Construction method and application of bacterial sensor for sensing iron and magnesium ions

Abstract

The invention discloses a construction method and application of a bacterial sensor for sensing iron and magnesium ions. The invention belongs to the field of microorganisms, and particularly relates to a construction method and application of a bacterial sensor for sensing iron and magnesium ions. The recombinant escherichia coli contains a super-folded green fluorescent protein sfGFP coding gene, a sensing protein PmrB mutant coding gene, a response regulatory protein PmrA mutant coding gene, a signal transduction protein PmrD coding gene and a strong ribosome binding site RBS. The gene contains a T7 RNA polymerase coding gene driven by a promoter of phosphorylase PmrG activated by regulatory protein PmrA and an sfGFP coding gene driven by a T7 promoter, and meanwhile, overexpresses a phosphoethanolamine transferase EptA coding gene. The bacterial sensor for detecting the concentration of iron ions is constructed, modification of lipopolysaccharide of the bacterial sensor can be changed through induction of iron and magnesium ions, and drug resistance of bacteria is enhanced.

Description

Technical Field

[0001] The invention belongs to the field of microorganisms, and in particular relates to a construction method of a bacterial sensor for sensing iron and magnesium ions and an application thereof. Background Art

[0002] Iron is an essential nutrient for all living organisms, and key metabolism in organisms cannot be separated from the participation of iron. However, excessive iron is very harmful to organisms because it reacts with oxygen to form hydroxyl radicals, which damage macromolecules in the body after a large amount of accumulation, and eventually lead to cell death. Many intestinal bacteria sense extracellular iron ions through the two-component system (TCS) on the cell membrane, and regulate the transcriptional expression of a series of genes in the cell through signal transduction, which not only enables bacteria to resist oxidative stress and avoid iron poisoning in a high-iron environment, but also increases the positive charge modification of bacterial lipopolysaccharide (LPS), preventing peptide antibiotics from lysing the cell membrane, thereby enhancing the resistance of intestinal bacteria to polymyxins; at the same time, it helps bacteria escape the recognition of the host immune system, changes the inflammatory response, reduces the host's clearance of bacteria, and thus enhances the pathogenicity of bacteria. Moreover, the imbalance of iron homeostasis in the body causes changes in the intestinal flora, which is closely related to the occurrence of metabolic diseases. Therefore, it is important to monitor the iron ion concentration in the body, which indicates changes in bacterial resistance and pathogenicity.

[0003] LPS is composed of three parts: lipid A, core oligosaccharide and O-polysaccharide antigen. Figure 1 A in the middle). Lipid A is inserted into the outer membrane, connected to the core oligosaccharide, and the O-polysaccharide is located on the outermost side. Lipid A is the most important bacterial endotoxin, composed of β-(1-6')-diglucosamine connected by acetylated fatty chains, and has phosphate groups modified at their 1st and 4' positions ( Figure 1 The structure of lipid A is relatively conservative, but it is sometimes modified by positively charged compounds ( Figure 1 E. coli senses high concentrations of iron ions in the environment through the two-component system PmrA-PmrB ( Figure 2 ). The two-component system consists of a histidine kinase sensor protein (Histidine Kinase, HK) located on the cell membrane and a response regulator protein (Response Regulator, RR) located in the cytoplasm. The former can sense one or more external environmental stimuli, and the kinase is activated, causing the response regulator protein to be phosphorylated. The phosphorylated response regulator protein binds to the promoter of a series of bacterial genes, promoting the expression of these genes. High concentrations of iron ions and low pH can induce the activation of the sensor protein PmrB, phosphorylating the response regulator protein PmrA and binding to the pmr operon (containing eptA, pmrA, pmrB, pmrR genes) and the arn operon (containing arnT , arnB etc.) and other genes ( eptC , pmr , ugd ) on the promoter of the gene, activating the expression of these genes to produce enzymes. EptA is a phosphoethanolamine (pEtN) transferase, and ArnT is a 4-amino-4-deoxy-L-arabinose (L-Ara4N) transferase. They connect the positively charged phosphoethanolamine or L-Ara4N to the two glucosamines of lipid A, preventing the connection of phosphate groups, thereby increasing the positive charge of LPS and reducing the negative charge. At the same time, another two-component system PhoQ-PhoP can activate the sensor protein PhoQ at low concentrations of magnesium ions and low pH, phosphorylating another response regulatory protein PhoP in the cell, activating pmd At present, it has not been confirmed that the PmrD protein of Escherichia coli can promote the phosphorylation of PmrA, but it has been proved that the PmrD protein of Salmonella can promote the phosphorylation of PmrA, linking these two two-component systems together. Since LPS is located on the surface of bacteria, the increased positive charge on the surface of bacteria repels external cationic cyclic lipopeptide antibiotics (CAMP) such as polymyxin B, preventing CAMP from inserting into the lysed cell membrane, thus enhancing the drug resistance of bacteria. Summary of the invention

[0004] The main problem to be solved by the present invention is how to detect iron ions in the environment by biological methods.

[0005] In order to solve the above problems, the present invention provides a recombinant Escherichia coli, which can be used as a bacterial sensor for detecting iron ion concentration.

[0006] The recombinant Escherichia coli provided by the present invention contains a superfolded green fluorescent protein sfGFP encoding gene, a sensing protein PmrB mutant encoding gene and a response regulatory protein PmrA mutant encoding gene, a signal transduction protein PmrD encoding gene and a strong ribosome binding site RBS, and contains a T7 RNA polymerase encoding gene regulated by a promoter of a phosphorylase PmrG activated by PmrA and a superfolded green fluorescent protein sfGFP encoding gene regulated by a T7 promoter, and simultaneously over-expresses a phosphoethanolamine transferase EptA encoding gene.

[0007] In the above recombinant Escherichia coli, the superfolded green fluorescent protein sfGFP can be any of the following proteins: A1) The amino acid sequence is SEQ ID No: 1; A2) a protein having at least 80% identity with the protein shown in A1) obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in A1); A3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2); The sensor protein PmrB mutant can be any of the following proteins: B1) The amino acid sequence is SEQ ID No: 2; B2) a protein having at least 80% identity with the protein shown in B1) obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in B1); B3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of B1) or B2); The response regulatory protein PmrA mutant may be any of the following proteins: C1) The amino acid sequence is SEQ ID No: 3; C2) a protein having at least 80% identity with the protein shown in C1) obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in C1), C3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of C1) or C2); The signal transduction protein PmrD can be any of the following proteins: D1) The amino acid sequence is SEQ ID No: 4; D2) a protein having more than 80% identity with the protein shown in D1) obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence shown in D1); D3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of D1) or D2); The T7 RNA polymerase may be any of the following proteins: E1) amino acid sequence is SEQ ID No: 14; E2) a protein having more than 80% identity with the protein shown in E1) obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence shown in E1); E3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of E1) or E2); The phosphoethanolamine phosphotransferase EptA can be any of the following proteins: F1) whose amino acid sequence is SEQ ID No: 13; F2) a protein having more than 80% identity with the protein shown in F1) obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in F1); F3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of F1) or F2).

[0008] In the above recombinant Escherichia coli, the PmrD is derived from the PmrD of Salmonella, and its amino acid sequence can be SEQ ID No: 4. pmd The nucleotide sequence of Escherichia coli is codon-optimized, and its nucleotide sequence may be SEQ ID No: 9. pmd Replaced with Salmonella pmd It enables Escherichia coli to sense low concentrations of magnesium ions through the PhoP / PhoQ two-component system, enhancing pmr expression.

