Moso bamboo PeSUS3 gene for promoting germination of plant tillering buds and application thereof

Abstract

The invention discloses a phyllostachys edulis PeSUS3 gene for the first time, and belongs to the technical field of gene engineering. The phyllostachys edulis PeSUS3 gene comprises a CDS sequence (SEQ ID NO.1) and an amino acid sequence (SEQ ID NO.2). The sucrose synthase coded by the PeSUS3 gene plays a key role in plant sucrose metabolism. The gene is cloned, a recombinant plasmid is constructed, and the gene is introduced into a plant body for overexpression by using a gene engineering technology, so that the overexpressed PeSUS3 gene is found to be capable of remarkably increasing the number of tillering buds of dendrocalamus nanchus and promoting the tillering buds to germinate in advance. The discovery provides a new gene resource for improving the yield and quality of crops through a molecular breeding means. The PeSUS3 gene has important application value in cultivation of high-yield and high-quality new bamboo varieties and regulation and control of sucrose metabolism pathways of other plants, and provides a new research direction for genetic improvement and molecular breeding of crops.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, in particular to a PeSUS3 gene of moso bamboo and an application thereof. Background Art

[0002] Dendrocalamus brandisii is a tree-like bamboo plant of the Poaceae family and the genus Dendrocalamus. It is a new high-quality bamboo variety for bamboo shoots. It is mainly distributed in the tropical areas of Yunnan Province, my country. It is a variant of Dendrocalamus brandisii of the genus Dendrocalamus. Dendrocalamus brandisii has a sweet taste, tender texture, and rich nutrition. It can be eaten raw like sugarcane, so it is also called sugarcane shoot. The bamboo shoots have good yield, the shoot period is more than 7 months, and the maximum yield per mu can reach about 3,000 jin. Its quality is far superior to that of moso bamboo shoots and ma bamboo shoots. It is a precious variety of bamboo shoots with significant economic benefits. The shoot yield is 1.50 to 1.75 times that of Dendrocalamus brandisii. At the same time, compared with Dendrocalamus brandisii, the stems of Dendrocalamus brandisii are taller and thicker, with stems up to 15-17 meters high, 2 to 5 meters taller and 0 to 4 cm thicker than ordinary Dendrocalamus brandisii. The biomass per unit area is large, so it has high economic value and ecological service value. At present, there are only more than 100 clumps and more than 3,000 bamboos in Manche. Due to the immaturity of climate, soil, planting technology and management, and the high maintenance cost, it is not suitable for "southern bamboo migration to the north". At present, it only grows naturally in the tropical areas of Yunnan in China, with a small scale, and the production of bamboo shoots is far from meeting people's market demand.

[0003] In recent years, with the development of molecular biology and genetic engineering technology, it has become possible to improve crop traits through genetic engineering. Sucrose synthase (SUS), as a key enzyme in sucrose metabolism in plants, not only participates in the synthesis and decomposition of sucrose, but also plays an important role in plant growth and development and biomass formation. Studies have shown that different members of the SUS gene family have specific expression patterns in different developmental stages and tissue parts of plants, and changes in their expression levels are closely related to plant growth and development.

[0004] In bamboo plants, the research on SUS gene is still in its infancy. In particular, there is no detailed report on the functional research of PeSUS3 gene in moso bamboo. Therefore, in-depth exploration of the function of PeSUS3 gene in moso bamboo and clarifying its mechanism of action in the growth and development of bamboo plants are of great significance for improving bamboo traits through genetic engineering and cultivating new high-yield and high-quality varieties.

[0005] In addition, Dendrocalamus brandisii, as a high-quality new bamboo variety for bamboo shoots, is highly favored for its sweet taste and tender texture. However, its natural distribution range is limited, and its growth cycle is long, so its yield cannot meet market demand. Therefore, increasing the number and germination rate of tillering buds of Dendrocalamus brandisii through genetic engineering means, thereby increasing its yield, is of great value in promoting the industrialization development of this bamboo species.

[0006] In summary, the present invention aims to clone the PeSUS3 gene of moso bamboo and study its role in promoting plant tillering bud initiation, so as to provide a theoretical basis and technical support for improving bamboo traits and cultivating high-yield and high-quality new varieties through genetic engineering. Summary of the invention

[0007] The purpose of the present invention is to provide a PeSUS3 gene of moso bamboo and its application, so as to solve the problem that the existing bamboo breeding methods are inefficient and difficult to meet the market demand for new high-yield and high-quality bamboo varieties.

[0008] The present invention first clones the PeSUS3 gene of moso bamboo, the nucleotide sequence of which is shown in SEQ ID NO.1 and the protein sequence is shown in SEQ ID NO.2, and the protein encoded by the gene has the function of sucrose synthase, which can catalyze the reversible reaction between sucrose and glucose and fructose. By constructing a recombinant plasmid, the PeSUS3 gene is introduced into the plant body to achieve overexpression, and the present invention finds that overexpressing the PeSUS3 gene can significantly increase the number of plant tiller buds and promote the early germination of tiller buds.

[0009] Furthermore, the present invention applies the PeSUS3 gene to the improvement of Dendrocalamus brandisii, introduces the PeSUS3 gene into Dendrocalamus brandisii through the bamboo mosaic virus vector system, and successfully obtains transgenic plants that overexpress the PeSUS3 gene. The experimental results show that compared with the control plants, the number of tiller buds of the transgenic plants increased significantly, the germination time was advanced, and the sucrose content was also increased.

[0010] Based on the above findings, the present invention also provides a method for increasing the number of plant tiller buds and promoting tiller bud germination, as well as a method for cultivating a high-yield new bamboo variety using the PeSUS3 gene. Specifically, the method includes introducing the PeSUS3 gene as a target gene into the plant genome to achieve overexpression of the gene in the plant, thereby obtaining a high-yield new bamboo variety with an increased number of tiller buds and an earlier germination time.

