Heterologous expression and preparation method of recombinant human lactoferrin in yeast

By constructing recombinant yeast engineered strains in Pichia pastoris and employing codon optimization and signal peptide replacement methods, the expression challenge of human lactoferrin in large-scale production was solved, achieving efficient soluble expression and high yield of recombinant human lactoferrin.

CN119776401BActive Publication Date: 2025-12-02JIANGSU TRAUTEC MEDICAL TECH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411898497.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-23
Publication Date
2025-12-02
Estimated Expiration
2044-12-23

AI Technical Summary

Technical Problem

Existing technologies struggle to achieve efficient, soluble expression and preparation of bioactive human lactoferrin in large-scale production, especially due to the long growth cycle and complex culture requirements in mammalian and plant cells. While the Pichia pastoris expression system has advantages in glycosylation modification and post-translational folding, it lacks efficient expression methods.

Method used

By constructing recombinant yeast engineered strains and using the OST-pro-αf-pPICZαA-HLF and SUC-pro-αf-pPICZαA-HLF recombinant expression vectors, human lactoferrin was expressed in Pichia pastoris. Codon optimization and signal peptide replacement were employed to achieve efficient soluble expression, with a fermentation yield of 1200 mg/L.

Benefits of technology

The efficient soluble expression of recombinant human lactoferrin in Pichia pastoris was achieved, with a fermentation yield of 1200 mg/L, meeting the needs of large-scale industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119776401B_ABST
    Figure CN119776401B_ABST
Patent Text Reader

Abstract

This invention discloses the heterologous expression of recombinant human lactoferrin in yeast and its preparation method, belonging to the field of biotechnology. Using the HLF gene as a template, codon optimization was performed according to the codon preference of Pichia pastoris. The optimized gene was cloned into the pPICZαA vector, and the coding sequence of the α-factor signal peptide was replaced with the heterozygous signal peptide coding sequence OST-pro-αfactor or SUC-pro-αfactor to construct a recombinant expression vector. This vector was then electroporated into Pichia pastoris X-33 to obtain recombinant engineered yeast strains. The expression of HLF protein was purified by column chromatography and analyzed by SDS-PAGE. The results showed that HLF was expressed solublely and efficiently in the recombinant engineered yeast strains, with a fermentation yield of 1200 mg / L and a molecular weight of approximately 80 kDa, consistent with its theoretical molecular weight.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to the heterologous expression of recombinant human lactoferrin in yeast and its preparation method. Background Technology

[0002] Human lactoferrin (HLF) is an iron-binding protein with a molecular weight of approximately 80 kDa, belonging to the transferrin family. HLF is found in high concentrations in human milk; colostrum contains up to 7 mg / mL, and mature milk has a concentration of 1 mg / mL. HLF contains 691 amino acids, and each lactoferrin molecule contains two homologous domains, located at the N-terminus and C-terminus. Each domain contains two subdomains, forming a gap in which Fe... 3+ The ion binds to two carboxyl groups; these subdomains are called N1 and N2, and C1 and C2, respectively. In its natural state, bovine lactoferrin has only 15-20% iron saturation and is pink in color. The intensity of the color depends on the iron saturation level; lactoferrin with less than 5% iron saturation is usually called apolactoferrin, while iron-saturated lactoferrin is usually called holotoferrin. Human milk lactoferrin is primarily apolactoferrin.

[0003] Lactoferrin is mainly found in organs densely populated with exocrine glands, such as the digestive tract, respiratory tract, and reproductive system. It is also present in the blood and has been found in neutrophils. At sites of inflammation, the synthesis and release of stored lactoferrin are accelerated. Lactoferrin is a multifunctional protein that not only promotes iron absorption but also possesses antibacterial, antiviral, antioxidant, and antitumor properties, and regulates the body's immune system. Therefore, lactoferrin has broad application prospects in the food, feed additive, cosmetic, and pharmaceutical industries.

[0004] For decades, researchers have been searching for the most convenient method for producing lactoferrin. Currently, lactoferrin is mainly obtained through purification from cow's milk or colostrum. However, the lactoferrin content in cow's milk is extremely low, resulting in low production volumes and high prices. Therefore, more and more researchers are focusing on the heterologous expression of human lactoferrin in bacterial, fungal, and animal expression systems. The *E. coli* expression system lacks a glycosylation modification mechanism, preventing the production of bioactive lactoferrin. While mammalian and plant cells can undergo appropriate glycosylation modifications, their long growth cycles and complex cultures make large-scale production difficult.

