A circular RNA targeting and inhibiting the replication of fish neuronecrosis virus and its preparation method and application
By preparing a circular RNA (NNV-circRNA-1) that specifically inhibits NNV replication and loading it on a lipid nanocarrier, combined with the NNV-RdRp protein, the problem of NNV replication was solved, the viral titer and mRNA level were significantly reduced, providing a new disease prevention and control method, and improving the economic benefits and ecological protection of fish farming.
Patent Information
- Application Number
- CN202510283520.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-11
- Publication Date
- 2025-09-09
- Estimated Expiration
- 2045-03-11
AI Technical Summary
Existing technologies lack effective methods to inhibit the replication of fish neural necrosis virus (NNV), resulting in high mortality and economic losses, and the application of circular RNA in virus-host interactions has not been fully developed.
A circular RNA (NNV-circRNA-1) that targets and inhibits NNV replication was designed and prepared, and loaded onto a lipid nanocarrier to form an NNV-circRNA-1 circular RNA preparation, which inhibits viral replication by specifically binding to the NNV-RdRp protein.
Significantly reduce NNV virus titer and mRNA level, provide a new means of disease prevention and control, reduce the risk of virus transmission, reduce the use of antibiotics, protect the ecological environment, and increase fish farming production and economic benefits.
Smart Images

Figure CN119776354B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedicine technology, and in particular to a circular RNA for targeted inhibition of fish neuronecrosis virus replication, and a preparation method and application thereof. Background Art
[0002] Fish Nervous Necrosis Virus (NNV) is a highly pathogenic RNA virus that causes significant economic losses to the global aquaculture industry. Viral nervous necrosis (VNN), caused by NNV infection, is a Category II infectious disease and is prevalent in marine fish species in nearly all regions of the world, except the Americas and Africa. It has an extremely high mortality rate for larvae and juveniles, with severe cases reaching 100% mortality within a week. The number of infected fish species and the extent of the damage have increased rapidly in recent years. NNV, a member of the Nodaviridae family, possesses a single-stranded positive-sense RNA genome composed of two major single-stranded RNA segments: RNA1 primarily encodes the RNA-dependent RNA polymerase (RdRp), while RNA2 encodes the capsid protein (CP), the sole structural protein of the virus. In addition, some NNV strains produce a subgenomic RNA3 encoding two nonstructural proteins, B1 and B2.
[0003] NNV, with its rapid spread and high mortality rate, poses a serious threat to many farmed fish species and causes huge economic losses. NNV mainly infects the central nervous system and retinal nervous system of fish, and can cause mass deaths of larvae and juvenile populations of many marine fish. Fish neuronecrosis viruses are sensitive to environmental factors, such as temperature and pH, which affect the stability and infectivity of the virus. They can induce metabolic reprogramming of host cells to meet the needs of viral replication and trigger a series of immune responses in the host. The viral neuronecrosis disease caused by NNV has caused serious economic losses to aquaculture fish. Therefore, the development of effective prevention and control measures, such as vaccines, antiviral drugs and biological immune products, is crucial to ensuring the sustainable development of the aquaculture industry.
[0004] In recent years, circular RNA (circRNA), a novel non-coding RNA molecule, has demonstrated its importance in regulating gene expression, participating in RNA-protein interactions, and serving as a disease marker. CircRNAs possess a unique closed circular structure, exhibiting greater stability and a longer half-life within cells compared to linear RNA. In NNV research, the application of circular RNA technology offers new insights into the interaction between viruses and hosts and may provide a potential tool for developing new therapeutic strategies. Summary of the Invention
[0005] The present invention aims to solve the above problems and provides a circular RNA for inhibiting the replication of fish neural necrosis virus, as well as a preparation method and application thereof.
[0006] The present invention adopts the following technical solution: a circular RNA that targets and inhibits the replication of fish neural necrosis virus, wherein the circular RNA is NNV-circRNA-1, and the nucleotide sequence is shown in SEQ ID NO: 1.