[0011] The beneficial effect of the present invention is that by cloning and applying the PeSUS3 gene of moso bamboo, new gene resources and technical means are provided for improving bamboo traits and cultivating high-yield and high-quality new varieties through genetic engineering. At the same time, the application of the gene is also helpful to increase the yield of high-quality bamboo shoots such as Manchego sempervirens, meet market demand, and promote the sustainable development of the bamboo industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 The electrophoresis diagram of the PCR amplification product of PeSUS3 gene of Moso bamboo and the vector construction map;

[0013] Figure 2 Bright field and dark field images of transgenic tobacco

[0014] Figure 3 This is a fluorescence observation picture of the leaves of transgenic sweet bamboo

[0015] Figure 4 This is a picture of the tillering buds of the transgenic sweet dragon bamboo

[0016] Figure 5 To detect the EGFP gene in the leaves of Dendrocalamus manchegoides by RT-PCR

[0017] Comparison of tillering buds of transgenic Manchegodon chinensis

[0018] Figure 6 RT-qPCR detection of the expression of SUS3 gene in tillering buds and leaves of transgenic Manchegodon sempervirens

[0019] Figure 7 The number of tillering buds of Manchego sempervirens

[0020] Figure 8 This is a statistical chart of the germination time of the tillering buds of Manchegodon chinensis DETAILED DESCRIPTION

[0021] The present application is further described in detail below in conjunction with the accompanying drawings. It is necessary to point out here that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technical personnel in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0022] 1. Materials

[0023] The methods used in this example are conventional methods known to those skilled in the art unless otherwise specified, and the reagents and other materials used are commercially available products unless otherwise specified.

[0024] 2. Methods

[0025] 2.1 Total RNA extraction

[0026] Use the ultrapure total RNA extraction kit produced by Hangzhou Xinjing Biological Reagent Development Co., Ltd. and strictly follow the instructions. The specific steps are as follows:

[0027] 2.1.1 Place appropriate amount of bamboo leaves and young shoot tissues in a pre-cooled mortar, add liquid nitrogen and grind into powder, transfer the leaf powder to an RNase-free 1.5 mL centrifuge tube. Add 500 μl Buffer TL, grind with a grinding rod until no obvious particles, then add 500 μl Buffer TL and shake vigorously for 15 seconds to mix.

[0028] 2.1.2 Add 200 μl Buffer EX, cover the tube, shake vigorously for 15 seconds, and centrifuge at 12,000 rpm for 15 minutes.

[0029] 2.1.3 Transfer 600 μl of the upper aqueous phase to a clean 1.5 ml centrifuge tube, add 600 μl Buffer DW, do not discard the pipette tip, directly use the pipette tip to pipette twice to mix, and proceed to step 2.1.4.

[0030] 2.1.4 Transfer 600 μl of the mixture to the nucleic acid purification column, cover the tube, and centrifuge at 12000 rpm for 30 seconds.

[0031] 2.1.5 Discard the filtrate in the 2 ml centrifuge tube, place the nucleic acid purification column back into the 2 ml centrifuge tube, transfer all the remaining liquid in the 1.5 ml centrifuge tube to the nucleic acid purification column, cover the tube, and centrifuge at 12000 rpm for 30 seconds.

[0032] 2.1.6 Discard the filtrate in the 2 ml centrifuge tube, place the nucleic acid purification column back into the 2 ml centrifuge tube, add 500 μl Buffer WA to the nucleic acid purification column, cover the tube, and centrifuge at 12000 rpm for 30 seconds.

[0033] 2.1.7 Discard the filtrate in the 2 ml centrifuge tube, put the nucleic acid purification column back into the 2 ml centrifuge tube, add 600 μl Buffer WBR to the nucleic acid purification column, cover the tube, and centrifuge at 12000 rpm for 30 seconds.

[0034] 2.1.8 Discard the filtrate in the 2 ml centrifuge tube, place the nucleic acid purification column back into the 2 ml centrifuge tube, and centrifuge at 14000 rpm for 1 minute.

[0035] 2.1.9 Discard the 2 ml centrifuge tube, place the nucleic acid purification column in an RNase-free 1.5 ml centrifuge tube, add 50 μl RNase-free water to the purification column, cover the tube, let it stand at room temperature for 1 minute, and centrifuge at 12000 rpm for 30 seconds.

[0036] 2.1.10 Use a nucleic acid detector to measure the purity and concentration of the extracted RNA, and use agarose gel electrophoresis to detect the integrity of the RNA.

[0037] 2.1.11-80℃Storage

[0038] 2.2 Reverse transcription to obtain cDNA

[0039] Use products produced by Yisheng Biotechnology (Shanghai) Co., Ltd. Ⅲ1st Strand cDNA Synthesis SuperMix for qPCR (gDNA digester plus), strictly follow the instructions, the specific steps are as follows:

[0040] First-strand cDNA synthesis steps

[0041] 2.2.1 Removal of residual genomic DNA

[0042] Prepare the following mixed solution in an RNase free centrifuge tube (the components are shown in Table 1), mix by gently pipetting, and incubate at 42°C for 2 minutes.

[0043] Table 1 Components and dosage of reaction solution

[0044]

[0045] * Note: The recommended total RNA input for a 20μL reverse transcription reaction system is no more than 1μg. If the target gene is expressed at a low abundance, a maximum of 5μg total RNA may be used. Otherwise, the RNA input is too high and may exceed the linear range of subsequent quantitative PCR.

[0046] Directly add into the reaction tube in 2.2.1 IIISuperMix plus (components as shown in Table 2), mix gently by pipetting.

[0047] Table 2 Components and dosage of reaction solution

[0048]

[0049] Reverse transcription standard program settings (specific settings are shown in Table 3)

[0050] Table 3 Specific values ​​for setting the standard reverse transcription program

[0051] temperature time 25℃ 5 minutes 55℃ 15 minutes 85℃ 5 minutes

[0052] The product after the reverse transcription reaction is completed is cDNA, which should be stored at -20℃ and used within half a year. If stored for a long time (more than half a year), it should be packaged and stored at -80℃. In addition, cDNA should avoid repeated freezing and thawing to avoid degradation.