[0005] The Pichia pastoris expression system offers several advantages over other expression systems for heterologous expression of some difficult-to-express proteins. Firstly, the AOX1 promoter, commonly used in Pichia pastoris, is one of the most potent known promoters for methanol metabolism, achieving expression levels of g / L for many proteins under methanol-induced conditions. Secondly, Pichia pastoris not only possesses the advantages of prokaryotic expression systems—simple operation, low cost, and low requirements for culture conditions—but also exhibits functions not found in prokaryotic expression systems, such as post-translational folding modification, processing, and glycosylation, making it more conducive to the functional expression of exogenous proteins. Furthermore, in the Pichia pastoris expression system, the exogenous protein gene is integrated into the yeast genome, resulting in significantly higher stability compared to prokaryotic expression systems. Under adequate aeration, Pichia pastoris can achieve a cell dry weight of 100 g / L, exhibiting rapid growth and suitability for high-density culture, enabling large-scale industrial production at low cost and higher economic benefits. Human lactoferrin is a product encoded by a eukaryotic gene, requiring post-translational folding modification and glycosylation. Therefore, the Pichia pastoris expression system is an ideal choice for heterologous expression of human lactoferrin. This invention aims to develop a recombinant engineered bacterium to achieve heterologous, soluble, and efficient expression of human lactoferrin in Pichia pastoris. Summary of the Invention

[0006] The purpose of this invention is to provide a method for heterologous expression of recombinant human lactoferrin in yeast and its preparation, thereby addressing the problems existing in the prior art. This invention achieves efficient and soluble expression of recombinant human lactoferrin by constructing engineered recombinant yeast strains, with a fermentation yield reaching 1200 mg / L.

[0007] To achieve the above objectives, the present invention provides the following solution:

[0008] This invention provides a method for constructing a recombinant yeast engineered strain OH that solublely expresses recombinant human lactoferrin, comprising the steps of transforming the recombinant expression vector OST-pro-αf-pPICZαA-HLF into yeast host cells to prepare the recombinant yeast engineered strain OH;

[0009] The method for constructing the recombinant expression vector OST-pro-αf-pPICZαA-HLF includes: cloning the HLF gene into the expression vector pPICZαA to obtain the recombinant expression vector pPICZαA-HLF;

[0010] The gene encoding the α-factor signal peptide in the recombinant expression vector pPICZαA-HLF was replaced with the gene encoding OST-pro-αfactor to obtain the recombinant expression vector OST-pro-αf-pPICZαA-HLF;

[0011] The nucleotide sequence of the HLF gene is shown in SEQ ID NO.1;

[0012] The nucleotide sequence of the gene encoding the α-factor signal peptide is shown in SEQ ID NO.2;

[0013] The nucleotide sequence of the gene encoding the OST-pro-α factor is shown in SEQ ID NO.7;

[0014] Furthermore, the yeast host cell is Pichia pastoris X-33.

[0015] The present invention also provides a recombinant yeast strain OH that expresses recombinant human lactoferrin in a soluble form, constructed according to the above-described construction method.

[0016] Furthermore, the recombinant yeast strain OH is Pichia pastoris (Komagataella phaffii) OH10, which was deposited on November 7, 2024, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 32533.

[0017] The present invention also provides a method for constructing a recombinant yeast engineered strain SH that solublely expresses recombinant human lactoferrin, comprising the steps of transforming the recombinant expression vector SUC-pro-αf-pPICZαA-HLF into yeast host cells to prepare the recombinant yeast engineered strain SH;

[0018] The method for constructing the recombinant expression vector SUC-pro-αf-pPICZαA-HLF includes: cloning the HLF gene into the expression vector pPICZαA to obtain the recombinant expression vector pPICZαA-HLF;

[0019] The gene encoding the α-factor signal peptide in the recombinant expression vector pPICZαA-HLF was replaced with the gene encoding SUC-pro-αfactor to obtain the recombinant expression vector SUC-pro-αf-pPICZαA-HLF;

[0020] The nucleotide sequence of the HLF gene is shown in SEQ ID NO.1;

[0021] The nucleotide sequence of the gene encoding the α-factor signal peptide is shown in SEQ ID NO.2;

[0022] The nucleotide sequence of the gene encoding the SUC-pro-α factor is shown in SEQ ID NO.8.

