Oryzamectin positive regulation gene scn6293, overexpression gene engineering bacteria thereof, preparation method and application of overexpression gene engineering bacteria

Abstract

The invention discloses an oryzanol positive regulation gene scn6293 and an overexpression gene engineering bacterium, a preparation method and application thereof, and belongs to the technical field of gene engineering. In order to improve the yield of the oryzanol, the oryzanol positive regulation gene scn6293 is excavated from an oryzanol producing strain streptomyces cerevisiae NEAU6, and the oryzanol positive regulation gene scn6293 is used for encoding an XRE family transcription regulation factor; in addition, the streptomyces obscursogriseus NEAU6 is taken as an original strain, a recombinant strain of over-expression scn6293 is constructed, and compared with a control strain, the recombinant strain is found to be capable of remarkably improving the yield of the oryzanol and can be applied to production of the oryzanol.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to an oryzanol positive regulatory gene scn6293 and an overexpression genetic engineering bacterium thereof, a preparation method and an application thereof. Background Art

[0002] Oxyprolin is a natural purine nucleoside product produced by Streptomyces. In recent years, it has been registered as a new type of pesticide for increasing rice yield due to its excellent biological activities such as promoting seed germination, plant tillering and early maturity. However, the low fermentation titer and high production cost of oryzanin have largely limited its widespread application. Systematic exploration of the transcriptional regulatory network of oryzanin biosynthesis, especially the regulatory mechanism of important transcription factors, is a necessary step to achieve high yield of oryzanin and promote its widespread application in rice production.

[0003] Natural products in Streptomyces are usually produced at relatively low levels, mainly because Streptomyces has a complex intrinsic regulatory network that strictly controls their biosynthesis. Transcriptional regulatory factors are the main components of this regulatory network and play a key role in determining the production and final yield of natural products. Streptomyces caniferus NEAU6 is a oryzanin producer with independent intellectual property rights. Its genome contains 652 genes encoding transcriptional regulatory factors, but the functions of most transcription factors are unknown. Exploring the transcriptional regulatory genes that affect oryzanin synthesis in Streptomyces caniferus NEAU6 will provide important gene resources for the construction of oryzanin high-yield bacteria. Summary of the invention

[0004] In order to increase the yield of oryzanin, the present invention excavated a oryzanin positive regulatory gene scn6293 from the oryzanin-producing bacterium Streptomyces NEAU6, which encodes an XRE family transcription regulatory factor; in addition, using Streptomyces NEAU6 as the starting strain, a recombinant bacterium overexpressing scn6293 was constructed, and it was found that the recombinant bacterium could increase the yield of oryzanin compared with the control strain.

[0005] In order to solve the above technical problems and achieve corresponding technical effects, the present invention provides the following technical solutions:

[0006] The first object of the present invention is to provide a oryzanol positive regulatory gene scn6293, wherein the oryzanol positive regulatory gene scn6293 encodes an XRE family transcription regulatory factor, and the nucleotide sequence is shown in SEQ ID NO.1.

[0007] The second object of the present invention is to provide a recombinant expression vector containing the above-mentioned oryzanol positive regulatory gene scn6293.

[0008] The third object of the present invention is to provide the use of the above-mentioned oryzanol positive regulatory gene scn6293 or the above-mentioned recombinant expression vector in increasing the yield of oryzanol.

[0009] The fourth object of the present invention is to provide an overexpression genetic engineering bacterium containing the above-mentioned oryzanol positive regulatory gene scn6293 or the above-mentioned recombinant expression vector.

[0010] In one embodiment of the present invention, the starting strain of the overexpression genetically engineered bacteria is Streptomyces caniferus NEAU6.

[0011] The fifth object of the present invention is to provide an application of the above-mentioned overexpression genetically engineered bacteria in improving the yield of oryzanin, wherein the application is to cultivate the overexpression genetically engineered bacteria of the present invention under conditions suitable for the production of oryzanin, that is, the overexpression genetically engineered bacteria are cultured in a seed culture medium and fermented in a fermentation culture medium in sequence to synthesize oryzanin.

