control has become a research hotspot for the prevention and control of soil-borne plant diseases at home and abroad due to its environmental friendliness, no drug residues, and green and sustainable development, and has a relatively broad application prospect. The combined application of biological agents and chemical pesticides in the prevention and control of crop diseases has attracted more and more attention. The combined application of chemical fungicides and biocontrol bacteria to prevent and control tobacco root rot is of great significance for the scientific and green prevention and control of tobacco root rot, ensuring the safety of tobacco production in Jilin Province, and promoting the healthy and sustainable development of the tobacco industry.

[0004] Therefore, there is an urgent need to develop biocontrol agents for preventing and controlling tobacco Fusarium root rot and composite agents for combined application with chemical pesticides. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a Bacillus Velezii and its application in preparing a biocontrol agent and a composite agent for preventing and controlling tobacco Fusarium root rot.

[0006] To achieve the above object, the present invention is implemented according to the following technical solutions: One of the technical solutions of the present invention is a Velez bacteria, which is a Velez bacteria ( Bacillus velezensis ) N4, deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on September 23, 2024, with the deposit number CGMCC NO.32040, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0007] The second technical solution of the present invention is the use of Bacillus Velezii in the preparation of a biocontrol agent for preventing and controlling tobacco Fusarium root rot.

[0008] The third technical solution of the present invention is a biocontrol agent for preventing and controlling tobacco Fusarium root rot, comprising the Bacillus Velezii, and the formulation of the biocontrol agent is a wettable powder.

[0009] Furthermore, the wettable powder is composed of the following components in percentage by mass: 84% of mother powder mixed with Bacillus Velez fermentation liquid using diatomaceous earth as a carrier, 4.8% of sodium lignin sulfonate, 7.2% of polyethylene glycol, 2% of xanthan gum, 1% of ascorbic acid, and 1% of soluble starch, wherein the mass ratio of diatomaceous earth to Bacillus Velez fermentation liquid is 1 g: 2.5 mL; the effective viable bacteria count in the wettable powder reaches 1.65×10 9 cfu / g.

[0010] Furthermore, the culture medium used in the preparation of the Velez subtilis fermentation broth is composed of the following components in mass percentage: 2.0% yeast extract, 1.5% soy peptone, and 0.3% NaCl; the culture conditions are: the inoculation amount of the Velez subtilis seed liquid is 1%, the bottling volume is 60 mL / 250 mL, the pH is 6, the temperature is 28-30°C, and the rotation speed is 180 rpm; the number of viable bacteria in the obtained Velez subtilis fermentation broth reaches 2.3×10 10 cfu / mL.

[0011] A fourth technical solution of the present invention is a composite agent for preventing and controlling tobacco Fusarium root rot, which is composed of the biocontrol agent and propiconazole emulsifiable concentrate, the mass ratio of the propiconazole emulsifiable concentrate to the biocontrol agent is 1:60, and the active ingredient content of the propiconazole emulsifiable concentrate is 250 g / L.

[0012] Compared with the prior art, the present invention has the following beneficial effects: 1) The present invention provides a Velez subtilis N4, which has high efficiency in antagonizing tobacco root rot pathogens. F. tobaccum sp. nov., and has obvious antibacterial effects on a variety of plant pathogenic fungi.

[0013] 2) After the Bacillus Velez N4 wettable powder of the present invention is used in combination with the chemical agent propiconazole in the field, it has a good control effect on tobacco root rot and can promote the growth of tobacco plants, thereby reducing the application of chemical pesticides and improving the control effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 For some biocontrol bacteria F. tobaccum The inhibitory effect on the mycelial growth of sp. nov.

[0015] Figure 2Morphological identification of Bacillus Velez N4: A is the colony morphology; B is Gram staining; C is the bacterial morphology observed under an electron microscope.

[0016] Figure 3 Phylogenetic tree of strain N4 constructed based on 16S rDNA sequence.

[0017] Figure 4 Based on yrA Phylogenetic tree of strain N4 constructed from gene sequences.

[0018] Figure 5 Based on ikB Phylogenetic tree of strain N4 constructed from gene sequences.