[0023] Furthermore, the yeast host cell is Pichia pastoris X-33.

[0024] The present invention also provides a recombinant yeast strain SH that expresses recombinant human lactoferrin in a soluble form, constructed according to the above-described construction method.

[0025] The present invention also provides the application of the above-mentioned recombinant yeast engineered strain OH or recombinant yeast engineered strain SH in the soluble expression of recombinant human lactoferrin.

[0026] The present invention also provides a method for preparing recombinant human lactoferrin by soluble expression, comprising the steps of fermenting and culturing the above-mentioned recombinant yeast engineered strain OH or recombinant yeast engineered strain SH to obtain bacterial cells, lysing the bacterial cells and purifying them to obtain the recombinant human lactoferrin.

[0027] The present invention also provides a recombinant human lactoferrin prepared according to the above method.

[0028] The present invention discloses the following technical effects:

[0029] This invention uses the HLF gene as a template, optimizes the codons according to the codon preference of Pichia pastoris, clones the optimized gene into the pPICZαA vector, and replaces the N region presequence of the α-factor signal peptide with the OST or SUC signal peptide to construct the recombinant expression vector pPICZαA-HLF. This vector is then electroporated into Komagataella phaffii X-33 to obtain recombinant engineered yeast. Column chromatography purification combined with SDS-PAGE analysis of HLF protein expression showed that HLF was expressed solublely and efficiently in the recombinant engineered yeast, with a fermentation yield of 1200 mg / L and a molecular weight of approximately 80 kDa, consistent with its theoretical molecular weight. Attached Figure Description

[0030] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0031] Figure 1 The results of SDS-PAGE analysis of secretory protein expression in supernatants of different fermentation broths after 96 h of fermentation are shown in the figure.

[0032] Figure 2 The image shows the results of SDS-PAGE analysis of intracellular protein expression in yeast cells fermented for 96 hours.

[0033] Figure 3 The image shows the results of SDS-PAGE analysis of purified protein. Detailed Implementation

[0034] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0035] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0036] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0037] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0038] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0039] The sequence information and culture medium formulation involved in this invention are as follows:

[0040] SEQ ID NO.1:

[0041]

[0042] α-factor signal peptide sequence (SEQ ID NO.2):

[0043] ATGAGATTTCCTTCAATTTTTACTGCTGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGA AGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCT.

[0044] The N-region of the α-factor signal peptide sequence, i.e., the presequence sequence (SEQ ID NO.3):

[0045] ATGAGATTTCCTTCAATTTTTACTGCTGTTTTATTCGCAGCATCCTCCGCATTAGCT.

[0046] The C-region of the α-factor signal peptide sequence, i.e., the pro region sequence (SEQ ID NO.4):

[0047] GCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCT.

[0048] The coding sequence of the OST signal peptide (SEQ ID NO.5) is as follows:

[0049] ATGAGGCAGGTTTGGTTCTCTTGGATTGTGGGATTGTTCCTATGTTTTTTCAACGTGT CTTCTGCT.

[0050] The coding sequence of the SUC signal peptide (SEQ ID NO.6) is as follows:

[0051] ATGCTTTTGCAAGCTTTCCTTTTCCTTTGGCTGGTTTTGCAGCCAAAATATCTGCA.

[0052] The sequence of OST-pro-αfactor (SEQ ID NO.7) is as follows:

[0053] ATGAGGCAGGTTTGGTTCTCTTGGATTGTGGGATTGTTCCTATGTTTTTTCAACGTGTCTTTCTGCT GC TCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAA GGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTG CCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCT , where the underlined part represents the sequence of the proregion.

[0054] The sequence of SUC-pro-α factor (SEQ ID NO.8) is as follows:

[0055] ATGCTTTTGCAAGCTTTCCTTTTCCTTTGGCTGGTTTTGCAGCCAAAATATCTGCA GCTCCAGTCAA CACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTC GATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTG CTGCTAAAGAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCT The underlined part represents the sequence of the pro region.