[0053] 2.3 Construction of recombinant plasmid

[0054] The published PeSUS3CDS sequence of bamboo in the database (as shown in SEQ ID NO.1, sequence source: gene number>CY_hic_hap1_01Gene004387) was used to design primers by homologous recombination method and perform PCR amplification reaction. The PCR reaction system is shown in Table 4, and the PCR reaction procedure is shown in Table 5. Figure 1 As shown, the PCR product (amplified bamboo PeSUS3 sequence) was detected by 0.1% agarose gel electrophoresis.

[0055] The primer sequences for the PCR reaction are as follows:

[0056] SEQ ID NO 2: Upstream Primer F: ATGGGGGAAGCTGCCGGCGAC

[0057] SEQ ID NO 3: Upstream primer R: TTTGTTCGAGGGCTCTCCATCA

[0058] The high-fidelity enzyme used in the experiment was 2×Phanta Max Master Mix (Dye Plus) (Nanjing Vazyme Biotech Co., Ltd.), and cDNA was used as a template to amplify the target fragment.

[0059] Table 4 PCR reaction system for target gene amplification cDNA 1-5μL 2×Phanta Max Master Mix(Dye Plus) 25μL Forward Primer (10μM) 2μL Reverse Primer (10μM) 2μL <![CDATA[ddH2O]]> up to 50μL

[0060] Table 5 PCR reaction program for target gene amplification

[0061] Double restriction enzyme digestion of plasmid DNA to linear

[0062] Table 6 shows the enzyme digestion system Reagents Dosage Plasmid DNA 1 μg 10×FD buffer 2μL Endonuclease 1 1μL Endonuclease 2 1μl ddH2O Up to 20μl

[0063] The enzyme digestion was carried out at 37°C for 30 minutes. After the reaction, the band size was detected by agarose gel electrophoresis, and the target fragment was cut out under ultraviolet light for purification and recovery.

[0064] 2.4 Rubber Recycling

[0065] DNA gel recovery was performed using the Simgen DNA gel recovery kit in strict accordance with the instructions. The specific steps are as follows:

[0066] 2.4.1 Cut out the agarose gel containing the DNA fragment under UV light and transfer it to a clean 1.5 ml centrifuge tube.

[0067] Note: Try to cut off as much excess gel volume as possible. If the gel volume is large, cutting it into small pieces will help shorten the gelation time.

[0068] 2.4.2 Weigh the cut gel and add 1 volume of Buffer G (1 μL gel volume for every 1 mg gel).

[0069] Note: For example, 200 μl Buffer G should be added to 200 mg of gel.

[0070] 2.4.3 Vortex Buffer SI to suspend all the media in it, and pipette 30 μL of Buffer SI into the 1.5 mL centrifuge tube containing the gel.

[0071] 2.4.4 Place the centrifuge tube in a 50°C water bath until the gel is completely dissolved (approximately 5 to 10 minutes).

[0072] 2.4.5 Centrifuge at 8000 rpm for 30 seconds and carefully discard the supernatant with a pipette.

[0073] Note: Be careful not to aspirate the precipitate at the bottom of the tube as it contains DNA.

[0074] 2.4.6 Add 500 μl Buffer WS, cover the tube, and gently invert the centrifuge tube repeatedly until the precipitate is completely dispersed.

[0075] Note: This step is to remove the residual trace agarose molecules.

[0076] Note: Do not vortex in this step, otherwise it may cause the breakage of large DNA fragments; if the precipitate is difficult to disperse, tap the tube wall with your fingers to disperse it.

[0077] 2.4.7 Centrifuge at 8000 rpm for 30 seconds and carefully discard the supernatant with a pipette.

[0078] 2.4.8 Add 1 ml of Buffer WG, cover the tube, gently flip the tube to disperse the precipitate. Centrifuge at 8000 rpm for 30 seconds, and carefully discard the supernatant with a pipette.

[0079] Note: Make sure that anhydrous ethanol has been added to Buffer WG. Do not vortex during this step, otherwise it may cause large DNA fragments to break; if the precipitate is difficult to disperse, tap the tube wall with your fingers to disperse it.

[0080] Note: Optionally, repeat step 8 once. Repeating the wash once ensures that DNA with lower residual salt content is obtained.

[0081] 2.4.9 Cover the tube and centrifuge at low speed for a few seconds to allow the solution on the tube wall to settle to the bottom of the tube. Carefully use a 20-200μL pipette tip to aspirate as much of the supernatant as possible and discard it. Dry the precipitate at room temperature. The precipitate should be white powder when it is dried.

[0082] Note: The centrifuge tube can be placed in a 37°C incubator to speed up the drying process, but negative pressure drying should not be used because it will cause over-drying and affect the elution efficiency of DNA.

[0083] 2.4.10 Add 20-30 μl Buffer TE, tap the tube lightly with your finger to disperse the precipitate, and place in a 50℃ water bath for 10 minutes.

[0084] Note: Deionized water can also be used to elute DNA, but the pH of the deionized water used should be between 7.0 and 8.5, otherwise it will affect the elution efficiency of DNA.

[0085] 2.4.11 Centrifuge at 12000rpm for 30 seconds, carefully use a pipette to transfer the supernatant containing DNA to another clean centrifuge tube. The obtained DNA can be used immediately for various molecular biology experiments; or the DNA can be stored at -20℃ for later use.

[0086] 2.5 Homologous recombination reaction

[0087] The kit used for connecting the target fragment to the vector was ClonExpress II One Step Cloning Kit (C112, Nanjing Vazyme Biotech Co., Ltd). The specific operation steps were carried out according to the instructions:

[0088] Table 6 The following system was carried out on ice: Components Dosage Linearized vector XμL Insert YμL 5×CE II Buffer 4μL Exnas II 2μL ddH2O Up to 20μL

[0089] 37°C, 30 minutes; after the reaction is completed, place on ice for transformation.

[0090] X / Y is used to calculate the amount of vector and insert fragment:

[0091] Optimal amount of cloning vector used = [0.02 × number of base pairs of cloning vector] ng (0.03 pmol)

[0092] Optimal amount of insert fragment = [0.04 × number of base pairs of insert fragment] ng (0.06 pmol)

[0093] 2.5 Preparation of competent E. coli cells

[0094] Original strain: XL10-Gold

[0095] Antibiotic Resistance: XL10-Gold competent cells are resistant to tetracycline and chloramphenicol.