[0012] In one embodiment of the present invention, the composition of the seed culture medium is: sucrose 20 g / L, maltodextrin 20 g / L, soybean powder 60 g / L, calcium carbonate 3 g / L, and the balance is water, pH 7.0.

[0013] In one embodiment of the present invention, the fermentation medium is composed of: 10 g / L sucrose, 60 g / L maltodextrin, 40 g / L soybean powder, 4 g / L calcium carbonate, and the balance is water, with a pH of 7.2.

[0014] The sixth object of the present invention is to provide a method for preparing the above-mentioned overexpression genetically engineered bacteria, the preparation method comprising the following steps:

[0015] 1) Construction of target gene overexpression plasmid: Using NEAU6 genomic DNA of Streptomyces caniferus as a template, the target gene and its own promoter fragment were obtained by PCR amplification, and the fragment was connected to the pSET152 vector backbone to obtain the target gene overexpression plasmid; the target gene is oryzanol positive regulatory gene scn6293, and the nucleotide sequence is shown in SEQ ID NO.1;

[0016] 2) The target gene overexpression plasmid was introduced into Escherichia coli, and then transferred into Streptomyces NEAU6 through inter-genus conjugation transfer to obtain a genetically engineered bacterium overexpressing the target gene.

[0017] In one embodiment of the present invention, the primers selected for the PCR amplification in step 1) are scn6293-LF with a nucleotide sequence as shown in SEQ ID NO.2 and scn6293-LR with a nucleotide sequence as shown in SEQ ID NO.3.

[0018] In one embodiment of the present invention, the target gene and its own promoter fragment in step 1) are assembled with the vector pSET152 treated with XbaI and EcoRI double enzymes using the ClonExpress MultiS kit to obtain a target gene overexpression plasmid.

[0019] In one embodiment of the present invention, the Escherichia coli in step 2) is E. coli ET12567 / pUZ8002.

[0020] In one embodiment of the present invention, the overexpression also includes other promoters of different strengths and types.

[0021] Definitions and Abbreviations:

[0022] In the present invention, the starting Streptomyces for producing the recombinant Streptomyces refers to the Streptomyces subjected to the genetic manipulations shown in the present invention, such as gene overexpression. "Recombinant" as used herein refers to a strain with desired modifications obtained due to intentional human intervention.

[0023] Beneficial effects of the present invention:

[0024] The present invention discloses a gene scn6293 in Streptomyces caniferus NEAU6, which is a transcriptional regulatory factor of the XRE family and can positively regulate the synthesis of oryzanin. In addition, the present invention uses Streptomyces caniferus NEAU6 as a starting strain, constructs a recombinant bacterium Oscn6293 based on the gene, and finds that when the recombinant bacterium Oscn6293 is used to ferment and produce oryzanin, compared with the control strain NEAU6 / pSET152, the final oryzanin yield of the recombinant bacterium Oscn6293 is increased from 504 mg / L to 923 mg / L, which is increased by 0.8 times. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Schematic diagram for the construction of recombinant plasmid pSET152::scn6293;

[0026] Figure 2 The graph shows the detection results of oryzanol content in the fermentation broth of the recombinant bacteria Oscn6293, the control strain NEAU6 / pSET152 and the original strain NEAU6; ****p<0.0001. DETAILED DESCRIPTION

[0027] In order to make the purpose, technical scheme and advantages of the present invention more clear, the present invention is further described in detail below in conjunction with specific implementation methods and the accompanying drawings of the specification. It should be noted that the embodiments mentioned below are only applicable to explaining the present invention, but are not intended to limit the scope of the present invention. The embodiments mentioned below are only part of the embodiments of the present invention rather than all the embodiments. In this field, if other technicians do not make creative work, the embodiments they obtain are protected by the present invention.