[0056] BMGY medium: 1% yeast extract, 2% tryptone, 100mM potassium phosphate buffer (pH 6.0), 1.34% YNB (amino acid-free yeast nitrogen source, YeastNitrogen Base), 0.004% biotin and 1% glycerol.

[0057] BMMY medium: 1% yeast extract, 2% tryptone, 100mM potassium phosphate buffer (pH 6.0), 1.34% YNB (amino acid-free yeast nitrogen source, YeastNitrogen Base), 0.004% biotin and 0.5% methanol.

[0058] YPD liquid medium: 1% yeast extract, 2% tryptone and 2% glucose.

[0059] YPD-Zeocin solid medium: 1% yeast extract, 2% tryptone, 2% glucose, 100 μg / mL bleomycin (Zeocin) and 2% agar powder.

[0060] Method for determining protein concentration: Protein concentration is determined using an A280.

[0061] Example 1: Construction of the human lactoferrin (HLF) gene expression vector

[0062] Based on the codon bias of Pichia pastoris, codon optimization was performed to obtain the human lactoferrin encoding gene HLF, the nucleotide sequence of which is shown in SEQ ID NO.1. The gene was totalized by Biogen. The synthesized HLF gene was cloned into the expression vector pPICZαA to obtain the recombinant expression vector pPICZαA-HLF.

[0063] Based on the successfully constructed recombinant expression vector pPICZαA-HLF, the α-factor signal peptide was replaced with the hybrid signal peptide coding sequences OST-pro-αfactor and SUC-pro-αfactor, respectively. This replacement process was outsourced to a biotechnology company. The resulting recombinant vectors were named OST-pro-αf-pPICZαA-HLF and SUC-pro-αf-pPICZαA-HLF, respectively.

[0064] Example 2: Construction of a recombinant Pichia pastoris system

[0065] The specific steps are as follows:

[0066] (1) The recombinant expression vectors OST-pro-αf-pPICZαA-HLF and SUC-pro-αf-pPICZαA-HLF prepared in Example 1 were linearized with the restriction endonuclease Pme I. The linearization system consisted of 200 μL (20 μg of recombinant vector, 20 μL of 10× buffer, 2 μL of Pme I, and the volume was made up to 200 μL with ultrapure water) and digested overnight at 37°C. The DNA was precipitated with ethanol and sodium acetate, dissolved in 10 μL of ddH2O, and stored at -20°C for later use.

[0067] (2) Competent cells of Pichia pastoris (Komagataella phaffii) X-33 were prepared according to the "Pichia pastoris Expression Manual" of Invitrogen. The linearized recombinant expression vectors OST-pro-αf-pPICZαA-HLF and SUC-pro-αf-pPICZαA-HLF were electroporated into Pichia pastoris X-33 competent cells.

[0068] The electroporation procedure is as follows: Mix 80 μL of competent cells with 10 μL of linearized recombinant plasmid DNA thoroughly and transfer the mixture to a 0.2 cm electroporation cuvette that has been chilled at -20°C. Incubate the cuvette with the mixture on ice for 5 min. Adjust the electroporator parameters to the Pichia pastoris setting: voltage 1.5 kV, capacitance 25 μF, resistance 200 ohms, and time approximately 5 ms. After electroporation, quickly add 1 mL of pre-chilled 1 M sorbitol solution to the cuvette, gently aspirate and mix, then transfer the mixture to a centrifuge tube. Incubate at 30°C for 1 h, then centrifuge at 3000 rpm for 5 min. Discard 800 μL of supernatant, rehydrate the remaining cells, and spread them onto YPD-Zeocin plates. Incubate at 30°C for 2-4 days until large colonies appear on the plates.

[0069] (3) Pick multiple single clones from YPD-Zeocin plates and inoculate them into YPD liquid medium for overnight culture. Take 50 μL of the overnight culture, centrifuge, and discard the supernatant. Add 0.2% SDS to each tube, vortex for 15 s, and heat at 90℃ for 4 min. Centrifuge at maximum speed for 1 min on a benchtop centrifuge, and collect the supernatant as yeast genomic DNA. Perform PCR using AOX1 primers to identify whether OST-pro-αf-pPICZαA-HLF or SUC-pro-αf-pPICZαA-HLF is integrated into the yeast genome.