[0096] 2.5.1 Prepare Inoue transformation buffer (pre-cool on ice before use).

[0097] Note: Ultrapure sterile water obtained through a Milli-Q filtration system was used to prepare the transformation buffer.

[0098] Preparation of 0.5 mol / L PIPES (pH 6.7) | piperazine-N,N'-bis(2-ethanesulfonic acid) | (Sigma) solution

[0099] Dissolve 15.1 g PIPES in 80 ml ultrapure water, adjust pH to 6.7 with 5 mol / L KOH, make up to 100 ml, sterilize by high pressure steam at 121°C for 20 minutes, and store at 4°C.

[0100] Note: Prepare at least 20 ml of 5 mol / L KOH and adjust the pH to a transparent and clear state.

[0101] Preparation of Inoue transformation buffer: Dissolve the following components in 800 ml sterile ultrapure water, add 20 ml 0.5 mol / L PIPES (pH = 6.7), and dilute to 1 L. Generally, 500 ml Inoue transformation buffer is required for 250 ml of bacterial solution, and it is prepared before use.

[0102] Table 7 Transformation buffer components

[0103] Reagents Required amount / L Final concentration 500mL 200mL MnCl2·4H2O 10.88g 55mM / L 5.44g 2.176 CaCl2·2H2O 2.20g 15mM / L 1.1g 0.44g

[0104] Note: Sterilize by vacuum filtration with a 0.22 μm filter (can be sterilized by high pressure steam at 121°C for 20 minutes. Store at 4°C.)

[0105] 2.5.2 Activate the strain on a plate, pick a single colony and inoculate it into 4 ml LB liquid medium (add 4 μl of 25 mg / ml chloramphenicol resistance) (8-10 am), and culture it at 37°C incubator (220 r / min) for 19-21 hours.

[0106] 2.5.3 Inoculate the above initial culture into 250mL LB liquid medium (with 250μL of 25mg / ml chloramphenicol resistance) at 1:100 (8 am), and culture overnight at 18℃ shaker (200r / min) for about 24h. (Note: Use a 1L conical flask to shake 250mL LB liquid medium; you can shake another bottle for backup.)

[0107] 2.5.4 Measure the OD value of the culture (4 pm the next day) (approximately 34 hours). When the culture OD600 = 0.55 (not greater than 0.65), divide the culture into 50 mL centrifuge tubes and place them on ice for 10 minutes.

[0108] (Note: When OD600 is about 0.4, the bacterial growth rate is very fast. Measure and record OD every 30 minutes to prevent the activity of the bacteria from decreasing. After measuring the OD value, pre-freeze the 2mL centrifuge tube in advance.)

[0109] 2.5.5 Collect the cells by centrifugation at 4000 rpm for 10 minutes at 4°C.

[0110] 2.5.6 Pour out the culture medium and place the centrifuge tube upside down on absorbent paper (filter paper) for 2 minutes to absorb the remaining liquid (it does not take a long time, just absorb it dry). Be careful to prevent the bacteria from flowing out from the bottom of the tube.

[0111] 2.5.7 Add an equal volume (50 mL) of pre-cooled Inoue transformation buffer to resuspend the bacterial pellet (resuspend on ice).

[0112] 2.5.8 Collect the cells by centrifugation at 4000 rpm for 10 minutes at 4°C.

[0113] 2.5.9 Add 20 mL of pre-cooled Inoue transformation buffer to each tube to resuspend the bacterial pellet (resuspend on ice) and combine 5 tubes into 2 tubes.

[0114] 2.5.10 Collect the cells by centrifugation at 4000 rpm for 10 minutes at 4°C.

[0115] 2.5.11 Add 20 mL of pre-cooled Inoue transformation buffer to each tube to resuspend the bacterial pellet (resuspend on ice) and combine the two tubes into one tube.

[0116] 2.5.12 Collect the cells by centrifugation at 4000 rpm for 10 minutes at 4°C.

[0117] 2.5.13 Gently resuspend the pellet in 20 ml pre-cooled Inoue transformation buffer (resuspend on ice). Add 1.5 ml DMSO (Amresco, ACS grade) (open in a clean bench and filter with a 0.22 μm filter). Gently mix the bacterial suspension and place on ice for 10 minutes.

[0118] 2.5.14 On ice, dispense the bacterial suspension into pre-cooled sterile centrifuge tubes (1.5 ml), immerse the bottom of the tube in liquid nitrogen, then take out and seal the tube mouth, and immerse it in liquid nitrogen to quickly freeze the competent cells. Store at -80℃ for later use.

[0119] Note: Quick freezing with liquid nitrogen can increase the transformation efficiency by 5 times. After packaging, take out from liquid nitrogen and thaw on ice before use.

[0120] Special attention:

[0121] 1. This method requires that the entire production process is in a low-temperature environment. Starting from step 5, the temperature should be kept as low as possible. Therefore, the clean bench should be sterilized with ultraviolet light and wiped with alcohol. Do not turn on the alcohol lamp during the entire production process.

[0122] 2. This method is applicable to XL10-Gold, XL-Blue, DH1, JM103, JM108 / 109, DH52 and HB101.

[0123] 3. Pre-cool the Inoue transformation solution to 0°C on ice before use.

[0124] 2.6 Introduction of recombinant plasmid into competent E. coli cells

[0125] 2.6.1 Take the chemically competent cells for cloning out of the -80°C freezer and thaw on ice.

[0126] 2.6.2 Take 5-10 μl of the recombinant product and add it to 100 μl of competent cells. Mix by gently tapping the tube wall (do not oscillate to mix). Let it stand on ice for 30 minutes.

[0127] The volume of the recombinant product should not exceed 1 / 10 of the volume of the competent cells used.

[0128] 2.6.3 After heat shock in a 42℃ water bath for 45 seconds, immediately place on ice to cool for 2-3 minutes. Add 900μl SOC or LB liquid culture medium (without antibiotics) and shake at 37℃ for 1 hour (speed 200-250rpm).