[0028] The experimental methods used in the following examples are conventional methods unless otherwise specified, and the materials, reagents, culture media and instruments used are conventional materials, reagents, culture media and instruments in the art unless otherwise specified, and can be obtained by those skilled in the art through commercial channels. The molecular biology experimental operations such as PCR amplification, enzyme ligation, transformation, etc. involved in the present invention are conventional experimental operations in the art or can be performed according to the product instructions of the corresponding reagents unless otherwise specified.

[0029] The specific detection method of oryzanol used in the present invention is recorded in Shi, H. et al. Synthetic and Systems Biotechnology 10, 237-246, doi: https: / / doi.org / 10.1016 / j.synbio.2024.11.001 (2025).

[0030] The ClonExpress MultiS kit used in the present invention was purchased from Novozymes.

[0031] The culture medium used in the present invention and its composition are as follows:

[0032] The solid culture medium required for bacterial growth and fermentation in the present invention is a YMS solid culture medium, which is composed of:

[0033] In 1L of culture medium, there are 4g yeast extract powder, 10g malt extract powder, 4g soluble starch, 20g agar, and pH 7.4.

[0034] The composition of the seed culture medium of Streptomyces NEAU6 used in the present invention is:

[0035] In 1L of culture medium, there are 20g sucrose, 20g maltodextrin, 60g soybean powder, 3g calcium carbonate, and pH 7.0.

[0036] The fermentation medium of Streptomyces NEAU6 used in the present invention is composed of:

[0037] In 1L of culture medium, there are 10g sucrose, 60g maltodextrin, 40g soybean powder, 4g calcium carbonate, and pH 7.2.

[0038] The starting strain used in the present invention is:

[0039] Streptomyces caniferus NEAU6 is a oryzanol-producing bacterium with independent intellectual property rights. The strain is recorded in a Chinese patent with application number 201910189570.2 and invention name "A strain of Streptomyces and its application". The public can obtain it through the Institute of Plant Protection, Chinese Academy of Agricultural Sciences.

[0040] The plasmid information involved in the following examples is shown in Table 1; the strain information involved is shown in Table 2; and the primer information involved is shown in Table 3.

[0041] Table 1 Plasmid information involved in the examples

[0042]

[0043] Table 2 Strain information involved in the examples

[0044]

[0045] Example 1: Construction of genetically engineered bacteria overexpressing oryzanol positive regulatory gene scn6293

[0046] In this example, a recombinant bacterium Oscn6293 overexpressing the oryzanin positive regulatory gene scn6293 and a control strain NEAU6 / pSET152 containing an empty plasmid were constructed. The recombinant bacterium Oscn6293 was obtained by overexpressing the gene scn6293 using Streptomyces neau6 as the starting strain; the control strain NEAU6 / pSET152 was obtained by introducing the empty vector pSET152 using Streptomyces neau6 as the starting strain. The specific construction method is as follows:

[0047] 1. Construction of recombinant bacterium Oscn6293

[0048] (1) Construction of recombinant vector

[0049] The polymerase chain reaction (PCR) and Q5 high-fidelity enzyme system were used, the genome of Streptomyces NEAU6 was used as a template, and scn6293-LF / R was used as a primer to amplify a fragment containing the gene scn6293 and its own promoter (the nucleotide sequence of the gene scn6293 is shown in SEQ ID NO.1). The PCR reaction system was as follows: 10×KOD Buffer 5μL, 2mM dNTPs 5μL, template DNA (S. NEAU6 genome) 10pg-1000ng, 10μM upstream and downstream primers 2μL each, 25mM MgSO4 2μL, 1U / μL KOD plus DNApolymerase 1μL, DMSO 3μL, ddH2O supplemented to 50μL. The PCR reaction conditions were as follows: 94℃4min; 94℃1min, 65℃30sec, 68℃3min, 31 cycles; 68℃10min. The PCR product was spliced ​​with the vector pSET152 treated with double restriction enzymes XbaI and EcoRI (restriction digestion system: plasmid pSET152 1-2 μg, 10×M buffer 10 μL, BSA 10 μL, XbaI 3 μL, EcoRI 3 μL, ddH2O made up to 100 μL) using the ClonExpress MultiS kit. The splicing system was as follows: vector pSET152 60-70 ng, fragment scn6293 15-16 ng, 5×CE MultiS Buffer 2 μL, Exnase MultiS 1 μL, ddH2O made up to 10 μL. The spliced ​​product was then transformed into E. coli JM109, and after plating, the clone was picked and cultured in a small test tube containing apramycin (final concentration 100 μg / mL), and the plasmid was extracted using a plasmid extraction kit. After electrophoresis detection, restriction enzyme digestion verification and sequencing verification were performed to obtain the recombinant plasmid pSET152::scn6293 (as shown in Figure 1 ).