[0070] The AOX1 primer sequence is as follows:

[0071] Upstream primer: GACTGGTTCCAATTGACAAGC (SEQ ID NO.9);

[0072] Downstream primer: GCAAATGGCATTCTGACATCC (SEQ ID NO.10).

[0073] The PCR reaction system is shown in Table 1:

[0074] Table 1 PCR reaction system

[0075] reagents Added amount Genomic DNA 1μL 2×PhantaMaxMasterMix 12.5μL Upstream primer (10 μM) 1μL Downstream primer (10 μM) 1μL sterile water 9.5μL

[0076] PCR reaction conditions: 94℃, 2 min; 94℃, 30 s, 55℃, 20 s, 72℃, 1 min, 30 cycles; 72℃, 1 min.

[0077] Clones with positive PCR results were designated as OST-pro-αf-pPICZαA-HLF or SUC-pro-αf-pPICZαA-HLF positive transformants, resulting in recombinant Pichia pastoris X-33 / OST-pro-αf-pPICZαA-HLF or Pichia pastoris X-33 / SUC-pro-αf-pPICZαA-HLF, respectively. Pichia pastoris X-33 / OST-pro-αf-pPICZαA-HLF is abbreviated as OH, and the seven selected positive transformants were named OH1-OH7. Pichia pastoris X-33 / SUC-pro-αf-pPICZαA-HLF is abbreviated as SH, and the seven selected positive transformants were named SH1-SH7.

[0078] Strain preservation:

[0079] The positive transformant OH7 was renamed Komagataella phaffii OH10 and deposited on November 7, 2024, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 32533.

[0080] Example 3: Expression of recombinant Pichia pastoris

[0081] (1) The positive transformants OH1-OH7 and SH1-SH7 identified in Example 2 were inoculated into 50 mL centrifuge tubes containing 3 mL LYPD liquid medium and cultured overnight at 30 °C and 220 rpm.

[0082] (2) The next day, 1 mL of the bacterial culture from step (1) was transferred to a 250 mL Erlenmeyer flask containing 25 mL of BMGY medium and incubated at 30°C and 220 rpm until OD. 600 Centrifuge at 3000 rpm for 5 min to collect the bacterial cells, and wash three times with sterile water to remove residual glycerol. This is the seed culture.

[0083] (3) The seed culture obtained in step (2) was resuspended in 25 mL of BMMY medium and transferred to a 250 mL Erlenmeyer flask. It was cultured at 20 °C and 220 rpm for 96 h. 0.5% methanol was added every 24 h to keep the induction going.

[0084] (4) The fermentation broth supernatant and cultured OH1-OH7 and SH1-SH7 cells were collected after the culture was completed. The expression of proteins in the fermentation broth supernatant and intracellular cells after 96 hours of fermentation was detected by SDS-PAGE. The results are as follows: Figure 1-2As shown, the target strip of HLF is located at 80kDa.

[0085] The results show:

[0086] like Figure 1 As shown, the fermentation broth supernatants of strains OH2, OH3, OH4, OH5, and OH6 showed only weak bands at the 80 kDa position, while the fermentation broth supernatants of OH1 and OH7 showed no bands. The fermentation broth supernatants of strains SH1-SH7 all showed no bands at the 80 kDa position.

[0087] like Figure 2 As shown, all strains, including OH1-OH7 and SH1-SH7, exhibited a clear band at the 80 kDa position in their cell lysate supernatant. This indicates that HLF was solublely expressed within whole yeast cells.

[0088] Example 4 Purification of the target protein

[0089] The target protein was purified using centrifugation, ion exchange, and molecular sieving.

[0090] The specific implementation steps are as follows:

[0091] (1) Centrifuge the OH7 and SH7 fermentation broth prepared in Example 3 at 8000 rpm for 10 min and discard the supernatant.

[0092] (2) Resuspend the bacterial cells in buffer A (25mM Tris pH7.5, 100mM NaCl) and lyse the cells. Centrifuge at 12000rpm for 30min and collect the supernatant.