[0129] 2.6.4 Preheat the LB solid culture medium plate with the corresponding resistance in a 37℃ incubator. Centrifuge at 5,000rpm (2,500×g) for 5 minutes and discard 900μl of supernatant. Resuspend the bacteria with the remaining culture medium and spread it evenly on the plate with the correct resistance using a sterile coating stick. Seal the plate after the surface liquid is completely absorbed.

[0130] 2.6.5 Incubate inverted in a 37°C incubator for 12-16 hours.

[0131] 2.7 Colony PCR

[0132] The PCR reaction conditions are: pre-denaturation at 94°C for 2 minutes; denaturation at 94°C for 30 seconds; annealing at 55-65°C for 30 seconds; extension at 72°C for 30 seconds / kb, 35 cycles; final extension at 72°C for 2 minutes. The primer sequences used in colony PCR are as follows:

[0133] SEQ ID NO 4:GAGATGGCAATTCGGTCTA

[0134] SEQ ID NO 5:CTGTACCTGTACCAGTTCCGGACA

[0135] Table 8 PCR reaction system

[0136]

[0137] 2.8 Sequencing

[0138] The colony PCR reaction solution was subjected to agarose gel electrophoresis, and the correctly connected bacterial solution was selected for sequencing by Qingke Biotechnology (Hangzhou), and the sequencing results were compared with the plasmid vector sequence.

[0139] 2.9 Plasmid extraction

[0140] Use the Simgen high-purity plasmid DNA small-volume kit method and strictly follow the actual instructions. The specific steps are as follows:

[0141] 2.9.1 Centrifuge at 12000rpm for 30 seconds to collect 1-5ml of overnight cultured bacteria, discard the culture medium, and add 250μl of Buffer I with RNase A added to fully suspend the precipitated bacteria.

[0142] Note: The precipitated bacterial clumps can be suspended by vortexing or by blowing with a pipette several times. The fully suspended bacteria should be a uniform suspension, and no visible small bacterial clumps should remain, otherwise it will seriously affect the final yield of plasmid DNA.

[0143] 2.9.2 Add 250 μl Buffer II and gently and thoroughly invert the centrifuge tube 4-6 times (do not use a vortex shaker to mix, otherwise the final prepared plasmid DNA will be mixed with genomic DNA).

[0144] Note: When the bacteria are fully lysed, the solution should be viscous and translucent. If the solution does not become translucent, it may be due to excessive bacteria. The number of inversions must be increased to achieve the effect of full bacterial lysis.

[0145] 2.9.3 Add 10 μl of alkaline protease storage solution, gently invert and mix 4-6 times, and let stand at room temperature for 5 minutes.

[0146] 2.9.4 Add 350 μl Buffer III and gently and thoroughly invert the centrifuge tube until the upper light blue solution disappears and a light yellow precipitate is formed.

[0147] Note: Do not use a vortex shaker to mix in this step, otherwise the final prepared plasmid will be mixed with genomic DNA.

[0148] Note: When this step is fully effective, a loose light yellow flocculent precipitate should be produced; if the precipitate appears thick, it may be due to excessive use of bacteria. Increase the number of inversions to make the precipitate loose.

[0149] 2.9.5 Centrifuge at 13000rpm for 10 minutes.

[0150] 2.9.6 Place the nucleic acid purification column in a 2 ml centrifuge tube, pour the supernatant in step 4 into the nucleic acid purification column, cover the tube, and centrifuge at 12000 rpm for 30 seconds.

[0151] 2.9.7 Discard the filtrate in the 2 ml centrifuge tube, place the nucleic acid purification column back into the 2 ml centrifuge tube, add 500 μl Buffer W1 to the nucleic acid purification column, cover the tube, and centrifuge at 12000 rpm for 30 seconds.

[0152] Note: The filtrate does not need to be completely discarded. If you want to avoid contamination of the centrifuge by the filtrate adhering to the mouth of the centrifuge tube, you can turn the 2ml centrifuge tube upside down on a paper towel.

[0153] Clap once.

[0154] 2.9.8 Discard the filtrate in the 2 ml centrifuge tube, place the nucleic acid purification column back into the 2 ml centrifuge tube, and

[0155] Add 700 μl of Buffer W2 to the column, cover the tube, and centrifuge at 12,000 rpm for 30 seconds.

[0156] Note: Make sure that anhydrous ethanol has been added to Buffer W2.

[0157] 2.9.9 Discard the filtrate in the 2 ml centrifuge tube, place the nucleic acid purification column back into the 2 ml centrifuge tube, and centrifuge at 14000 rpm.

[0158] Centrifuge for 1 minute.

[0159] Note: If the centrifuge speed cannot reach 14000 rpm, centrifuge at the highest speed for 2 minutes.

[0160] Note: This step of high-speed centrifugation is to remove all residual ethanol. Do not omit it, otherwise the subsequent experimental results may be affected by residual ethanol in the purified plasmid.

[0161] 2.9.10 Discard the 2ml centrifuge tube, place the nucleic acid purification column in a clean 1.5ml centrifuge tube, add 50-100μl Buffer E to the center of the membrane of the purification column, cover the tube, let it stand at room temperature for 1 minute, and centrifuge at 12000rpm for 30 seconds.

[0162] Note: If the centrifuge does not have a leak-proof cover, please change the centrifugation condition to 8000rpm for 1 minute to prevent the 1.5ml centrifuge tube cover from falling off and damaging the centrifuge.

[0163] Note: Deionized water can also be used to elute DNA, but the pH of the deionized water used should be between 7.0 and 8.5, otherwise it will affect the elution efficiency of DNA.

[0164] 2.9.11 Discard the purification column. The eluted plasmid can be used immediately for various molecular biology experiments; or store the plasmid DNA at -20℃ for later use.

[0166] 2.10 Preparation of competent Agrobacterium

[0167] 2.10.1 Streak the original Agrobacterium tumefaciens GV3101 stored in -80℃ refrigerator on YEP medium.