[0009] The recombinant Escherichia coli contains a T7 RNA polymerase expression cassette, and the T7 RNA polymerase expression cassette contains pmr The promoter and pmr The promoter drives the T7 RNA polymerase encoding gene, pmr The nucleotide sequence of the promoter may be SEQ ID No: 10, and the nucleotide sequence of the T7 RNA polymerase encoding gene may be the sequence located at 750421-753072 in the Escherichia coli BL21 (DE3) genome (GenBank No. CP001509.3; updated on February 6, 2017). The nucleotide sequence of the expression cassette of the T7 RNA polymerase gene and its PmrG promoter is SEQ ID No: 11.

[0010] The recombinant Escherichia coli contains a superfolded green fluorescent protein sfGFP expression cassette, the sfGFP expression cassette contains a T7 promoter and a sfGFP encoding gene driven by the T7 promoter, the T7 RNA polymerase described above binds to the T7 promoter on the vector to initiate the expression of the sfGFP, the nucleotide sequence of the T7 promoter is 5'-TAATACGACTCACTATAGG-3', and the sfGFP encoding gene sequence can be SEQ ID No: 6. The nucleotide sequence of the expression cassette of the sfGFP gene and its promoter is SEQ ID No: 12.

[0011] The recombinant Escherichia coli contains an eptA expression cassette, and the eptA expression cassette contains an eptA encoding gene sequence. The eptA encoding gene sequence may be a sequence located at c4333947-4335590 in the genome of Escherichia coli MG1655 (GenBank: U00096.3; updated on November 6, 2024).

[0012] The expression of the eptA encoding gene is driven by the araBAD promoter on the vector.

[0013] Furthermore, in the above-mentioned recombinant Escherichia coli, the nucleotide sequence of the superfolded green fluorescent protein sfGFP encoding gene is SEQ ID No: 6; The nucleotide sequence of the gene encoding the sensor protein PmrB mutant is SEQ ID No: 7; The nucleotide sequence of the gene encoding the response regulatory protein PmrA mutant is SEQ ID No: 8; The nucleotide sequence of the gene encoding the signal transduction protein PmrD is SEQ ID No: 9; The nucleotide sequence of the promoter of the phosphorylase PmrG is SEQ ID No: 10; The nucleotide sequence of the T7 RNA polymerase encoding gene is the sequence located at 750421-753072 in the Escherichia coli BL21 (DE3) genome (GenBank: CP001509.3; updated on February 6, 2017); The nucleotide sequence of the phosphoethanolamine phosphotransferase eptA encoding gene is a sequence located at c4333947-4335590 in the genome of Escherichia coli MG1655 (GenBank: U00096.3; updated on November 6, 2024).

[0014] The recombinant Escherichia coli described above is constructed by the following method, which comprises: 1) Inject the recipient E. coli into pmr and B Gene mutation modification; 2) The superfolded green fluorescent protein (sfGFP) encoding gene described above is introduced into the recipient Escherichia coli pmr and B between genes; 3) The recipient E. coli pmd Replaced with Salmonella pmd ; 4) Replace the ribosome binding site of the pmr operon of the recipient E. coli described above with a strong RBS site; 5) Using the response regulatory protein PmrA to regulate the expression of the T7 RNA polymerase of the recipient Escherichia coli described above; the regulation can specifically be regulating the promoter of the T7 RNA polymerase, and the promoter of the T7 RNA polymerase can be pmr promoter; 6) Using the T7 RNA polymerase described in 5) to regulate the expression of the sfGFP encoding gene, the regulation may specifically be regulating the promoter of sfGFP, and the promoter of sfGFP is a T7 promoter; 7) Overexpression of the receptors described above in E. coli eptA Gene.

[0015] In the present invention, the recipient Escherichia coli is Escherichia coli MG1655. The present invention also provides the use of the method described above in any of the following: 1) Preparation of bacterial sensors that sense iron and magnesium ions; 2) Prepare products for detecting iron ion concentration in the environment; 3) Obtaining Escherichia coli lipopolysaccharide endotoxin with increased positive charge modification; 4) Improve bacterial resistance to polymyxin B.

[0016] The present invention also provides the use of the Escherichia coli described above in any of the following: 1) Preparation of bacterial sensors that sense iron and magnesium ions; 2) Detect the iron ion concentration in the environment.

[0017] The present invention also provides a method for preparing a bacterial sensor for sensing iron and magnesium ions, comprising culturing the recombinant Escherichia coli described above, and centrifuging the fermentation product to obtain the bacterial sensor.

[0018] The bacterial sensor can detect 50-300 μM iron ions. Within this range, the higher the iron ion concentration, the stronger the fluorescence of the bacteria.

[0019] The bacterial sensor was also able to sense 10 μM magnesium ions.

[0020] The present invention uses CRISPR / Cas9 editing technology to genetically modify the two-component system PmrA-PmrB of Escherichia coli and construct a fluorescent bacterial sensor. The construction circuit diagram is as follows: Figure 3 Using E. coli MG1655 as the base cell, the superfolder green fluorescent protein (sfGFP) gene was integrated into the pCas / pTargetF double plasmid. pmr Operon pmr and Bstrain MG1655::sfGFP was obtained between genes. μ Under the induction of M iron ions, the strain only emitted weak fluorescence.

[0021] In order to improve the sensitivity of the sensor, B and pmr Multiple mutations were performed at various sites to enhance PcqI The binding of iron ions and PcqI for signal transduction; at the same time, the pmd Replaced with Salmonella pmd Escherichia coli senses low concentrations of magnesium ions through the PhoP / PhoQ two-component system, enhancing pmr expression; pmr The ribosome binding site (RBS) of the operon was replaced with a strong RBS site to obtain the genetically engineered strain MG-WY5. Finally, plasmid pBAD-EptA and plasmid pT7RNAP-sfGFP were constructed and transformed into strain MG-WY5 to increase the expression of EptA and sfGFP, and the final biosensor MG-WY5 (pBAD-EptA, pT7RNAP-sfGFP) was obtained. The biosensor can detect 50-300 μ M of iron ions. Within this range, the higher the iron ion concentration, the stronger the fluorescence of the bacteria. It was further found that at 300 μ M iron ions and 10 μ Under the induction of magnesium ions, the bacterial resistance to polymyxin B was significantly enhanced, almost 100 times that of MG1655::sfGFP; the chemical structure of lipid A of the bacterial sensor LPS was detected by MULTI-TOF-MS, and the results showed that the diglucosamine of lipid A was modified by phosphoethanolamine (pEtN) and L-Ara4N.

[0022] The invention discloses a method for constructing a bacterial sensor for detecting iron ion concentration. The modification of lipopolysaccharide of the bacterial sensor can be changed by induction of iron ions and low magnesium ions, thereby enhancing the drug resistance of bacteria. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The structure of LPS and the modification of lipid A. A. Lipopolysaccharide LPS is composed of lipid A (Lipid A), core oligosaccharide (Core) and O-polysaccharide antigen (O-antigen); B. The 1-position and 4'-position of the diglucosamine of lipid A are modified by phosphoethanolamine (pEtN) or 4-amino-4-deoxy-L-arabinose (L-Ara4N).

[0024] Figure 2Escherichia coli senses external signals such as iron and magnesium ions through the two-component systems PmrA-PmrB and PhoQ-PhoP.

[0025] Figure 3 Schematic diagram for constructing a bacterial sensor for sensing iron and magnesium ions.

[0026] Figure 4 The plasmid maps for constructing bacterial sensors. A, the map of plasmid pBAD-EptA; B, the map of plasmid pT7RNAP-sfGFP.