[0019] Figure 6 This is the effect of different components and concentrations in the fermentation medium on the production of Bacillus Velez N4 and its antibacterial activity.

[0020] Figure 7 The effects of different environmental conditions on the production of Bacillus Velez N4 and its antibacterial activity.

[0021] Figure 8 Figure 3. The number of viable bacteria and antibacterial effect in the fermentation broth of Bacillus Velez N4 before and after optimization: A is the number of viable bacteria before optimization; B is the antibacterial effect before optimization; C is the number of viable bacteria after optimization; D is the antibacterial effect after optimization. DETAILED DESCRIPTION

[0022] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and are not used to limit the invention.

[0023] Example 1. Screening and identification of Bacillus Velezii N4 The plate confrontation method was used to determine the laboratory-preserved samples as shown in Table 1. Figure 1 The biocontrol bacteria shown are effective against Fusarium spp. F. tobaccum sp. nov.), among which Y-502-4, B-206-1, N4, B-293-13 and T-0225-2 had obvious inhibitory effects, and the inhibition rates were 57.89%~65.12%, respectively. Further combined with the results of compatibility test between chemical agents and biocontrol strains, three biocontrol bacteria, Y-502-4, N4 and B-206-1, which had good compatibility with propiconazole, were selected for screening the optimal ratio of bacterial-drug combination, and finally N4 strain was determined as the subsequent research material, as shown in Table 2.

[0024]

[0025] 2. Strain N4 was identified by combining morphological characteristics observation, physiological and biochemical index determination and multi-gene molecular sequencing analysis.

[0026] 1) Colony morphology and physiological and biochemical characteristics of strain N4 The colonies of strain N4 on NA medium are white, oval in shape, opaque with irregular edges, and a clear protrusion in the middle of the colony; under an electron microscope, the bacterial morphology is rod-shaped with flagella; Gram staining is positive, such as Figure 2 .

[0027] The physiological and biochemical characteristics of strain N4 are as follows: catalase, oxidase reaction, nitrate reduction, and gelatin liquefaction tests are all positive, phenylalanine and indole production tests are negative, it can utilize glucose, sucrose, and starch, but cannot utilize maltose, lactose, mannitol, sorbitol, inositol, and citrate; it can grow in medium containing 2%, 5%, 7%, and 10% NaCl; it cannot utilize citrate; VP reaction is positive; and it does not produce fluorescent pigments. As shown in Table 3. Combining the morphological characteristics and the results of physiological and biochemical characteristics, it is preliminarily determined that strain N4 belongs to the genus Bacillus ( Bacillus ).

[0028] Table 3 Physiological and biochemical characteristics of strain N4

[0029] 2) Molecular sequencing analysis of strain N4 Based on 16S rDNA, yrA and ikB The phylogenetic tree of strain N4 was constructed, as Figures 3-5 .

[0030] The sequencing results of the 16S rDNA amplification product of strain N4 are as follows:

[0031] Strain N4 yrA The sequencing results of the amplified products are as follows: GGGGCATGCATGAGCGTTATCGTATCCCGGGCGCTTCCGGATGTGCGTGACGGTCTGAAGCCGGTTCACAGGCGGATTTTGTACGCAATGAATGATTTAGGCATGACCAGTGACAAACCATATAAAAAATCTGCCCGTATCGTCGGTGAAGTTATCGGTAAGTACCACCCGCACGGTGACTCAGCGGTTTACGAATCAATGGTCAGAATGGCGCAGGATTTTAACTACCGCTACATGCTTGTTGACGGACACGGCAACTTCGGTTCGGTTGACGGCGACTCAGCGGCCGCGATGCGTTACACAGAAGCGAGAATGTCAAAAATCGCAATGGAAATCCTCCGGGACATTACGAAAGATACGATTGATTATCAAGATAACTATGACGGCGCAGAAAGAGAACCTGTCGTCATGCCTTCGAGATTTCCGAATCTGCTCGTAAACGGAGCTGCCGGTATTGCGGTCGGAATGGCGACAAATATTCCTCCGCATCAGCTTGGGGAAGTCATTGAAGGCGTGCTTGCCGTAAGTGAGAATCCTGAGATTACAAACCAGGAGCTGATGGAATACATCCCGGGCCCGGATTTTCCGACTGCAGGTCAGATTTTGGGCCGGAGCGGCATCCGCAAGGCATATGAATCCGGACGGGGATCCATTACGATCCGGGCTAAGGCTGAAATCGAAGAGACATCATCGGGAAAAGAAAGAATTATTGTCACAGAACTTCCTTATCAGGTGAACAAAGCGAGATTAATTGAAAAAATCGCAGATCTTGTCCGGGACAAAAAAATCGAAGGAATTACCGATCTGCGTGACGAATCCGACCGTAACGGAATGAGAATCGTCATTGAGATCCGCCGTGACGCCAATGCTCACGTCATTTTGAATAACCTGTACAAACAAACGGCCCTGCAGACGTCTTTCGGAATCAACCTGCTGGCGCTCGTTGACGCCCAGTG。