[0168] 2.10.2 Pick a single colony and culture it in 10 mL of YEP liquid medium containing the antibiotic rifampicin at 28°C, 200 rpm, overnight.

[0169] 2.10.3 Inoculate the activated bacterial solution into 50 mL of YEP liquid culture medium containing Rif at a ratio of 1:50, culture at 28°C, 200 rpm, for 6 h until OD600 is between 0.4-0.6.

[0170] 2.10.4 Transfer the bacterial solution to a new pre-cooled centrifuge tube, centrifuge at 4°C, 4000 rpm for 5 minutes, remove the supernatant, resuspend the bacteria with 10 mL of ice-cold MgCl2 (0.1 M), and then place the bacterial solution on ice for 10 minutes.

[0171] 2.10.5 Centrifuge at 4000 rpm for 5 minutes at 4°C to collect the cells and gently resuspend them in 5 mL of ice-cold CaCl2 (0.1 M).

[0172] 2.10.6 Add DMSO at a final concentration of 8%, then dispense the competent cells into 1.5 mL centrifuge tubes, freeze them in liquid nitrogen and store them in a -80°C refrigerator.

[0173] 2.11 Transformation of Agrobacterium with recombinant plasmid

[0174] 2.11.1 Take the competent Agrobacterium GV3101 stored at -80℃ and place it on ice until it partially melts. When it is in an ice-water mixture state, insert it into ice.

[0175] 2.11.2 Add 1ug (no more than 10ul) plasmid DNA to every 100ul competent cell, stir the bottom of the tube by hand to mix, and place on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37℃ water bath for 5 minutes, and in an ice bath for 5 minutes.

[0176] 2.11.3 Add 700 μl of LB or YEB liquid culture medium without antibiotics and culture at 28°C with shaking for 2 to 3 hours.

[0177] 2.11.4 Collect the bacteria by centrifugation at 6000 rpm for one minute, take about 100 μl of the supernatant, gently blow to resuspend the bacteria, spread it on LB or YEB plates containing Kan antibiotics, and place it upside down in a 28℃ incubator for 2 to 3 days.

[0178] 2.11.5 After plaques are grown, verify by colony PCR, shake the bacteria, and multiply to obtain the Agrobacterium liquid containing the recombinant plasmid, which is stored for later use.

[0179] Table 9 Enzyme and biochemical reagent components

[0180] Restriction endonuclease (SalI) Yisheng Biotechnology (Shanghai) Co., Ltd. 2X NG PCR MasterMix Shanghai Huiling Biotechnology Co., Ltd. High-fidelity enzyme Novozymes Homologous recombination enzyme Novozymes Plasmid Extraction Kit Hangzhou Xinjing Biological Reagent Development Co., Ltd. DNA Gel Extraction Kit Hangzhou Xinjing Biological Reagent Development Co., Ltd. Acetosyringone (Ace) Shanghai Bioengineering SYBR Green fluorescent quantitative reagent Yisheng Biotechnology (Shanghai) Co., Ltd. Nucleic acid stains Yisheng Biotechnology (Shanghai) Co., Ltd. cDNA Reverse Transcription Kit Yisheng Biotechnology (Shanghai) Co., Ltd. RNA Extraction Kit MES Eric Biotechnology Co., Ltd.

[0181] Table 10 Formulation of the culture medium used in the experiment

[0182] 2.12 Preparation of antibiotics

[0183] 2.12.1 Kanamycin (50 mg / mL): Weigh 2 g of Kanamycin and dissolve it in 20 mL of sterile water. Then filter it with a 0.22 um bacterial filter and dispense it. This step needs to be performed on a clean bench. Finally, store the prepared reagent at -20°C.

[0184] 2.12.2 Rifampicin (50 mg / mL): Weigh 2 g of Rifampicin and dissolve it in 40 mL of DMSO. Dispense the aliquots on a clean bench and store the prepared reagents at -20°C.

[0185] 2.13 Obtaining transgenic tobacco

[0186] In order to verify the function of the PeSUS3 gene, the recombinant plasmid containing the PeSUS3 gene was first introduced into tobacco (such as Nicotiana benthamiana) through the Agrobacterium-mediated method to obtain transgenic tobacco plants. The specific steps are as follows:

[0187] 2.13.1 Wild-type Nicotiana benthamiana seeds were sown in a matrix soil with a ratio of perlite, peat and vermiculite of 1:1:1 and placed in an incubator with a photoperiod of 16 hours light / 8 hours dark and a temperature of 28°C for cultivation. When the tobacco seedlings grew to three true leaves, they were transferred to individual culture boxes and continued to be cultivated in a greenhouse with a humidity of 60% RH and a photoperiod of 14 hours light / 10 hours dark.

[0188] 2.13.2 Agrobacterium infection of tobacco: When tobacco plants grow to a suitable size (about 4-6 weeks old), select healthy leaves for Agrobacterium injection. Inject the Agrobacterium carrying the PeSUS3 gene into tobacco leaves by injection, and then place them in an incubator for culture.

[0189] 2.13.3 Use of transgenic tobacco: Fluorescence observation results of transgenic tobacco leaves are as follows: Figure 2 As shown, the successful introduction of transgenes was proved. After the fluorescence expression in tobacco leaves is stable, subsequent experiments can be carried out.

[0190] 2.14 Obtaining genetically modified bamboo

[0191] 2.14.1 Planting wild bamboo: Soak the seeds of Manche sweet dragon bamboo purchased from Yunnan in warm water and sow them evenly in a seedling tray covered with two layers of moist filter paper. After the seeds take root and germinate, transfer the seedlings to an aqueous solution containing 0.5μmol calcium chloride for cultivation. When the hydroponic seedlings have 1-2 leaflets, transfer them to a light incubator for germination and cultivation. Finally, use Kimura nutrient solution for hydroponics, or plant them in a matrix soil with a ratio of perlite, peat soil, and vermiculite of 1:1:1, and place them in an incubator with a photoperiod of 16 hours of light / 8 hours of darkness and a temperature of 28°C.