[0027] Figure 5 To detect the concentration of iron ions using a bacterial sensor. A. Use a fluorescence microscope to observe the luminescence of bacteria induced by different concentrations of iron ions; B. Use a flow cytometer to detect and analyze the fluorescence intensity of bacteria induced by different concentrations of iron ions, and the accurate detection range of iron ions is 50-300 μM; C. Use an enzyme marker to detect the fluorescence intensity of the bacterial sensor induced by different concentrations of iron ions, and the accurate detection range of iron ions is 50-300 μM; D. Use ferric chloride with final concentrations of 0 μM, 1 μM, 10 μM, 25 μM, 50 μM, 100 μM, and 300 μM to induce bacterial luminescence, obtain fluorescence values, and use GraphPad_Prism software to make a standard curve. Use a nonlinear regression curve to fit the data and obtain the Hill equation formula. Among them, Y is the fluorescence signal and X is the log value of the concentration of ferric chloride. The iron ion concentration in the sample can be calculated based on the standard curve formula and the fluorescence intensity of the sample.

[0028] Figure 6 Analysis of the bacterial sensor's resistance to polymyxin B before and after induction.

[0029] Figure 7 Chemical structural analysis of lipid A as a bacterial sensor. DETAILED DESCRIPTION

[0030] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0031] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0032] Unless otherwise specified, the quantitative tests in the following examples were performed three times and the results were averaged.

[0033] The E. coli MG1655 strain in the following examples is described in the document “Cas9-Assisted Targeting of Chromosome segments CATCH enables one-step targeted cloning of large gene clusters. Nature Communications, 2015, DOI: 10.1038 / ncomms9101.” The public can obtain the biological material from the applicant, and the biological material is only used for repeating the experiment of the present invention and cannot be used for other purposes.

[0034] The plasmids pCas and pTargetF in the following examples are described in the literature "Yu Jiang, Biao Chen, Chunlan Duan, Bingbing Sun, Junjie Yang, Sheng Yang. Multigene Editing in the Escherichia coli Genome via the CRISPR-Cas9 System. Applied and Environmental Microbiology, 2015, 81(7):2506-2514". The public can obtain the biological material from the applicant, and the biological material is only used for repeating the experiment of the present invention and cannot be used for other purposes.

[0035] The plasmid pPAS used in the following examples is described in the literature "Xuejin Zhao, Weijia Wei, Yeqing Zong, Chaoxian Bai, Xian Guo, Hua Zhu, Chunbo Lou. Novel switchable ECF sigmafactor transcription system for improving thaxtomin A production in vitro Streptomyces . Synthetic and Systems Biotechnology, 2022, 7: 972-981”. The public can obtain the biological material from the applicant, and the biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0036] The Escherichia coli BL21 (DE3) in the following examples is described in the document “Sinyeon Kim, HaeyoungJeong, Eun-Youn Kim, Jihyun F. Kim, Sang Yup Lee and Sung Ho Yoon, Genomic and transcriptomic landscape of Escherichia coli BL21 (DE3). Nucleic Acids Research, 2017, 45 (9): 5285–5293”. The public can obtain the biological material from the applicant, and the biological material is only used for repeating the experiment of the present invention and cannot be used for other purposes.

[0037] The basic medium formula in the following examples is shown in Table 1. The pH is adjusted to 7.2 or 5.8 with HCL and filtered with a 0.22 μM water filter. When preparing solid medium, 15 g agar powder is added to each liter of liquid medium and sterilized at 121° C. for 20 min.

[0038] Table 1. Basic culture medium formula

[0039] Preparation of the ferric chloride solution in the following examples: FeCl3·6H2O was prepared into a 100 mM stock solution with purified water, boiled to dissolve completely, cooled to room temperature and then diluted with 0.22 μM Filter through membrane and set aside.

[0040] Preparation of the magnesium chloride solution in the following example: MgCl2·6H2O was prepared into a 10mM stock solution with purified water, and the volume was fixed after complete dissolution. μM Filter through membrane and set aside.

[0041] Example 1. Construction of fluorescent bacterial sensor The codon-optimized strong green fluorescent reporter gene sfGFP was inserted into the pmrA gene of the pmr operon of the genome by CRISPR / Cas9 technology to obtain the engineered strain MG1655::sfGFP. The specific operation method is as follows: 1. Obtain strain MG1655 (pCas) containing plasmid pCas Electrocompetent cells of Escherichia coli MG1655 were prepared according to conventional methods, and then plasmid pCas was transformed into competent cells by electroporation, and transformants were screened using LB solid medium containing 50 μg / mL kanamycin. Primer pairs pCas-check-F and pCas-check-R were used to verify whether the plasmid had been transformed into bacteria by colony PCR, and the MG1655 strain containing plasmid pCas was obtained and named MG1655 (pCas). Among them, pCas-check-F: 5'-gagatggcgaaagtagatgatagtttct-3'; pCas-check-R: 5'-aagctgtaatttagcatcttctgcc-3'.

[0042] Then, the strain was cultured overnight in 3 mL LB liquid medium containing 50 μg / mL kanamycin at 30°C for about 12 hours, and the bacterial suspension was transferred to fresh LB liquid medium at a ratio of 1:100 and cultured until the OD 600nm 0.2-0.3, add L-arabinose to a final concentration of 10 mM, and continue to culture the bacteria until the OD 600nm The pCas plasmid was induced to express Cas9 endonuclease (GenBank No. WP_011285506.1) at 0.5-0.6, and then electroporated competent cells of strain MG1655 (pCas) were prepared according to conventional methods.

[0043] 2. Obtaining the engineered strain MG-WY1 The green fluorescent protein sfGFP gene, which was codon-optimized according to Escherichia coli, was inserted into the MG1655 genome. pmr and B The nucleotide sequence of sfGFP is SEQ ID No:1.

[0044] (1) Obtaining donor DNA fragments Respectively sfGFP Primers were designed upstream and downstream of the gene insertion site. Using the genome of MG1655 as a template, the upstream fragment was amplified with primer pair pmrA1 / pmrA2, and the downstream fragment was amplified with primer pair pmrA5 / pmrA6. The size of both fragments was 500 bp. At the same time, pPAS was used as a template and primer pair pmrA3 / pmrA4 was used to amplify sfGFPGene, fragment size is 717bp; KOD FX high-fidelity DNA polymerase (TOYOBO Bio-Technology, CO., LTD, catalog number KFX-101) was used for amplification, and the PCR product was purified using a kit. The three fragments were then used as templates for fusion PCR as donor DNA. The specific primer sequence information is as follows: pmrA1: 5'-GAAGGCTACGCGTGCGATAG-3'; pmrA2: 5'-ACAGCTCTTCGCCTTTACGCATCAGATTCAATTAGTTTTCCTCAT-3'; pmrA3: 5'-ATGAGGAAAACTAATTGAATCTGATGCGTAAAGGCGAAGAGCTGT-3'; pmrA4: 5'-TTGGTCGGCGCAGAAAATGCATTCATTTGTACAGTTCATCCAT-3'; pmrA5: 5'-TATGGATGAACTGTACAAATGAATGCATTTTCTGCGCCGACCAAT-3'; pmrA6: 5'-AATAGCAGGGTTTGCTGTCGCT-3'.

[0045] (2) Construction of plasmid pTargetF-gfpN20 Using plasmid pTargetF as a template, circular PCR was performed with primer pair pmrA-N1 / pmrA-N2 to obtain circular PCR products and transform Escherichia coli DH5a competent cells (Tiangen Biochemical Technology Co., Ltd., catalog number CB101). Transformants were selected using LB medium containing 100 μg / mL spectinomycin, and the plasmid was extracted using a kit (Tiangen Biochemical Technology Co., Ltd., catalog number DP103-03). PCR identification was performed with primer pair N20-Check-F / N20-Check-R and the DNA sequence was verified by sequencing to obtain plasmid pTargetF-gfpN20.