[0007] SEQ ID NO: 1:
[0008] GGGUAACAUCACCUUCUUGCUCUGUUGAGUAAUCACUUACGCAAG GUUACCGUUCAGCUUAGACAACGACAAGUCUACGCCAAGCUUGGUACC GAGCUCGG.
[0009] A circular RNA preparation that targets and inhibits the replication of fish neuronecrosis virus. The prepared circular RNA is loaded onto a lipid nanocarrier with a mass ratio of circular RNA to lipid nanocarrier of 1:10 to obtain an NNV-circRNA-1 circular RNA preparation.
[0010] Furthermore, the preparation method of the lipid nanocarrier is: 4-(N,N-dimethylamino)butyric acid (dilinoleyl) methyl ester DLin-MC3-DMA, distearoylphosphatidylcholine DSPC, cholesterol and DMG-PEG2000 are mixed in a mass ratio of 5:1:3.8:0.2 and added to an ethanol solution to prepare a lipid nanocarrier.
[0011] The invention discloses an application of a circular RNA preparation for the targeted inhibition of fish nervous necrosis virus replication, which is used for the preparation of vaccines and antiviral drugs for fish nervous necrosis virus.
[0012] The NNV viral genome consists of two single-stranded RNA segments, RNA1 encodes the non-structural protein RdRp (NNV-RdRp), and RNA2 encodes the main structural protein CP. The replication mechanism of NNV involves the virus entering the host cell through endocytosis, releasing the RNA genome, and using the host cell's machinery for replication and transcription. RdRp plays a central role in viral replication. It anchors on the mitochondrial membrane of the host cell through its mitochondrial membrane localization signal and can activate and bind to the glucose-regulated protein GRP78 in the endoplasmic reticulum. This process triggers the endoplasmic reticulum stress response, which in turn activates caspase-12, promotes PERK phosphorylation, and reduces the expression of the Bcl-2 gene, thereby providing favorable conditions for viral transcription and replication. Therefore, the normal binding of RdRp protein to the viral positive-strand RNA template is crucial for the correct replication and transcription of the NNV virus.
[0013] In the present invention, a circular RNA molecule capable of binding to NNV-RdRp protein was initially designed, then optimized using Alphafold3 software and verified through interaction experiments such as RNA-pulldown. Finally, a circular RNA molecule with strong binding ability to NNV-RdRp protein was designed, which was named circular RNANNV-circRNA-1. RNA pulldown molecular interaction experiments proved that circular RNANNV-circRNA-1 has a strong binding ability with NNV-RdRp protein.
[0014] Beneficial effects of the present invention: The circular RNA prepared by the present invention: NNV-circRNA-1 has a strong binding ability with the NNV-RdRp protein, good stability and high purity. The circular RNA preparation can significantly reduce the virus titer in cell culture by more than 90% in both post-NNV exposure treatment and pre-exposure prevention, and reduce the mRNA level of the NNV virus, providing a new disease prevention and control technical means for the fish farming industry, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Figure 1 Schematic diagram of the cyclization process of NNV-circRNA-1 of the present invention.
[0016] Figure 2 Schematic diagram of the direct interaction between NNV-circRNA-1 and NNV-RdRp protein of the present invention.
[0017] Figure 3 This is a gel electrophoresis analysis diagram of NNV-circRNA-1 and linear RNA of the present invention.
[0018] Figure 4This is a diagram showing the effect of the NNV-circRNA-1 circular RNA preparation of the present invention on the treatment after NNV virus exposure.
[0019] Figure 5 This is a diagram showing the effect of the NNV-circRNA-1 circular RNA preparation of the present invention on the prevention of NNV virus exposure before exposure.
[0020] Figure 6 This is the effect of the NNV-circRNA-1 circular RNA preparation of the present invention on the expression level of NNV virus mRNA during post-exposure treatment.
[0021] Figure 7 This figure shows the effect of the NNV-circRNA-1 circular RNA preparation of the present invention on the expression level of NNV virus mRNA during pre-exposure prevention.
[0022] Figure 8 Schematic diagram of NNV-circRNA-1 stability detection of the present invention. DETAILED DESCRIPTION
[0023] In order to enable those skilled in the art to better understand the solutions of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention.