[0192] 2.14.2 Mechanical inoculation: When the bamboo seedlings grow to 3-4 leaves, mechanical inoculation is carried out. Select healthy bamboo seedlings, sprinkle 600-mesh corundum or diatomaceous earth on the leaves, hold the leaves with your left hand, dip the index finger of your right hand into the juice of bamboo mosaic virus containing the PeSUS3 gene, and gently rub it on the inoculated leaves to cause slight wounds without causing death. After inoculation, place the bamboo seedlings in a dark and humid environment at 20-25℃ for two days, and then transfer them to an incubator with a temperature of 28℃, a humidity of 79%RH, and a photoperiod of 16 hours of light / 8 hours of darkness for cultivation.

[0193] 2.14.3 Observation of phenotype: After inoculation, the growth of bamboo was observed regularly, especially the germination of tiller buds and the number of tillers. The number of tiller buds at the root was counted about 40 days after inoculation. Figure 4The fluorescence observation results of transgenic Manchegodon sempervirens leaves are shown in Figure 3 As shown, the successful introduction of transgene was confirmed.

[0194] 2.15 RT-PCR

[0195] Total RNA was extracted from leaf tissue using the Plant Total RNA Kit (Xinjing Biotechnology, Product No.: 5101050). Polymerase chain reaction (PCR) was performed using primers for amplifying green fluorescent protein (GFP) to detect the presence of transgenes. Ultra-Rapid HotStart PCR Master Mix (with Dye) (Shanghai Yisheng Biotechnology, product number: 10157ES08) was used for PCR according to its instruction manual. The amplified DNA fragments were separated by electrophoresis on 1.2% (m / v) agarose gel and visualized using the Omega LumTM imaging system (US Aplegen). The results are shown in Figure 5 The results show that PeSUS3 was successfully introduced. The primer sequences used for GFP amplification are SEQ ID NO 6 and SEQ ID NO 7.

[0196] SEQ ID NO 6: ATGGTGAGCAAGGGCGAG

[0197] SEQ ID NO 7:TTACTTGTACAGCTCGTCCATGC

[0199] 2.16 RT-qPCR

[0200] RT-qPCR was performed using the Ultra SYBR mix (CWBIO, China, CW2601M) kit according to the instructions. The primers used for fluorescence quantification were designed in primer 6, and the specific primer sequences were SEQ ID NO 6 and SEQ ID NO 7. The bamboo actin gene (actin) was used as an internal reference gene, and the sequence was SEQ ID NO 8. Amplification was performed using a Bio-Rad instrument under the following reaction conditions: 95°C for 10 minutes; 40 cycles: 95°C for 10s, 62°C for 30s, and 72°C for 32s. Three biological replicates and three technical replicates were set for each sample. The 2-ΔΔCt method was used for calculation. The expression of the EGFP gene in the tiller buds and leaves of transgenic Manchego bamboo was detected by RT-PCR, and the results are shown in the figure. Figure 6 Shown

[0201] SEQ ID NO 6:TCTTCACGAGGCTGGTCAAC

[0202] SEQ ID NO 7:GTACGGGGGTCTGCTGAAA

[0203] SEQ ID NO 8:ATACACTTCCTCACGCTATTCTT

[0204] SEQ ID NO 9: GCGAGCTTCTCCTTTATGTCCC

[0205] Table 11 RT-qPCR reaction procedure

[0206] 2.17 Biological software and data analysis software

[0207] Primer Premier 5.0 software was used for primer design; primer synthesis was completed by Hangzhou Youkang Biotechnology Co., Ltd. and Beijing Qingke Biotechnology Co., Ltd. (Hangzhou Branch); DNAMAN 6.0 and SnapGene software and NCBI.BLAST (https: / / blast,ncbi.nlm.nih.gov / Blast.cgi)l website were used for DNA sequence analysis and alignment; DNA sequencing and analysis were completed by Hangzhou Youkang Biotechnology Co., Ltd. and Beijing Qingke Biotechnology Co., Ltd. (Hangzhou Branch).