[0046] The structure of the pTargetF-gfpN20 vector is described as follows: a recombinant vector is obtained by inserting a DNA fragment with a sequence of 5'-ACGGCTGATATTGACCATCG-3' between the 5'-gtcctaggtataatactagt-3' and 5'-gttttagagctagaaatagc-3' fragments of the starting vector pTargetF, while keeping other sequences of the vector pTargetF unchanged.

[0047] Design the N20 sequence of the sgRNA into the primer, marked with an underline: pmrA-N1:5'- ACGGCTGATATTGACCATCG GTTTTAGAGCTAGAAATAGCAAG-3'; pmrA-N2: 5'- CGATGGTCAATATCAGCCGT ACTAGTATTATACCTAGGACTGAGC-3'; N20-Check-F: 5'-TTATCCCCTGATTCTGTGGATAACCG-3'; N20-Check-R: 5'-CTGATGGAGCTGCACATGAAC-3'.

[0048] (3) Obtaining strain MG-WY1 The pTargetF-gfpN20 obtained in step (2) and the donor DNA obtained in step (1) were mixed at a ratio of 1:4 and added to MG1655 (pCas) electroporation competent cells for electroporation. Immediately after electroporation, 1 mL of LB medium containing 50 μg / mL kanamycin was added. After continued cultivation at 30°C for 1 hour, 100 μL of the bacterial solution was spread on an LB plate containing 50 μg / mL kanamycin and 100 μg / mL spectinomycin and cultured overnight at 30°C. Colony PCR was performed on single colonies using the following primer pairs to identify sfGFP Insertion of the gene and both plasmids were confirmed by sequencing sfGFP The gene is integrated into pmr The strain was named MG1655::sfGFP (pCas, pTargetF-gfpN20).

[0049] in sfGFP The insertion of the gene was identified with pmrA--check-F / pmrA-heck-R, the plasmid pTargetF-gfpN20 was identified with pTF-check-F / pTF-check-R, and the plasmid pCas was identified with pCas-check-F / pCas-check-R. The specific primer sequences are as follows: pmrA-check-F: 5'-GCTATATGCTGGTCGCGAATGAGGAAAAC-3'; PmrA-check-R: 5'-AGCGATATTGGTCGGCGCAGAAAA-3'; pTF-check-F: 5'-GGGGATGATAAGTTTATCACCACCGA-3'; pTF-check-R: 5'-GGCAACGCTATGTTCTCTTGC-3'; pCas-check-F: 5'-GAGATGGCGAAAGTAGATGATAGTTTCT-3'; pCas-check-R: 5'-AAGCTGTAATTTAGCATCTTCTGCC-3'.

[0050] (4) Plasmid pTargetF-gfpN20 is lost Plasmid pTargetF-gfpN20 was lost according to the method described in the literature (Applied and Environmental Microbiology, 2015, 81(7): 2506-2514). The specific method is as follows: Bacteria were cultured in LB liquid medium containing 50 µg / mL kanamycin and 1mM IPTG at 30°C for 16 hours, and IPTG induced the loss of the plasmid. The bacteria were diluted and spread on LB solid medium containing 50 µg / mL kanamycin for further culture. Single colonies were picked and spotted on the corresponding positions of LB solid plates containing kanamycin and spectinomycin, and the bacteria were continued to be cultured at 30°C. The corresponding colonies that did not grow on the streptomycin plate but grew on the kanamycin plate were selected, and the primer pair pTF-check-F and pTF-check-R were used to verify whether the plasmid pTargetF-gfpN20 was lost by PCR, and the strain MG1655::sfGFP(pCas) containing only the plasmid pCas was obtained for subsequent genetic modification of the genome.

[0051] Finally, the temperature-sensitive plasmid pCas was lost. The specific method is as follows: culture bacteria MG1655::sfGFP(pCas) at 37°C overnight, spot single colonies on the corresponding positions of the plate without antibiotics and the plate containing 50 µg / mL kanamycin, continue to culture bacteria at 37°C, select the corresponding colonies that grow on the plate without antibiotics but not on the kanamycin plate, and perform colony PCR with primers pCas-check-F and pCas-check-R to verify whether the plasmid pCas is lost, and finally obtain strain MG-WY1.

[0052] Example 2: Optimization of bacterial sensor 1. Yes B Point mutation (1) Obtaining a fusion DNA fragment with a point mutation In order to mutate the 14th amino acid leucine (L) of the PmrB protein to arginine (R), the 93rd amino acid arginine (R) to proline (P), and the 206th amino acid glycine (G) to aspartic acid (D), it is necessary to change CTG in the pmrB gene sequence to CGG, CGC to CCC, and GGT to GAT. The mutant nucleotide sequence of the PmrB protein is shown in SEQ ID No:7.

[0053] The specific method is as follows: B The mutation sites were designed into primers, and genomic DNA of MG1655 was used as a template. PCR amplification was performed with primers PmrB-1 / PmrB-2 and PmrB-3 / PmrB-4 to obtain PCR products 1 and 2. PCR products 1 and 2 were purified and used as templates, and primer pair PmrB-1 / PmrB-4 was used to obtain fusion PCR product A.

[0054] Using MG1655 as a template, PCR amplification was performed using primer pairs PmrB-5 / PmrB-6 and PmrB-7 / PmrB-8 to obtain PCR products 3 and 4. The PCR product was purified and used as a template to obtain fusion PCR product B using primers PmrB-5 / PmrB-8. The specific primer sequences are as follows: PmrB-1: 5'-TCTGCGCGACAAAGTGGGCAAA-3'; PmrB-2: 5'-TCTTTTTTGCAGCTCCGCCAGCGGGGGGGTGATGCGGCGTACCGCCTGATAGCAG-3'; PmrB-3: 5'-TCAGGCGGTACGCCGCATCACCCCCCCGCTGGCGGAGCTGCAAAAAGAGCT-3'; PmrB-4: 5'-CGCTGGTCGAGCATGGTACTGAG-3'; PmrB-5: 5'-CAGCCTGACGCTATTTATCTGCTATCAGG-3'; PmrB-6: 5'-CAGCAGTTTTTACATGTTGATAATTATCGGAAGAAAATGACTGTCCGGCACGCGCCAG-3'; PmrB-7: 5'-GCGTGCCGACAGTCATTTTCTTCCGATAATTATCAACATGTAAAACTGCTGGAAGAT-3'; PmrB-8: 5'-GTACCCAGGCCCGCGTGCCGGAAGTCT-3'.

[0055] (2) Construction of plasmid pTargetF-pmrN20 The N20 sequence (5'-CATCATGCGTGAGATCCGCG-3') was designed into primers PmrB-N1 and PmrB-N2 (underlined), and circular PCR was performed using plasmid pTargetF as a template. The circular PCR product was then transformed into E. coli DH5a competent cells, and transformants were selected using LB medium containing spectinomycin (the concentration of spectinomycin was 100 μg / mL). Plasmid extraction and identification were as described in step 2 of Example 1, and the plasmid was sequenced and verified, and named plasmid pTargetF-pmrN20.

[0056] The structure of plasmid pTargetF-pmrN20 is described as follows: a DNA fragment with a sequence of 5'-CATCATGCGTGAGATCCGCG-3' is inserted between the 5'-gtcctaggtataatactagt-3' and 5'-gttttagagctagaaatagc-3' fragments of the starting vector pTargetF, while keeping the other sequences of the vector pTargetF unchanged to obtain a recombinant vector. The specific primer sequences are as follows, in which the N20 sequence is underlined: PmrB-N1:5'- CATCATGCGTGAGATCCGCG GTTTTAGAGCTAGAAATAGCAAG-3'; PmrB-N2:5'- CGCGGATCTCACGCATGATG ACTAGTATTATACCTAGGACTGAGC-3'.