[0024] Carp epithelial cells (EPCs) are a widely used cell model for fish immunology and virology research. EPCs are grown adherently in cell culture medium in a 5% CO2, 28°C incubator. EPCs are cultured in Medium 199 (Invitrogen) supplemented with 10% fetal bovine serum, 100 U / ml penicillin, and 100 mg / ml streptomycin. During virus culture, the cells are maintained in Medium 199 supplemented with only 2% fetal bovine serum.
[0025] The Nervous Necrosis Virus (NNV) in the present invention is stored in the National Aquatic Animal Pathogen Bank of the Ministry of Agriculture and Rural Affairs.
[0026] Example 1:
[0027] 1. Preparation of NNV-circRNA-1 circular RNA:
[0028] Its nucleotide sequence is
[0029] GGGUAACAUCACCUUCUUGCUCUGUUGAGUAAUCACUUACGCAAGGUUACCGUUCAGCUUAGACAACGACAAGUCUACGCCAAGCUUGGUACCGAGCUCGG.
[0030] (1) First, primers NNV-circRNA-1-F, whose sequence is SEQ ID NO: 2, and primers NNV-circRNA-1-R, whose sequence is SEQ ID NO: 3, were annealed to form a double-stranded DNA template. The specific steps were as follows: NNV-circRNA-1-F 10 μL (100 μM), NNV-circRNA-1-R 10 μL (100 μM), anneal according to the following procedure: 95°C for 5 min, 94°C-46°C (cooling at a rate of 1°C / min), 46°C-26°C (cooling at a rate of 2°C / min), and stored at 4°C. Transcribe linear RNA using T7 RNA polymerase and the DNA template annealed above. The specific steps are as follows: 1 μg DNA template, 2 μL T7 transcription buffer, 4 μL NTP mixture (10 mM), 0.1 μL T7 RNA polymerase (1 kU / μl), add nuclease-free pure water to 20 μL, and incubate at 37°C for 120 minutes;
[0031] (2) After the reaction is completed, the transcribed linear RNA is purified using the ethanol precipitation method. The specific steps are as follows: first, add 160 μL of nuclease-free pure water to expand the reaction volume to 180 μL, then add 20 μL of 3M sodium acetate (pH 5.2) or 20 μL of 5M ammonium acetate and mix thoroughly; add an equal volume of phenol / chloroform mixture (1:1) and extract once (vortex mix for 20-30 seconds, then centrifuge at 14000g for 5-10 minutes to collect the supernatant), then extract with chloroform 1-2 times (vortex mix for 20-30 seconds each time, then centrifuge at 14000g for 5-10 minutes to collect the supernatant). Precipitate the RNA with double the volume of anhydrous ethanol and incubate at -20℃ for at least 30 minutes. Then centrifuge at 14000g at 4℃ for 5-10 minutes to precipitate the RNA. Discard the supernatant, wash the precipitate with 500 μL of pre-chilled 70% ethanol, and resuspend and dissolve the RNA with 20 μL of nuclease-free pure water;
[0032] (3) Use T4 RNA ligase 1 to circularize the purified linear RNA. The specific steps are as follows: take 20 μM linear RNA, 2 μL T4 RNA ligase buffer, 1 μL 1 mM ATP, and 1 μL T4 RNA ligase 1, add nuclease-free pure water to 20 μL, incubate at 37°C for 1 hour, and purify the circularized RNA according to the above-mentioned ethanol precipitation method.
[0033] (4) Use RNase R enzyme to remove the residual linear RNA in the above reaction system. Take 20 μL of the above purified RNA and 3 μL of RNase R enzyme buffer, add 30 μL of nuclease-free pure water, incubate at 37°C for 30 minutes, and then purify the circularized RNA according to the above ethanol precipitation method to finally obtain the purified NNV-circRNA-1.