[0093] (3) Protein purification was performed using an FPLC protein chromatography system. The specific procedure was as follows: The QFF anion exchange column was washed sequentially with 5CV ultrapure water, 5CV buffer B (25mM Tris pH 7.5, 1M NaCl), and buffer A (25mM Tris pH 7.5, 100mM NaCl) at a flow rate of 5 mL / min. Diluted fermentation broth was loaded onto the equilibrated QFF column using a peristaltic pump at a flow rate of 1.6 mL / min, and flow-through was collected. The QFF column was connected to the FPLC system, and proteins were linearly eluted (0-1M NaCl in 25mM Tris pH 7.5). Protein was detected by SDS-PAGE, and the elution peak was collected. Dialysis was then performed (25mM Tris pH 7.5, 100mM NaCl).

[0094] Purification results are as follows Figure 3 As shown, a target band corresponding to the theoretical molecular weight of HLF is present at 80 kDa, and the purified target protein HLF is obtained.

[0095] Based on the purification results, the fermentation yields of OH7 and SH7 were calculated to be 1200 mg / L and 1210 mg / L, respectively.

[0096] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A method for constructing a recombinant yeast strain OH that solublely expresses recombinant human lactoferrin, characterized in that, The process includes the step of transforming the recombinant expression vector OST-pro-αf-pPICZαA-HLF into yeast host cells to prepare the recombinant yeast engineered strain OH; The method for constructing the recombinant expression vector OST-pro-αf-pPICZαA-HLF includes: cloning the HLF gene into the expression vector pPICZαA to obtain the recombinant expression vector pPICZαA-HLF; The gene encoding the α-factor signal peptide in the recombinant expression vector pPICZαA-HLF was replaced with the gene encoding OST-pro-αfactor to obtain the recombinant expression vector OST-pro-αf-pPICZαA-HLF; The nucleotide sequence of the HLF gene is shown in SEQ ID NO.1; The nucleotide sequence of the gene encoding the α-factor signal peptide is shown in SEQ ID NO.2; The nucleotide sequence of the gene encoding the OST-pro-α factor is shown in SEQ ID NO.7; The yeast host cell is Pichia pastoris X-33.

2. A recombinant yeast strain OH that expresses recombinant human lactoferrin in a soluble form, constructed according to the method described in claim 1.

3. The recombinant yeast engineered strain OH according to claim 2, characterized in that, The recombinant yeast strain OH is Pichia pastoris OH10, which was deposited on November 7, 2024, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 32533.

4. A method for constructing a recombinant yeast strain SH that solublely expresses recombinant human lactoferrin, characterized in that, The process includes the step of transforming the recombinant expression vector SUC-pro-αf-pPICZαA-HLF into yeast host cells to prepare the recombinant yeast engineered strain SH. The method for constructing the recombinant expression vector SUC-pro-αf-pPICZαA-HLF includes: cloning the HLF gene into the expression vector pPICZαA to obtain the recombinant expression vector pPICZαA-HLF; The gene encoding the α-factor signal peptide in the recombinant expression vector pPICZαA-HLF was replaced with the gene encoding SUC-pro-αfactor to obtain the recombinant expression vector SUC-pro-αf-pPICZαA-HLF; The nucleotide sequence of the HLF gene is shown in SEQ ID NO.1; The nucleotide sequence of the gene encoding the α-factor signal peptide is shown in SEQ ID NO.2; The nucleotide sequence of the gene encoding the SUC-pro-α factor is shown in SEQ ID NO. 8; The yeast host cell is Pichia pastoris X-33.

5. A recombinant yeast strain SH that expresses recombinant human lactoferrin in a soluble form, constructed according to the construction method of claim 4.

6. The use of the recombinant yeast strain OH as described in claim 2 or 3, or the recombinant yeast strain SH as described in claim 5, in the soluble expression of recombinant human lactoferrin.

7. A method for preparing recombinant human lactoferrin via soluble expression, characterized in that, The method includes the steps of fermenting and culturing the recombinant yeast engineered strain OH as described in claim 2 or 3 or the recombinant yeast engineered strain SH as described in claim 5 to obtain bacterial cells, lysing the bacterial cells and purifying them to obtain the recombinant human lactoferrin.

8. A recombinant human lactoferrin prepared according to the method of claim 7.

Citation Information

Patent Citations

  • Hetero-transglycosylase and uses thereof

    CN105612251A

  • Heterologous expression and antibacterial activity research of bovine lactoferrin in pichia pastoris

    CN116286418A