[0057] (3) Obtaining strain MG-WY2 First, the fusion PCR product A, fusion PCR product B and plasmid pTargetF-pmrN20 obtained in step (1) above were co-transformed into the electrocompetent cells of MG1655::sfGFP (pCas) in Example 1. The electroporated bacterial solution was spread on LB solid medium containing 50 µg / mL kanamycin and 100 µg / mL spectinomycin, and the bacteria were cultured at 30°C overnight to screen positive transformants. Single colonies were picked for colony PCR and sequencing detection. The nucleotide sequences were compared by NCBI blastn. The results showed that B A point mutation occurred within the gene, and the mutation site was correct, and the strain MG-WY2 containing the plasmid was obtained.

[0058] Subsequently, plasmids pTargetF-pmrN20 and pCas were deleted according to the method described in step 2 (4) of Example 1 to obtain engineered strain MG-WY2.

[0059] 2. Yes pmr Point mutation (1) Obtain pmr Fusion DNA fragments with gene point mutations In order to mutate the 105th amino acid leucine (L) of the PmrA protein to proline (P), pmr The CTG in the gene sequence was changed to CCG, and the encoding nucleotide sequence of the PmrA mutant protein was shown in SEQ ID No:8.

[0060] The specific method is as follows: The mutation site of the PmrA protein is designed into the primer. The genomic DNA of MG1655 is used as a template, and the primers PmrA-1 / PmrA-2 and PmrA-3 / PmrA-4 are used for PCR amplification to obtain PCR products a and b. PCR products a and b are purified and used as templates, and then the primer pair PmrA-1 / PmrA-4 is used for fusion PCR amplification to obtain fusion PCR product c. The specific primer sequences are as follows: pmrA-P1: 5'-TGAATCGTTAGGTGAAAATGGCATCTATCTGCACGG-3'; pmrA-P2: 5'-GGCGCGGATACGGGCATGTAACTCTTCCGGCGCAAAAGGCTTCACCAGATAG-3'; pmrA-P3: 5'-TATCTGGTGAAGCCTTTTGCGCCGGAAGAGTTACATGCCCGTATCCGCGCCC-3'; pmrA-P4: 5'-TGCTCGGTACTTTCATGCCATAGCCAGAAGA-3'.

[0061] (2) Obtaining strain MG-WY3 The above fusion PCR product c was transformed into the electrocompetent cell MG-WY2 containing plasmids pCas and pTargetF-pmrN20. Single colonies were screened according to the method described above, and PCR detection and sequencing verification were performed. The sequence was compared by NCBI blastn. The results showed that pmr The correct point mutation site was obtained in the gene. Then, the plasmid pTargetF-pmrN20 and plasmid pCas were deleted according to the method described in step 2 (4) of Example 1 to obtain the engineered strain MG-WY3.

[0062] 3. The E. coli pmd Gene replacement into Salmonella pmd Gene (1) Obtaining Salmonella pmd Fusion DNA fragments of genes First, the Salmonella pmd The gene was codon optimized according to Escherichia coli and obtained pmd The nucleotide sequence is shown in SEQ ID No: 9. The above-mentioned pmd Gene.

[0063] The primer pairs pmrD1 / pmrD2 and pmrD5 / pmrD6 were used to amplify the MG1655 genome. pmd The upstream fragment a and downstream fragment c of the gene were PCR amplified using primer pair pmrD3 / pmrD4 to pmd PCR amplification was performed with pmrD1 as the template to obtain fragment b. Finally, the three fragments were mixed (the connection order was abc) and fusion PCR amplification was performed with primers pmrD1 / pmrD6 to obtain fragment b containing Salmonella. pmd The fusion DNA fragment of the gene. The primer sequences are as follows: pmrD1: 5'-GGCTGCCAGTATGGCAGAAGGTTAC-3'; pmrD2: 5'-CCATTCCATAGCGCCCCCGTTGCATTATCCTGTTTGCTAAGAGTTTTCACATC-3'; pmrD3: 5'-CTTAGCAAACAGGATAATGCAACGGGGGCGCTATGGAATG-3'; pmrD4: 5'-CCTGCCCACGACAAAACAACGTTAGCTCGGTTTACGGGTCAGACGC-3'; pmrD5: 5'-TGACCCGTAAACCGAGCTAACGTTGTTTTGTCGTGGGCAGGAAAATC-3'; pmrD6: 5'-TAATGGGCCTGATGTGGGGATTATTCAGC-3'.

[0064] (2) Construction of plasmid pTargetF-pmrDN20 The N20 sequence (5'-GGCTATAACTGCTTGCCGAG-3') was designed into primers PmrD-N1 and PmrD-N2, and circular PCR was performed using plasmid pTarget F as a template to obtain circular PCR products. The circular PCR products were then transformed into Escherichia coli DH5a competent cells, and transformants were selected using LB medium containing 100 µg / mL spectinomycin. Plasmid extraction and identification were as described above, and the plasmid was verified by sequencing and named pTargetF-pmrDN20.

[0065] The structure of plasmid pTargetF-pmrDN20 is described as follows: a DNA fragment with a sequence of 5'-GGCTATAACTGCTTGCCGAG-3' is inserted between the 5'-gtcctaggtataatactagt-3' and 5'-gttttagagctagaaatagc-3' fragments of the starting vector pTargetF, and the other sequences of the vector pTargetF remain unchanged to obtain a recombinant vector. The specific primer sequences are as follows, in which the N20 sequence is underlined: PmrD-N1:5'- GGCTATAACTGCTTGCCGAG GTTTTAGAGCTAGAAATAGCAAG-3'; PmrD-N2:5'- CTCGGCAAGCAGTTATAGCC ACTAGTATTATACCTAGGACTGAGC-3'.

[0066] (3) Obtaining strain MG-WY4 The Salmonella-containing pmd The fusion DNA fragment of the gene was transformed into the electrocompetent cell MG-WY3 containing pCas and pTargetF-pmrDN20, and single colonies were screened according to the method described above, and PCR detection and sequencing verification were performed. The results showed that the Escherichia coli pmd The sequence has been successfully replaced with that of Salmonella pmd sequence.

[0067] Subsequently, plasmids pTargetF-pmrDN20 and pCas were deleted according to the method described in step 2 of Example 1 to obtain engineered strain MG-WY4.

[0068] 4. Replacement of ribosome binding sites In order to further improve the transcriptional expression level of the gene and enhance the sensitivity of the sensor to iron ions, the original ribosome binding site (RBS) nucleotide sequence 5'-TGTTCGATGGAAACCGTG-3' in the pmr operon was replaced with the nucleotide sequence of a strong RBS 5'-AGAAAGAGGAGAAAACCGTG-3' (SEQ ID No: 5).