[0034] The process of NNV-circRNA-1 from linear to circular Figure 1 As shown by Figure 1 It can be seen that the linear RNA is formed by reverse splicing of the linker sequence 1, shown in SEQ ID NO: 4 (CCAAGCUUGGUACCGAGCUCGG) and the linker sequence 2 (GGGUAA). During the preparation process, the residual linear RNA in the reaction system was removed by RNase R enzyme. Figure 3 As can be seen from the gel electrophoresis diagram, after the linear RNA is treated with RNase R, the RNA band disappears, while the circular RNA band still exists after RNase R treatment, and the concentration is similar to the RNA concentration before RNase R treatment, indicating that circular RNA has been successfully synthesized in the present invention.
[0035] Depend on Figure 2 It can be seen that the NNV-circRNA-1 prepared by the present invention has a strong binding ability with the NNV-RdRp protein. Therefore, it can be seen that NNV-circRNA-1 has the potential to target and inhibit the replication of NNV virus.
[0036] 2. Preparation of circular RNA preparations:
[0037] 4-(N,N-dimethylamino)butyric acid (dilinoleyl) methyl ester DLin-MC3-DMA, distearoylphosphatidylcholine DSPC, cholesterol, and DMG-PEG2000 were mixed in an ethanol solution at a mass ratio of 5:1:3.8:0.2 and added to an ethanol solution to prepare a lipid carrier. The lipid carrier and the circular RNA solution were mixed in a volume ratio of 1:4 using a microfluidic chip to prepare a circular RNA-LNP solution (the mass ratio of circular RNA to nanolipid material was 1:10). The ethanol was then removed by a tangential flow system to obtain a circular RNA lipid nanoparticle preparation, namely, the NNV-circRNA-1 circular RNA preparation.
[0038] Example 2:
[0039] Effect of NNV-circRNA-1 circular RNA preparation on NNV virus titer during post-exposure treatment and pre-exposure prophylaxis:
[0040] 1. Effect of post-exposure therapy on viral titer: EPC cells in the logarithmic growth phase were taken and digested with trypsin solution. The cells were then diluted with cell culture medium (without adding double antibodies) to a cell density of 2.5×10 5 cells / ml to form a cell suspension, and the above cell suspension was added to a 12-well cell culture plate at 1 ml / well. Then, the NNV virus liquid was added to the cell culture plate containing the EPC cell suspension at an MOI of 0.1 / well. At the same time, a negative control was set up and the cells were cultured in a cell culture incubator with a CO2 volume content of 5% and a temperature of 28°C.
[0041] After 24 hours of culture, the cells were discarded and washed with sterile PBS. Then, 1 ml of cell culture medium was added to each well. The prepared NNV-circRNA-1 circular RNA preparation was then added to the EPC cells. After 48 hours of transfection, the cell supernatant of each well was collected. Cell maintenance medium was used to maintain the cells at 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 Serially dilute the cell supernatant obtained in the previous step to obtain gradient concentration virus dilutions;
[0042] EPC cells in the logarithmic growth phase were obtained and digested with trypsin solution. The cells were then diluted with cell culture medium (without double antibody) to a cell density of 2.5×10 5 cells / ml to form a cell suspension. The cell suspension was added to a 96-well cell culture plate at 0.1 ml / well, and the cell culture plate was placed in a cell culture incubator with a CO2 volume content of 5% and a temperature of 28°C. After culturing the cells for 24 hours, the culture medium in the 96-well cell culture plate was removed and the cell suspension was added to a 96-well cell culture plate at 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 Virus dilutions of varying concentrations, obtained by serial dilution, were added to the cell culture plates containing cells at a rate of 0.1 ml per well, with triplicate wells for each concentration. After 48 hours of cell culture, cytopathic effects were observed and recorded, and viral titers were calculated.
[0043] The results are as follows Figure 4 It is known.
[0044] 2. Effect of pre-exposure prophylaxis on viral titer: EPC cells in the logarithmic growth phase were obtained. The cells were digested with trypsin and then diluted with cell culture medium to a cell density of 2.5×10 5 The cell suspension was added to a 12-well cell culture plate at 1 ml / well and cultured in a cell culture incubator with a CO2 volume content of 5% and a temperature of 28°C.