[0050] (2) Construction of recombinant bacteria

[0051] The recombinant plasmid pSET152::scn6293 was transferred into Escherichia coli ET12567 / pUZ8002, and then introduced into Streptomyces NEAU6 by conjugation transfer. The conjugate was then picked on YMS medium containing apramycin (final concentration 16 μg / mL) and nalidixic acid (final concentration 25 μg / mL), and after culturing at 28°C for 7 days, the recombinant strain (Oscn6293) overexpressing scn6293 was obtained by measuring the transcriptional expression of the gene.

[0052] SEQ ID NO.1:

[0053] atgaccgccgcgcagccgagcagcgatccgtccctgcgccgctacctggaccatccgcgcggcggcccgaccgtcctgcgtatcgtgctgggcacccaactgcgccggctgcgtgagggagcgggcatcacccgggaggccgccggggacgccatccgcggttcgcacgcgaagatcagccgcctggaactcggccgggtgagctgcaaggagcgggatgtcgccgatctgctgacgctctacaacgtcacggacgacgcggtccgctcggacttcctcaagctggcccgcaagaccagcagtccggggtggtggcatcagtacggcgatgtgctgcccggctggttcgagacgcacatcggcctcgaagaagccgcctcggtgatccgtacgtacgaagtccagttcgtgcccggcctgttgcagacggcggactacgcccgtgcggtggcgcagctcgggcatccgcggtcctccccggaggagatcgaacgacgggtgcagctgcgcgtacagcgccaggagctgctgaccgtcccggacgcgccgcgggtatgggccgtgatcgacgaggcgtcgctgcgccgtccgctcggcggacctgaggtgatggccggccagctcagacatctgctgaagatggccgagctgccgaatgtcacgttgcagatcgcgccgttcagcctcggcggcctggcggcggccggtggcccgatcacgatcctgcggttcctggagccggatctgccggacatcgtctatctggagcagctgaccagcgcgctctatctggacaagcgcgatgatgtcgatcattacctcgcggtgatggaccggctcagcgcacagtccgagtctccccgcgagtcacgggagatcctggagcggctgctcaagcaggagagctga

[0054] 2. Construction of control strain NEAU6 / pSET152

[0055] The empty plasmid pSET152 was transferred into Escherichia coli ET12567 / pUZ8002, and then introduced into Streptomyces neau6 by conjugation transfer. The conjugate was then picked onto YMS medium containing apramycin (final concentration 16 μg / mL) and nalidixic acid (final concentration 25 μg / mL), and cultured at 28°C for 7 days to obtain the control strain NEAU6 / pSET152.

[0056] Example 2: Application of scn6293 overexpression genetic engineering bacteria in increasing oryzanol production

[0057] The method for producing oryzanin using the recombinant bacterium Oscn6293 is as follows: the recombinant bacterium Oscn6293 is inoculated on a YMS solid medium, cultured at a constant temperature of 28°C for 7 days, spores of about 1 square centimeter are scraped, and inoculated in a seed medium of Streptomyces neau6, cultured at 28°C, 250rpm, for 24 hours. Then, the inoculation amount is inoculated in a fermentation medium of Streptomyces neau6 at a rate of 5%, cultured at 28°C, 250rpm, for 8 days.