[0069] (1) Obtaining fusion DNA fragments PCR amplification was performed using primers Pmr-P1 / Pmr-P2 and Pmr-P3 / Pmr-P4 with genomic DNA of MG1655 as templates to obtain PCR products D and E. PCR products D and E were purified and used as templates for fusion PCR amplification using primer pair PmrA-P1 / PmrA-P4 to obtain PCR product F. Strong RBS sequences were designed into the primers and marked with underscores. The primer sequences are as follows: Pmr-P1: 5'-GGCGGGGCTGATTATCGTCGGTATTTTG-3'; Pmr-P2: 5'- CACGGTTTTCTCCTCTTTCT AAGTGCGCATATGCTCGCAAAATTATATT AAGCCAACCTTAAGTTCTTAAGGTTGGCTTTTATGTT-3'; Pmr-P3: 5'- TTAATATAATTTTGCGAGCATATGCGCACTT AGAAAGAGGAGAAAACCGTG ATGTTGAAGCGCCTACTAAAAAGAC-3'; Pmr-P4: 5'-GCCGCTGAATCCCAGCGTTAATAACATTTG-3'; (2) Construction of plasmid pTargetF-RBSN20 The N20 sequence of sgRNA 5'-GTAATTCAGCGCATACATGG-3' was designed into primers Pmr-N1 and Pmr-N2, and circular PCR was performed with plasmid pTarget F as a template to obtain circular PCR products. The circular PCR products were then transformed into Escherichia coli DH5a competent cells, and transformants were selected using LB medium containing 100 µg / mL spectinomycin. The plasmid was extracted, and the primer identification method was as described above. The sequencing-verified plasmid was named pTargetF-RBSN20.

[0070] The structure of the pTargetF-RBSN20 vector is described as follows: a recombinant vector is obtained by inserting a DNA fragment with a sequence of 5'-GTAATTCAGCGCATACATGG-3' between the 5'-gtcctaggtataatactagt-3' and 5'-gttttagagctagaaatagc-3' fragments of the starting vector pTargetF, while keeping the other sequences of the vector pTargetF unchanged. The specific primer sequences are as follows, and the N20 sequence is underlined: Pmr-N1: 5'- GTAATTCAGCGCATACATGG GTTTTAGAGCTAGAAATAGCAAG-3'; Pmr-N2: 5'- CCATGTATGCGCTGAATTAC ACTAGTATTATACCTAGGACTGAGC-3'.

[0071] (3) Obtaining strain MG-WY5 The purified fusion PCR product C and plasmid pTargetF-RBSN20 were co-transformed into the electrocompetent cell MG-WY4 containing the pCas plasmid. Single colonies were screened and PCR detection and sequencing verification were performed according to the method described above. The results showed that the original RBS sequence in the strain had been replaced by a strong RBS sequence.

[0072] Subsequently, the two plasmids were lost according to the method described in step 2 (4) of Example 1 to obtain the engineered strain MG-WY5.

[0073] 5. Construction of overexpression plasmids pBAD-EptA and pT7RNAP-sfGFP 1) Construction of overexpression plasmid pBAD-EptA Using the genomic DNA of MG1655 as a template, PCR amplification was performed with primers pBAD-eptA-P1 / pBAD-eptA-P2, and KpnI and HindⅢ restriction sites and protective bases were added to the 5' end of the primers to obtain DNA fragment S.

[0074] pBAD-eptA-P1:5'-CGG GGTACC ATGTTGAAGCGCCTACTAAAAAGAC-3'; pBAD-eptA-P2:5'-CCC AAGCTT TCATTCACTCACTCTCCTGCAA-3' (the underline is the restriction site).

[0075] The PCR product was purified using a kit and digested with KpnI and HindⅢ. At the same time, the expression vector pBAD43 (NewPu Biotech Co., Ltd., catalog number V012781) was digested with KpnI and HindⅢ. The DNA fragment S and the linear vector pBAD43 were connected with T4 DNA ligase. The ligation product was transformed into Escherichia coli DH5α competent cells and 100 µ g / mL spectinomycin was used to select transformants, and plasmids were extracted using a kit, identified by enzyme digestion, and successfully obtained after sequencing. The plasmid map is shown in Figure 4 As shown in A.

[0076] The structure of pBAD-EptA vector is described as follows: it is inserted between the KpnI and HindⅢ restriction sites of the starting vector pBAD43 eptA Gene, a recombinant vector obtained by keeping other sequences of vector pBAD43 unchanged. eptA The nucleotide sequence of the gene is the sequence located at c4333947-4335590 in the genome of Escherichia coli MG1655 (GenBank No. U00096.3; updated on November 6, 2024). The pBAD-EptA vector can express the EptA protein, and its amino acid sequence is SEQ ID No:13.

[0077] 2) Construction of overexpression plasmid pT7RNAP-sfGFP Using the vector pPAS as a template, PCR amplification was performed with primers pmrG-1 / pmrG-2 to obtain a plasmid containing a T7 promoter. sfGFP The gene was then ligated into the vector pGEM-T Easy (Promega, Cat. No. A1360) and transformed into DH5α competent cells. µ g / mL ampicillin was used to select transformants, and single colonies were picked, the plasmid was extracted and identified by PCR to obtain the plasmid pGEM-T-sfGFP.

[0078] The structure of plasmid pGEM-T-sfGFP is described as follows: a DNA fragment with a sequence of SEQ ID No: 1 is inserted between the 5'-GCCGCGGGAATTCGAT-3' and 5'-ATCCGGATATAGTTC-3' fragments downstream of the T7 promoter of the starting vector pGEM-T Easy, and the other sequences of the starting vector pGEM-T Easy are kept unchanged to obtain a recombinant vector.

[0079] Using the MG1655 genome as a template, PCR amplification was performed using primer pair pmrG-3 / pmrG-4 to obtain pmrThe promoter fragment upstream of the gene (the nucleotide sequence of the promoter is SEQ ID No: 10); using the genome of Escherichia coli BL21 (DE3) as a template, PCR amplification was performed with primer pair pmrG-5 / pmrG-6 to obtain the T7 RNA polymerase gene; then, using these two fragments as templates, fusion PCR was performed with primer pair pmrG-3 / pmrG-6 to obtain pmr The promoter and T7 RNAP fused DNA fragment Q.

[0080] The primer sequences are as follows (the underlined bases are PciI restriction sites): pmrG-1: 5'-ATGCGTAAAGGCGAAGAGCTG-3'; pmrG-2: 5'-TCATTTGTACAGTTCATCCATACCATG-3'; pmrG-3:5'-GCG ACATGT TGAATACCTGTCCACTTATATTTGC-3'; pmrG-4: 5'-CGTTCTTAGCGATGTTAATCGTGTTCATGTAAACTCCACCTATAGACAAGC-3'; pmrG-5: 5'-GCTTGTCTATAGGTGGAGTTTACATGAACACGATTAACATCGCTAAGAACG-3'; pmrG-6:5'-GCG ACATGT GAGTCGTATTGATTTGGCGTTACGCGAA-3'.

[0081] The fusion DNA fragment Q was digested with PciI, dephosphorylated and ligated to the PciI-digested plasmid pGEM-T-sfGFP. The ligation product was transformed into DH5α competent cells, and transformants were selected with 100 µg / mL ampicillin. The plasmid was extracted and identified by PciI digestion. After sequencing, the plasmid pT7RNAP-sfGFP ( Figure 4 Middle B).

[0082] The structure of the pT7RNAP-sfGFP vector is described as follows: an expression cassette of T7 RNA polymerase (i.e. PcqIThe promoter sequence SEQ ID No: 10 and the DNA fragment of the T7 RNA polymerase encoding gene connected thereto) were added to obtain the recombinant vector, while keeping the other sequences of the vector pGEM-T-sfGFP unchanged. The nucleotide sequence of the T7 RNA polymerase encoding gene is the sequence located at 750421-753072 in the Escherichia coli BL21 (DE3) genome (GenBank: CP001509.3; updated on February 6, 2017).

[0083] 6. Obtaining optimized bacterial sensors Prepare competent cells of MG-WY5 strain according to conventional methods, then transform the plasmids pBAD-EptA and pT7RNAP-sfGFP obtained in step 5 into competent cells of MG-WY5 strain, and add 100 μg of µ g / mL ampicillin and 100 µ The transformants were selected by LB solid medium containing 100 g / mL spectinomycin, and the plasmid was identified by PCR using the primers in the above step 5, and finally the engineered strain MG-WY5 (pBAD-EptA, pT7RNAP-sfGFP) was obtained, which is the bacterial sensor described below.