[0045] After 24 hours of cell culture, discard the supernatant in the above 12-well cell culture plate, rinse with sterile PBS, and then add cell culture medium at 1 ml / well. Then add the prepared NNV-circRNA-1 circular RNA preparation to the above EPC cells. After 24 hours of transfection, discard the supernatant in the above cell culture plate and rinse with sterile PBS. Add NNV virus venom to the cell culture plate with EPC cells at MOI = 0.1 / well, set up a negative control at the same time, and culture in a CO2 incubator with a CO2 volume content of 5% and a temperature of 28°C. After 48 hours of culture, collect the cell supernatant of each well above, and use cell maintenance solution at 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 The cell supernatant obtained by serial dilution was used to obtain the gradient concentration virus dilution solution;
[0046] EPC cells in the logarithmic growth phase were obtained and digested with trypsin solution, and then diluted with cell culture medium to a cell density of 2.5×10 5 cells / ml to form a cell suspension. The cell suspension was added to a 96-well cell culture plate at 0.1 ml / well, and the cell culture plate was placed in a cell culture incubator with a CO2 volume content of 5% and a temperature of 28°C. After culturing the cells for 24 hours, the culture medium in the 96-well cell culture plate was removed and the cell suspension was added to a 96-well cell culture plate at 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 The virus dilutions of different concentrations obtained by serial dilution were added to the cell culture plate containing cells at 0.1 ml / well, and each concentration was repeated 3 wells. After 48 hours of cell culture, the cytopathic effect was observed and recorded and the virus titer was calculated. The results are as follows Figure 5 shown.
[0047] In order to verify the effect of NNV-circRNA-1 circular RNA preparation in inhibiting viral replication, we first tested the therapeutic effect of NNV-circRNA-1 circular RNA preparation on cells after NNV virus exposure. Figure 4 It can be seen that compared with the control group, the NNV virus titer in cells transfected with NNV-circRNA-1 circular RNA preparation was significantly reduced, with the virus titer reduced by more than 90%. At the same time, the preventive effect of NNV-circRNA-1 circular RNA preparation before NNV virus exposure was also tested, and it was found that it could also significantly reduce the virus titer. Figure 5 It was found that the NNV virus titer was reduced by approximately 90% compared to the control group.
[0048] In summary, the NNV-circRNA-1 circular RNA preparation is suitable for post-exposure treatment and pre-exposure prevention of fish neuronecrosis virus, and can significantly reduce the virus titer in cell culture by more than 90%.
[0049] Example 3:
[0050] Effects of NNV-circRNA-1 circular RNA preparation on NNV virus mRNA expression levels:
[0051] 1. Effect of NNV-circRNA-1 circular RNA preparation on NNV virus mRNA expression during post-exposure therapy: EPC cells in the logarithmic growth phase were digested with trypsin and then diluted with cell culture medium (without double antibody) to a cell density of 2.5×10 5 cells / ml to form a cell suspension. The above cell suspension was added to a 12-well cell culture plate at 1 ml / well, and then the NNV virus solution was added to the cell culture plate containing the EPC cell suspension at an MOI of 0.1 / well. A negative control was also set up and the cells were cultured in a cell culture incubator with a CO2 volume content of 5% and a temperature of 28°C.
[0052] After culturing the cells for 24 hours, the supernatant in the cell culture plate was discarded, the plates were rinsed with sterile PBS, and then cell culture medium was added at 1 ml / well; the prepared NNV-circRNA-1 circular RNA preparation was then added to the EPC cells.
[0053] 48 hours after the cells were transfected, the supernatant in the cell culture plate was discarded and the cells were rinsed with sterile PBS. 1 ml of Trizol lysis buffer was then added to each well for lysis at room temperature for 10 minutes, and RNA was then extracted using a total RNA extraction kit (Cornwell). Total RNA was reverse transcribed using a full-length cDNA single-strand synthesis kit (Novozymes). The mRNA level of the NNV virus RdRp gene was then detected using a universal high-sensitivity dye-based quantitative PCR detection kit and primers (NNV-RdRp-RT-1F: 5'-ATAGTCTGGCGGATTTTC-3', as shown in SEQ ID NO: 5. NNV-RdRp-RT-1R: 5'-TCGGGAGCACACATACAT-3' as shown in SEQ ID NO: 6).