[0208] SEQ ID NO.1: ATGGGGGAAGCTGCCGGCGACCGTGTCCTGAGCCGCCTCCACAGCGTCAGGGAGCGCATCGGCGATTCCCTTTCCGC GCACCCCAATGAGCTCGTTGCCGTCTTCACGAGGCTGGTCAATCTTGGAAAGGGAATGCTGCAGCCCCACCAGATCA TTGCTGAGTACAACAATGCAATCCCTGAGGCAGAGCGTGAGAAGCTGAAGGATGGCGCCTTTGAGGATGTCCTGAGG GCAGCACAGGAGGCGATCGTTATCCCCCATGGGTTGCCCTTGCCATCCGCCCGAGGCCTGGTGTCTGGGAGTATGT GAGGGTCAACGTGAGCGAGCTCGCTGTTGAGGAGTTGAGAGTCCCTGAGTACTTGCAGTTCAAGGAACAGCTTGTGG AAGGAAGCACCAACAACAACTTTGTTCTTGAGCTGGACTTTGAGCCCATTCAATGCCTCCTTCCCTCGTCCTTCTCT TCGAAGTCCATTGGCAACGGTGTGCAGTTCCTCAACAGGCACCTGTCATCAAAGCTCTTCCATGATAAGGAGAGCAT GTACCCCTTGCTCAACTTCCTTCGCCGCGCACAACTACAAGGGCATGACTATGATGTTGAACGACAGAATCCGCAGTC TCAGTGCTCTCCAAGGTGCTCTGAGGAAGGCTGAGGAGCATCTTTCTGGTCTTTCAGCAGACACCCCGTATTCGGAC TTCCACCACAGATTCCAGGAACTTGGTCTGGGAGAAGGGTTGGGGTGATTGTGCAAAGCGTGCGCACGAGACCATCCA CCTCCTCTTGGACCTTCTTGAGGCCCCTGATCCGTCCACCCTGGGAGAAGTTCCTTGGAACAATCCCCAATGGTGTTCA ATGTTGTCATCCTCTCCCCGCATGGTTACTTTGCCCAAGCCAATGTCTTGGGGTACCCTGACACCGGAGGGCAGGTT GTCTACATTTTGGATCAAGTCCGTGCTATGGAGAATGAGATGCTACTGCGGATCAAGCAGCAAGGTCTCAACATCAC ACCACGGATCCTTATTGTCACCAGGATGCTCCCTGCAACCGGCACCACCTGCGGTCAGCGTCTAGAGAAGGTCC TTGGCACTGAGCACACCCACATCCTTCGTGTGCCATTCAGAACTGAAAATGGAATTGTTCGCAAATGGATCTCACGT TTTGAAGTCTGGCCGTACCTGGAGACTTTCACTGATGATGTGGCACATGAGATTGCTGGAGAGCTCCAGGCCAACCC TGACCTGATCATCGGAAACTACAGTGATGGAAACCTTGTTGCGTGCTTGCTTGCACACAAGATGGGTGTTACTCATT GTACCATTGCCCATGCACTTGAGAAAACCAAGTACCCCAACTCCGACCTCTACTGGAAGAAGTTTGAGGACCACTAC CACTTCTCATGCCAGTTCACTACTGACTTGATTGCTATGAACCACGCTGACTTCATCATCACCAGTACCTTCCAAGA GATTGCCGGAAACAAGGACACCGTTGGTCAGTACGAGTCTCACATGGCCTTCACAATGCCTGGGCTGTACCGTGTTG TCCACGGTATCGATGTTTTTGACCCCAAGTTTAACATTGTCTCACCTGGTGCGGACATGTCCATCTACTTCCCTTAC TCCGAGTCACATAAGAGGCTCACCTCCCTCCACCCAGAGATTGAGGAGTTGCTCTACAGTGATGTTGACAACAATGA GCACAAGTTCATGCTGAAGGACAGGAACAAGCCAATCATCTTCTCGATGGCTCGTCTTGACCGTGTCAAGAATTTGA CTGGTCTGGTTGAGCTGTATGGCCGGAATCCTCGCCTGCAAGAGCTGGTTAACCTTGTGGTTGTCTGTGGTGACCAT GGCAATCCATCTAAGGACAAGGAGGAGCAGGCCGAGTTCAAGAAGATGTTTGACCTTGTTGAGCAATACAACCTGAA TGGCCACATCCGCTGGATCTCTGCTCAGATGAACCGTGTCCGCAATGGTGAGCTCTACCGCTACATTTGTGACACCA AGGGTGCTTTCGTGCAGCCTGCTTTCTACGAGGCTTTTGGGCTTACCGTGGTTGAGGCCATGAGCTGCGGTCTTCCG ACATTCGCAACTGCCTATGGTGGTCCAGCTGAGATCATCGTGCACGGTGTGTCTGGCTTCCACATTGACCCTTACCA GGGTGACAAGGCCTCGGCGCTGCTTGTCGAATTCTTTGATAAGTGCCAGCAAGACCCCAGCCACTGGACCAAGATCT CCCAGGGTGGGCTTCAGCGTATTGAGGAGAAGTACACCTGGAAGCTCTACTCTGAGAGGCTGATGACCCTCACTGGT GTTTACGGATTCTGGAAGTACGTCTCCAACCTTGAGAGGCGCGAGACCCGCCGCTACCTCGAGATGCTGTACGCCCT CAAGTACCGCACGATGGCTAGCACTGTTCCATTGGCTGTTGATGGAGAGCCCTCGAACAAATGA

[0209] SEQ ID NO.2:

[0210] MGEAAGDRVLSRLHSVRERIGDSLSAHPNELVAVFTRLVNLGKGMLQPHQIIAEYNNAIPEAEREKLKDGAFEDVLRAAQEAIVIPPWVALAIRPRPGVWEYVRVNVSELAVEELRVPEYLQFKEQLVEGSTNNNFVLELDFEPFNASFPRPSLSKSIGNGVQFLNRHLSSKLFHDKESMYPLLNFLRAHNYKGMTMMLNDRIRSLSALQGALRKAEEHLSGLSADTPYSDFHHRFQELGLEKGWGDCAKRAHETIHLLLDLLEAPDPSTLEKFLGTIPMVFNVVILSPHGYFAQANVLGYPDTGGQVVYILDQVRAMENEMLLRIKQQGLNITPRILIVTRMLPDATGTTCGQRLEKVLGTEHTHILRVPFRTENGIVRKWISRFEVWPYLETFTDDVAHEIAGELQANPDLIIGNYSDGNLVACLLAHKMGVTHCTIAHALEKTKYPNSDLYWKKFEDHYHFSCQFTTDLIAMNHADFIITSTFQEIAGNKDTVGQYESHMAFTMPGLYRVVHGIDVFDPKFNIVSPGADMSIYFPYSESHKRLTSLHPEIEELLYSDVDNNEHKFMLKDRNKPIIFSMARLDRVKNLTGLVELYGRNPRLQELVNLVVVCGDHGNPSKDKEEQAEFKKMFDLVEQYNLNGHIRWISAQMNRVRNGELYRYICDTKGAFVQPAFYEAFGLTVVEAMSCGLPTFATAYGGPAEIIVHGVSGFHIDPYQGDKASALLVEFFDKCQQDPSHWTKISQGGLQRIEEKYTWKLYSERLMTLTGVYGFWKYVSNLERRETRRYLEMLYALKYRTMASTVPLAVDGEPSNK

Claims

1. A PeSUS3 gene of bamboo, characterized in that: The nucleotide sequence of the bamboo PeSUS3 gene is shown in SEQ ID NO.

1.

2. The bamboo PeSUS3 gene according to claim 1, characterized in that The protein encoded by the gene has the function of sucrose synthase and can catalyze the reversible reaction between sucrose and glucose and fructose.

3. Use of the bamboo PeSUS3 gene as claimed in claim 1 or 2 in promoting the sprouting of plant tillering buds.

4. The use according to claim 3, characterized in that: The moso bamboo PeSUS3 gene increases the number of plant tillering buds by overexpression and promotes early germination of tillering buds.

5. The use according to claim 3, characterized in that: The plant is a bamboo plant, in particular Dendrocalamus brandisii (Munro) Kurz, but is not limited to bamboo plants.

Images