[0084] Example 3: Detection of iron ions using bacterial sensors 1. Cultivate bacterial sensors The engineered strain MG-WY5 (pBAD-EptA, pT7RNAP-sfGFP) obtained in Example 2 was inoculated into 3 mL LB medium containing 50 μg / mL ampicillin and 100 μg / mL spectinomycin, and the MG1655 strain was inoculated into LB medium as a control, and the bacteria were cultured in a shaking incubator at 37°C overnight.

[0085] The next day, the bacterial suspension was transferred to 3 mL of basic medium at a ratio of 1:100, and 10 μM magnesium chloride and different concentrations of ferric chloride were added to induce activation of the two-component system. The final concentrations of ferric chloride were: 0 μM, 10 μM, 50 μM, 100 μM, 200 μM, 300 μM, and 500 μM. The test tube was wrapped with tin foil and the bacteria were cultured in a shaker at 200 rpm and 37°C. When the bacteria grew to OD 600 When the pH value is 0.6, take 1 mL of bacterial culture solution into an Eppendorf tube, centrifuge at 5000 rpm for 5 minutes to collect the bacteria, then wash the bacteria twice with 1 mL of 1×PBS (pH 7.0), centrifuge at 5000 rpm for 5 minutes to collect the bacteria, resuspend them in 1 mL of 1×PBS, vortex to fully disperse the bacteria, wrap the test tube with tin foil, protect from light throughout the process, and place it at 4°C for 2 hours for subsequent observation and detection of bacterial fluorescence.

[0086] 2. Observe bacterial luminescence using a fluorescence microscope Take 3 uL of bacterial suspension and dilute it to 10 μ L, dropped onto a glass slide, covered with a coverslip, and the bacteria were observed using an oil objective of a fluorescence microscope with a magnification of 100 times and a uniform exposure time of 200 ms.

[0087] The results are as follows Figure 5 As shown in A. 10 μ M Ferric chloride induces bacteria to fluoresce, and as the concentration of ferric chloride increases, more bacteria emit strong green fluorescence.

[0088] 3. Detect the fluorescence intensity of bacteria using flow cytometry Take 0.5 mL of bacterial suspension and use a flow cytometer (BD FACSCalibur) to detect the fluorescence of bacteria. Set the gates: FSC E01, SSC 365, FL1 791, FL2 587, count the fluorescence signals of 30,000 bacteria, and take the logarithm. Use FlowJo software to analyze the data and obtain the median fluorescent intensity (MFI).

[0089] The results of flow cytometry were as follows Figure 5 As shown in B. The biosensor has an accurate detection range of 50-300 μM (i.e. 2.80-16.8 mg / L) for iron ions. Within this range, the higher the iron ion concentration, the stronger the fluorescence of the bacteria. When the concentration exceeds 300 μM, the fluorescence value decreases, showing a fluorescence quenching effect. Therefore, in practical applications, high-concentration iron ions can be diluted according to specific conditions and then detected using the biosensor.

[0090] 4. Detect the fluorescence intensity of bacteria using an ELISA reader Transfer 200 uL of bacterial suspension to a black 96-well microplate. Perform three replicates for each sample and use a microplate reader or fluorescence reader to detect the fluorescence intensity of the bacteria. The settings of the reader are: the excitation wavelength is 488nm, the scanning emission wavelength is 525nm, and the fluorescence intensity is expressed as a relative value in arbitrary units (AU). The test results are as follows: Figure 5 When using an ELISA reader, the biosensor has a detection range of 50-300 for iron ions. μ M, within this range, the higher the iron ion concentration, the stronger the bacterial fluorescence.

[0091] 5. Detect the iron ion concentration in the sample First prepare a standard curve ( Figure 5 C), with final concentrations of 0 μM, 1 μM , 10 μM , 25 μM , 50 μM , 100 μM , 300 μM The ferric chloride was added to induce bacteria to emit light, and the fluorescence value was obtained. The standard curve was prepared by GraphPad_Prism software, and the data was fitted with a nonlinear regression curve to obtain the value in the Hill equation formula Y=Bottom + (Top-Bottom) / (1+10^((LogEC50-X)*HillSlope)), where Y is the fluorescence intensity, that is, the bacterial fluorescence intensity after adding ferric chloride minus the bacterial fluorescence intensity of the blank control; X is the logarithmic value of the ferric chloride concentration; the fluorescence amount at the bottom plateau of the S curve (Bottom) and the fluorescence amount at the top plateau of the curve (Top) were obtained by the software, LogEC50 is the logarithmic value of the inducer TMAO concentration when the maximum fluorescence amount is half reached, and HillSlope is the Hill factor. The results are shown in Figure 2. Figure 5 As shown in D.

[0092] The concentration of iron ions in the sample can be calculated based on the standard curve formula and the fluorescence intensity of the sample. The standard curve formula is Y=5.728+53.82 / (1+10^((0.08359-X)×0.1787). Where Y is the fluorescence intensity; X is the logarithmic value of the ferric chloride concentration.

[0093] Example 4. Analysis of bacterial resistance to polymyxin B First, the engineered strain MG-WY5 (pBAD-EptA, pT7RNAP-sfGFP) bacteria were streaked on LB agar plates containing 100 μg / mL ampicillin and 100 μg / mL spectinomycin. Then, a single colony was inoculated into 3 mL of LB medium containing ampicillin and spectinomycin for overnight culture, and then transferred to 100 mL of basic medium (pH 7.0) at a ratio of 1:100. 300 μM FeCl3, 10 μM MgCl2, 100 μg / mL ampicillin, 100 μg / mL spectinomycin, and 0.02% L-arabinose were added to the medium. The culture was incubated at 37°C and 200 rpm on a shaker for 5h-6h until the OD600nm reached 0.6. The bacteria were counted using a bacterial counter to obtain 10 8CFU / mL bacterial suspension, then dilute the bacteria tenfold serially, take 5 μL of bacteria with different dilutions and spot them on the following three plates: 1) LB agar plate without polymyxin B; 2) LB agar plate containing 4 μg / mL polymyxin B and 300μM FeCl3; 3) LB agar plate containing 4 μg / mL polymyxin B, 300μM FeCl3 and 10μM MgCl2, and observe the bacterial growth after inverted incubation at 37℃ for 16 h.

[0094] The results showed that under the induction of 300μM FeCl3, the bacterial resistance to polymyxin B increased by 10 times; under the co-induction of 300μM FeCl3 and 10μM MgCl2, the bacterial resistance to polymyxin B increased by nearly 100 times ( Figure 6 ).

[0095] Example 5: Modification of lipopolysaccharide 1. Cultivation of engineered strain MG-WY5 (pBAD-EptA, pT7RNAP-sfGFP) The engineered strain MG-WY5 (pBAD-EptA, pT7RNAP-sfGFP) bacteria were activated as follows: First, the engineered strain MG-WY5 (pBAD-EptA, pT7RNAP-sfGFP) bacteria were streaked on LB agar plates containing 100 μg / mL ampicillin and 100 μg / mL spectinomycin. Then, a single colony was inoculated into 3 mL of LB medium containing ampicillin and spectinomycin for overnight culture. The cells were transferred to 2 L of minimal medium (pH < 7.0) at a ratio of 1:100, and the above-mentioned inducers (300 μM FeCl3 and 10 μM MgCl2) and antibiotics (ampicillin concentration was 100 μM) were added to the medium. μ g / mL and spectinomycin concentration was 100 μ g / mL), 37°C, 200 rpm shaking incubator until OD 600nm is 1.0.