[0054] The results are as follows Figure 6 It can be seen that: in the treatment after NNV virus exposure, the NNV-circRNA-1 circular RNA preparation significantly reduced the level of NNV virus mRNA (RdRp gene), and the mRNA expression of the NNV-RdRp gene in cells transfected with the NNV-circRNA-1 circular RNA preparation was reduced by about 80% compared with the control group.
[0055] 2. Effect of NNV-circRNA-1 circular RNA preparation on NNV virus mRNA expression during pre-exposure prophylaxis:
[0056] EPC cells in the logarithmic growth phase were taken and digested with the corresponding digestion solution, and then diluted with cell culture medium to a cell density of 2.5×10 5 The cell suspension was added to a 12-well cell culture plate at 1 ml / well and cultured in a cell culture incubator with a CO2 volume content of 5% and a temperature of 28°C.
[0057] After 24 hours of cell culture, the supernatant from the 12-well cell culture plate was discarded, the cells were rinsed with sterile PBS, and 1 ml of cell culture medium was added per well. The prepared NNV-circRNA-1 circular RNA preparation was then added to the EPC cells. 24 hours after transfection, the supernatant from the cell culture plate was discarded and the cells were rinsed with sterile PBS. NNV virus venom was added to the cell culture plate containing EPC cells at an MOI of 0.1 per well. A negative control was also set up and the cells were cultured in a CO2 incubator with a CO2 content of 5% by volume and a temperature of 28°C.
[0058] After the above cells were cultured for 48 hours, the supernatant in the cell culture plate was discarded and the cells were rinsed with sterile PBS; then 1 ml of Trizol lysis solution was added to each well for lysis at room temperature for 10 minutes, and then RNA was extracted using a total RNA extraction kit (Kangwei Century). The total RNA was reverse transcribed using an efficient second-generation full-length cDNA single-strand synthesis kit (Novozymes). The mRNA level of the NNV virus RdRp gene was then detected using a universal high-sensitivity dye-based quantitative PCR detection kit and primers (NNV-RdRp-RT-1F: 5'-ATAGTCTGGCGGATTTTC-3', NNV-RdRp-RT-1R: 5'-TCGGGAGCACACATACAT-3'). The results are as follows. Figure 7 As shown in the results, in the pre-exposure prevention of NNV virus, the NNV-circRNA-1 circular RNA preparation can also significantly reduce the level of NNV virus mRNA (RdRp gene). The mRNA level of NNV-RdRp gene in cells transfected with the NNV-circRNA-1 circular RNA preparation was reduced by more than 90% compared with the control.
[0059] In summary, the NNV-circRNA-1 circular RNA preparation has excellent therapeutic effect after NNV virus exposure and preventive effect before exposure, and both have the ability to significantly reduce the level of NNV virus mRNA, further confirming the therapeutic potential of NNV-circRNA-1 circular RNA preparation in controlling NNV virus replication.
[0060] Therefore, the NNV-circRNA-1 circular RNA preparation of the present invention can be used in the preparation of vaccines, antiviral drugs and other biological immune products for fish neuronecrosis virus in the aquaculture industry. The NNV-circRNA-1 circular RNA preparation can inhibit the replication and proliferation of the fish neuronecrosis virus NNV by specifically binding to the fish neuronecrosis virus NNV, effectively blocking the spread of NNV in a variety of economically farmed fish, greatly reducing the risk of outbreaks of fish viral diseases caused by NNV virus infection, effectively protecting the healthy breeding of a variety of economically farmed fish, and thus significantly improving the yield and economic benefits of fish farming.
[0061] In addition, since this circular RNA can significantly reduce the outbreak of viral diseases in fish, it also reduces the risk of later complications such as bacterial diseases caused by viral diseases. In traditional aquaculture, the treatment of bacterial diseases often relies on the extensive use of antibiotics, which not only pollutes the environment but also may lead to drug residues and the emergence of drug-resistant strains. Therefore, the introduction of NNV-circRNA-1 circular RNA preparations not only reduces the use of antibiotics, but also has important practical significance in protecting the ecological environment, reducing drug residues, and reducing the risk of the emergence of drug-resistant strains.