[0032] of strain N4 ikBThe sequencing results of the amplified products are as follows:

[0033] The 16S rDNA molecular sequencing results of strain N4 were compared with MEGA11.0 software to construct a phylogenetic tree. It was found that strain N4 was closely related to various Bacillus spp. Bacillus sp. strains have a similarity of 100%. yrA Molecular sequencing results were compared with those of Bacillus velez Bacillus velezensis The similarity of strain K1 is 100%, ikB Molecular sequencing results were compared with those of Bacillus velez Bacillus velezensis The similarity of strain Y3 was 99.58%.

[0034] Combined with morphological observation, physiological and biochemical characteristics and molecular sequencing analysis, strain N4 was finally identified as a strain of Bacillus velezinsis ( Bacillus velezensis ), named Bacillus Velez Bacillus velezensis ) N4, and was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on September 23, 2024, with the deposit number CGMCC NO.32040, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0035] Example 2: Optimization of shake flask fermentation conditions of strain N4 and preparation of wettable powder The shake flask fermentation conditions of Bacillus velez N4 were optimized by single factor experiment combined with response surface methodology. The optimal medium formula was determined as follows: 2.0% yeast extract, 1.5% soy peptone, and 0.3% NaCl. The optimal culture conditions were as follows: bottling volume 60 mL / 250 mL, inoculation volume 1%, pH 6, temperature 28-30℃, and rotation speed 180 rpm. Compared with before optimization, the number of viable bacteria in the fermentation broth reached 2.3×10 10 cfu / mL, which was 13.66 times higher than that before optimization.

[0036] In this example, a biocontrol agent for preventing and controlling tobacco Fusarium root rot was prepared, and its formulation was a wettable powder. Therefore, the carrier and adjuvant of the N4 strain were screened based on the suspension rate, moisture content, wetting time, etc., and the optimal formula of the N4 wettable powder was determined to be: 84% (1g: 2.5 mL) of mother powder mixed with diatomaceous earth as a carrier and Bacillus Velez fermentation liquid, 4.8% sodium lignin sulfonate, 7.2% polyethylene glycol, 2% xanthan gum, 1% ascorbic acid, and 1% soluble starch. The effective viable bacteria count of the microbial agent created according to this formula reached 1.65×10 9 cfu / g, suspension rate was 85.62%, moisture content was 2.38%, wetting time was 6.72 s, pH was 6.83, fineness was 97.20%, and all quality indicators were in line with national standards.

[0037] Example 3: Preparation of a composite agent for preventing and treating tobacco Fusarium root rot and optimization of the optimal ratio The composite agents were prepared by mixing 250 g / L propiconazole emulsifiable concentrate and 1 billion cfu / g N4 wettable powder at different mass ratios of 1:10, 1:20, 1:30, 1:40, 1:50, 1:60, 1:70, 1:80, 1:90, and 1:100. The mycelium growth rate method was used to determine the efficacy of the composite agents on tobacco root rot pathogens. F. tobaccum sp. nov. inhibitory effect on mycelial growth.

[0038] Table 4 Compounding of propiconazole and N4 wettable powder F. tobaccum Inhibition of hyphae growth of sp. nov.