[0096] 2. Extraction and purification of lipopolysaccharide and lipid A from the engineered strain MG-WY5 (pBAD-EptA, pT7RNAP-sfGFP) Collect bacterial cells by centrifugation, add 300 ml of cold acetone to wash the cells, place in a fume hood to evaporate, let stand to separate, and discard the upper solution. Add another 300 ml of acetone and repeat the above steps for a total of 4 times. Add ether and dry naturally to evaporate the acetone. Add 150 mL of 45% water-saturated phenol (pH 6.6) to the shrunken cells, extract crude LPS using the hot phenol water method, and dissolve in water. Obtain lipid A by hydrolyzing LPS with acetic acid according to the method described in the literature (Antimicrob Agents Chemother. 2018, 27;62(9): e00864-18). Hydrolyze LPS with 2% acetic acid at 100°C for 90 min, add an equal volume of chloroform:methanol (2:1, vol / vol), stir, centrifuge at 600 g for 15 min, and take the lower organic phase, which is lipids.

[0097] 3. Detection and analysis of lipid A The chemical structure of lipid A was analyzed by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MULTI-TOF-MS) in positive ion reflectron mode. Figure 7 ). Figure 7 In the middle ion mode, m / z 1716 is the unmodified monophosphohexanoyl lipid A; m / z 1796 is the unmodified diphosphohexanoyl lipid A; m / z 1954 is the monophosphohexanoyl lipid A modified with L-Ara4N; and m / z 2034 is the diphosphohexanoyl lipid A modified with phosphoethanolamine and L-Ara4N.

[0098] The results showed that inducing bacterial sensors by 300 μM iron ions and 10 μM magnesium ions could change the modification of bacterial lipopolysaccharide lipid A, resulting in an increase in the positive charge of LPS.

[0099] In conclusion, the bacterial sensor of the present invention can be used to detect the concentration of iron ions in the environment. The method of the present invention can improve the sensitivity of Escherichia coli to iron ions, change the chemical modification of Escherichia coli LPS endotoxin and enhance the drug resistance of bacteria.

[0100] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A recombinant Escherichia coli, characterized in that: The recombinant Escherichia coli contains a gene encoding a superfolded green fluorescent protein sfGFP, a gene encoding a sensor protein PmrB mutant, a gene encoding a response regulatory protein PmrA mutant, a gene encoding a signal transduction protein PmrD and a strong ribosome binding site RBS, and contains a T7 RNA polymerase encoding gene driven by a promoter of a phosphorylase PmrG and a sfGFP encoding gene driven by a T7 promoter, and simultaneously overexpresses a gene encoding a phosphoethanolamine transferase EptA.

2. The recombinant Escherichia coli according to claim 1, characterized in that: The superfolded green fluorescent protein sfGFP is any of the following proteins: A1) The amino acid sequence is SEQ ID No. 1; A2) a protein having at least 80% identity with the protein shown in A1) obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in A1); A3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2); The sensor protein PmrB mutant is any of the following proteins: B1) The amino acid sequence is SEQ ID No. 2; B2) a protein having more than 80% identity with the protein shown in B1) obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in B1); B3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of B1) or B2); The response regulatory protein PmrA mutant is any of the following proteins: C1) The amino acid sequence is SEQ ID No. 3; C2) a protein having at least 80% identity with the protein shown in C1) obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in C1), C3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of C1) or C2); The signal transduction protein PmrD is any of the following proteins: D1) The amino acid sequence is SEQ ID No. 4; D2) a protein having more than 80% identity with the protein shown in D1) obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence shown in D1); D3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of D1) or D2); The T7 RNA polymerase is any of the following proteins: E1) amino acid sequence is SEQ ID No: 14; E2) a protein having more than 80% identity with the protein shown in E1) obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence shown in E1); E3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of E1) or E2); The phosphoethanolamine phosphotransferase EptA is any one of the following proteins: F1) amino acid sequence is SEQ ID No: 13; F2) a protein having more than 80% identity with the protein shown in F1) obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in F1); F3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of F1) or F2).

3. The recombinant Escherichia coli according to claim 1 or 2, characterized in that: The nucleotide sequence of the strong ribosome binding site (RBS) in the recombinant Escherichia coli is SEQ ID No.

5.

4. The recombinant Escherichia coli according to any one of claims 1 to 3, characterized in that: The recombinant Escherichia coli pmd From Salmonella pmd .

5. The recombinant Escherichia coli according to any one of claims 1 to 4, characterized in that: The nucleotide sequence of the superfolded green fluorescent protein sfGFP encoding gene is SEQ ID No: 6; The nucleotide sequence of the gene encoding the sensor protein PmrB mutant is SEQ ID No: 7; The nucleotide sequence of the gene encoding the response regulatory protein PmrA mutant is SEQ ID No: 8; The nucleotide sequence of the gene encoding the signal transduction protein PmrD is SEQ ID No: 9; The nucleotide sequence of the promoter of the phosphorylase PmrG is SEQ ID No: 10; The nucleotide sequence of the T7 RNA polymerase encoding gene is the sequence located at 750421-753072 in the Escherichia coli BL21 (DE3) genome (GenBank: CP001509.3; updated on February 6, 2017); The nucleotide sequence of the phosphoethanolamine phosphotransferase EptA encoding gene is a sequence located at c4333947-4335590 in the genome of Escherichia coli MG1655 (GenBank: U00096.3; updated on November 6, 2024).

6. The recombinant Escherichia coli according to any one of claims 1 to 5, characterized in that: The recombinant Escherichia coli is constructed according to the method of claim 7.

7. A method for constructing a recombinant Escherichia coli, characterized in that: The method comprises: 1) Injecting any one of claims 1 to 5 into the recipient Escherichia coli pmr and B Gene mutation modification; 2) Integrating the superfolded green fluorescent protein sfGFP encoding gene described in any one of claims 1 to 5 into the genome of the recipient Escherichia coli pmr and B between genes; 3) the recipient Escherichia coli of any one of claims 1 to 5 pmd Replaced with Salmonella pmd ; 4) the recipient Escherichia coli of any one of claims 1 to 5 pmr The ribosome binding site of the operator was replaced with a strong RBS site; 5) Using the response regulatory protein PmrA to regulate the expression of T7 RNA polymerase in the recipient Escherichia coli of any one of claims 1 to 5; the regulation is to regulate the promoter of T7 RNA polymerase, and the promoter of T7 RNA polymerase is pmr promoter; 6) Using the T7 RNA polymerase described in 5) to regulate the receptor Escherichia coli of any one of claims 1 to 5 sfGFP The regulation of gene expression is to regulate the promoter of sfGFP, and the promoter of sfGFP is T7 promoter; 7) Overexpression of the receptor Escherichia coli according to any one of claims 1 to 5 eptA Gene.

8. The method of claim 7 used in any of the following: 1) Preparation of bacterial sensors that sense iron and magnesium ions; 2) Prepare products for detecting iron ion concentration in the environment; 3) Obtaining Escherichia coli lipopolysaccharide endotoxin with increased positive charge modification; 4) Improve bacterial resistance to polymyxin B.

9. Use of the Escherichia coli according to any one of claims 1 to 5 in any of the following: 1) Preparation of bacterial sensors that sense iron and magnesium ions; 2) Detect the iron ion concentration in the environment.

10. A method for preparing a bacterial sensor for sensing iron and magnesium ions, comprising culturing the recombinant Escherichia coli according to any one of claims 1 to 5, and centrifuging the fermentation product to obtain the bacterial sensor.

Images