[0058] HPLC detection verifies the change of oryzanol production in recombinant bacteria Oscn6293:

[0059] The recombinant bacteria Oscn6293, the control strain NEAU6 / pSET152 and the original strain NEAU6 were inoculated on YMS solid medium, cultured at 28°C for 7 days, and spores of about 1 square centimeter were scraped and inoculated in the seed medium of Streptomyces neau6, cultured at 28°C, 250rpm, and cultured for 24 hours. Then, the inoculation amount of 5% was inoculated in the fermentation medium of Streptomyces neau6, cultured at 28°C, 250rpm, and cultured for 8 days to obtain the fermentation broth of strains NEAU6, Oscn6293 and NEAU6 / pSET152, respectively.

[0060] The total oryzanin production detection method is as follows: 0.4 mL of fermentation liquid is taken, soaked in 1.6 mL of ethanol, and rotated overnight for extraction. Centrifuged at 12000 rpm for 10 min, the supernatant is taken, filtered through a 0.22 μm organic filter membrane, and HPLC is performed. The liquid phase conditions are: 0-30 min, 90% solvent A and 10% solvent B (solvent A: water; solvent B: acetonitrile), the flow rate is 0.8 mL / min, the column is AligenSq-C18 column (Zorbax, 4.6×250 mm, 5 μm), and the detection wavelength is 260 nm.

[0061] HPLC test results are as follows Figure 2As shown in the figure, it can be seen that the oryzanin production of the recombinant bacteria Oscn6293 (923 mg / L) is about 0.8 times higher than that of the control strain NEAU6 / pSET152 (504 mg / L). Therefore, the recombinant bacteria overexpressing the oryzanin positive regulatory gene scn6293 can be used to increase the production of oryzanin by fermentation of Streptomyces NEAU6.

[0062] Although the present invention has been disclosed as above in the form of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A oryzanol positive regulatory gene scn6293, characterized in that: The nucleotide sequence of the oryzanol positive regulatory gene scn6293 is shown in SEQ ID NO.

1.

2. A recombinant expression vector containing the oryzanol positive regulatory gene scn6293 according to claim 1.

3. Use of the oryzanol positive regulatory gene scn6293 according to claim 1 or the recombinant expression vector according to claim 2 in increasing oryzanol production.

4. An overexpression genetic engineering bacterium containing the oryzanol positive regulatory gene scn6293 according to claim 1 or the recombinant expression vector according to claim 2.

5. The overexpression genetic engineering bacteria according to claim 4, characterized in that: The starting strain of the overexpression genetic engineering bacteria is Streptomyces caniferus NEAU6.

6. Use of the overexpression genetically engineered bacteria according to any one of claims 4 or 5 in increasing oryzanol production.

7. The method for preparing the overexpression genetically engineered bacteria according to any one of claims 4 or 5, characterized in that: The steps include: 1) Construction of target gene overexpression plasmid: Using the genomic DNA of Streptomyces NEAU6 as a template, the target gene and its own promoter fragment were obtained by PCR amplification, and the fragment was connected to the pSET152 vector backbone to obtain the target gene overexpression plasmid; the target gene is the oryzanol positive regulatory gene scn6293, and the nucleotide sequence is shown in SEQ ID NO.1; 2) The target gene overexpression plasmid was introduced into Escherichia coli, and then transferred into Streptomyces NEAU6 through inter-genus conjugation transfer to obtain a genetically engineered bacterium overexpressing the target gene.

8. The preparation method according to claim 7, characterized in that: Step 1) The primers used for the PCR amplification are scn6293-LF with a nucleotide sequence as shown in SEQ ID NO.2 and scn6293-LR with a nucleotide sequence as shown in SEQ ID NO.

3.

9. The preparation method according to claim 7, characterized in that: Step 1) The target gene and its own promoter fragment are combined with the vector pSET152 treated with XbaI and EcoRI, and assembled using the ClonExpress MultiS kit to obtain a target gene overexpression plasmid.

10. The preparation method according to claim 7, characterized in that: In step 2), the Escherichia coli is ET12567 / pUZ8002.

Images