[0039] From Table 4, it can be determined that the optimal ratio of the composite agent is 1:60, a mass ratio of 250 g / L propiconazole emulsifiable concentrate to 1 billion cfu / g N4 wettable powder.

[0040] Example 4: Evaluation of the field control effect of the composite agent on tobacco root rot After planting tobacco, a compound agent of a biocontrol agent prepared with Bacillus Velez N4 as raw material and propiconazole was applied according to the optimal compounding ratio of 1:60. Different application times and different application dosages of the compound agent were set in the field.

[0041] Table 5 Field control effects of different fungus-drug combination treatments on tobacco Fusarium root rot

[0042] As shown in Table 5, the combined application of propiconazole and N4 microbial agent showed a good control effect on tobacco root rot in the field. The average control effect of the three surveys reached 70.60~84.90%, which was higher than the effect of the single application of the agent. While improving the control effect, it also reduced the application of chemical pesticides. In order to study the effect of different treatments of microbial and drug combination on tobacco yield, different treatment groups were designed as shown in Table 6, and the plant height, stem diameter, number of leaves, maximum leaf area and chlorophyll content of tobacco plants were measured.

[0043] Table 6 Effects of different treatments of fungus-drug combination on tobacco yield

[0044] As shown in Table 6, the compound pesticide treatment had different degrees of promoting effect on tobacco plant height, stem diameter, leaf number, maximum leaf area and chlorophyll content.

[0045] In summary, the Velez subtilis N4 of the present invention has high efficiency in antagonizing tobacco root rot bacteria. F. tobaccum sp. nov., and has obvious antibacterial effect on various plant pathogenic fungi. After the Bacillus Velezii N4 wettable powder of the present invention is used in the field in combination with the chemical agent propiconazole, it has a good control effect on tobacco root rot and can promote the growth of tobacco plants, while reducing the application of chemical pesticides and improving the control effect.

[0046] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A Bacillus Velez, characterized in that This strain is Bacillus Velez Bacillus velezensis ) N4, deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on September 23, 2024, with the deposit number CGMCC NO.32040, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

2. Use of the Bacillus Velezii as claimed in claim 1 in the preparation of a biocontrol agent for preventing and controlling tobacco Fusarium root rot.

3. A biocontrol agent for preventing and treating tobacco Fusarium root rot, characterized in that: The method comprises the Bacillus Velezii as claimed in claim 1.

4. The biocontrol agent for preventing and controlling tobacco Fusarium root rot according to claim 3, characterized in that: Its dosage form is wettable powder.

5. The biocontrol agent for preventing and controlling tobacco Fusarium root rot according to claim 4, characterized in that: The wettable powder is composed of the following components in percentage by mass: 84% of mother powder mixed with Bacillus Velez fermentation liquid using diatomaceous earth as a carrier, 4.8% of sodium lignin sulfonate, 7.2% of polyethylene glycol, 2% of xanthan gum, 1% of ascorbic acid, and 1% of soluble starch, wherein the mass ratio of diatomaceous earth to Bacillus Velez fermentation liquid is 1:2.5; the effective viable bacteria count in the wettable powder reaches 1.65×10 9 cfu / g.

6. The biocontrol agent for preventing and controlling tobacco Fusarium root rot according to claim 5, characterized in that: The culture medium used in the preparation of the Velez subtilis fermentation liquid is composed of the following components in mass percentage: 2.0% yeast extract, 1.5% soy peptone, and 0.3% NaCl; the culture conditions are: the inoculation amount of the Velez subtilis seed liquid is 1%, the bottling volume is 60 mL / 250 mL, the pH is 6, the temperature is 28-30°C, and the rotation speed is 180 rpm; the number of viable bacteria in the obtained Velez subtilis fermentation liquid reaches 2.3×10 10 cfu / mL.

7. A composite agent for preventing and treating tobacco Fusarium root rot, characterized in that: The invention is composed of the biocontrol agent according to any one of claims 4 to 6 and propiconazole emulsifiable concentrate, wherein the mass ratio of the propiconazole emulsifiable concentrate to the biocontrol agent is 1:60, and the active ingredient content of the propiconazole emulsifiable concentrate is 250 g / L.

Images