[0062] Example 4:
[0063] Stability testing of NNV-circRNA-1 circular RNA preparations:
[0064] Detection method: EPC cells in the logarithmic growth phase were taken and digested with the corresponding digestion solution, and then diluted with cell culture medium to a cell density of 2.5×10 5 The cell suspension was added to a 12-well cell culture plate at 1 ml / well and cultured in a cell culture incubator with a CO2 volume content of 5% and a temperature of 28°C.
[0065] After 24 hours of cell culture, the supernatant in the above 12-well cell culture plate was discarded, rinsed with sterile PBS, and then cell culture medium was added at 1 ml / well. The prepared NNV-circRNA-1 circular RNA preparation was delivered into EPC cells and transfected into 5 replicate wells. After 24 hours, 36 hours, 48 hours, 60 hours, 72 hours, and 96 hours of transfection, the cells in each well were selected, the supernatant in the well was discarded, rinsed with sterile PBS, and then 1 ml of Trizol lysis buffer was added for lysis at room temperature for 10 minutes, and then RNA was extracted using a total RNA extraction kit (Kangwei Century).
[0066] Total RNA was reverse transcribed using a full-length cDNA first-strand synthesis kit (Novozymes).
[0067] Then, the level of NNV-circRNA-1 was detected using a universal high-sensitivity dye-based quantitative PCR detection kit and primers (NNV-circRNA-1-RT-1F: 5'-CATCACCTTCTTGCTCTG-3' as shown in SEQ ID NO: 7, NNV-circRNA-1-RT-1R: 5'-GCGTAGACTTGTCGTTGT-3' as shown in SEQ ID NO: 8). The results are shown in Figure 2. Figure 8 shown.
[0068] Depend on Figure 8 The results showed that the relative levels of the prepared NNV-circRNA-1 circular RNA preparation were tested 24h, 36h, 48h, 60h, 72h, and 96h after delivery into EPC cells. The NNV-circRNA-1 circular RNA preparation showed almost no degradation trend within 48h of transfection, began to degrade after 72h of transfection, and degraded by 40%-50% after 96h of transfection. Therefore, it can be seen that the half-life of the NNV-circRNA-1 circular RNA preparation in EPC cells is 96h, which has good stability.
[0069] The basic principles, main features, and advantages of the present invention are shown and described above. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The above embodiments and descriptions are merely illustrative of the principles of the present invention. Various changes and modifications may be made to the present invention without departing from the spirit and scope of the present invention. Such changes and modifications are intended to fall within the scope of the present invention. The scope of protection claimed in the present invention is defined by the appended claims and their equivalents.
Claims
1. A circular RNA that targets and inhibits the replication of fish neuronecrosis virus, characterized in that: The circular RNA is NNV-circRNA-1, and the nucleotide sequence is shown in SEQ ID NO:
1.
2. A circular RNA preparation that targets and inhibits the replication of fish neural necrosis virus, wherein the circular RNA preparation is loaded onto a lipid nanocarrier according to claim 1, and the mass ratio of the circular RNA to the lipid nanocarrier is 1:10, to obtain an NNV-circRNA-1 circular RNA preparation.
3. The circular RNA preparation for targeted inhibition of fish neural necrosis virus replication according to claim 2, characterized in that: The lipid nanocarrier is prepared by mixing 4-(N,N-dimethylamino)butyric acid (dilinoleyl) methyl ester DLin-MC3-DMA, distearoylphosphatidylcholine DSPC, cholesterol and DMG-PEG2000 in a mass ratio of 5:1:3.8:0.2 and adding the mixture to an ethanol solution to prepare the lipid nanocarrier.
4. Use of the circular RNA preparation for targeted inhibition of fish nervous necrosis virus replication as claimed in claim 2 in the preparation of a vaccine or antiviral drug for fish nervous necrosis virus.
Citation Information
Patent Citations
Preparation method and application of nano antibody for resisting nervous necrosis virus of grouper
CN113214387A