Method for predicting neoadjuvant therapy effect of esophageal cancer patient and postoperative stratification of patient

Abstract

The invention provides a method for detecting minimal residual focuses of esophageal squamous cell carcinoma patients in peripheral blood cfDNA through individualized customization of a panel to predict the pathological reaction of new adjuvant therapy and the curative effect of operative therapy, so that patients avoiding esophageal resection and patients needing further adjuvant therapy are screened out. Comprising the following steps: (1) collecting peripheral blood of a patient before neoadjuvant therapy, after neoadjuvant therapy and after an operation, extracting cfDNA, and performing library construction; (2) performing exon sequencing on tumor puncture tissues and white blood cells of the esophageal squamous carcinoma patient, selecting sites and designing primers according to tumor specific mutation, and designing an individualized customized panel; (3) performing targeted amplification on the library in the step (1) by utilizing the individualized customized panel in the step (2), and sequencing; and (4) carrying out bioinformatics analysis on a sequencing result in the step (3), then judging whether mutation is true or false, judging a tiny residual focus state of a sample, and calculating a ctDNA proportion of blood so as to predict a pathological reaction after new adjuvant therapy of the ESCC patient or an effect after operative therapy.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to a method for detecting neoadjuvant therapy effects and postoperative patient stratification in peripheral blood cfDNA of esophageal cancer patients using a customized panel. Background Art

[0002] Esophageal cancer is a common malignant tumor, ranking seventh in incidence and sixth in mortality among malignant tumors worldwide [1]. In my country, the incidence and mortality rates are ranked sixth and fourth, respectively. Neoadjuvant therapy (NAT) is a standard treatment for locally advanced esophageal cancer. In recent years, tumor immunotherapy represented by immune checkpoint inhibitors has made great progress, which has enabled a considerable number of esophageal squamous cell carcinoma (ESCC) patients to achieve pathologic complete response (pCR) after neoadjuvant therapy. pCR is closely associated with a significant increase in progression-free survival and overall survival [2-4]. In theory, patients who achieve pCR after neoadjuvant therapy can be exempted from esophagectomy because the cancer cells in the tumor lesions have been cleared, thereby maximizing the benefits for patients and improving their quality of life. However, paradoxically, the current clinical criteria for judging pCR still rely on the tumor tissue removed by radical esophagectomy. Although studies have reported that in other cancer types, a "follow-up and wait" strategy is adopted for patients based on whether they achieve clinical complete response (cCR) after neoadjuvant therapy; however, some cCR patients will relapse later, suggesting that the cCR index cannot accurately predict pCR[5]. Therefore, more accurate detection methods are urgently needed to predict whether patients achieve pCR after neoadjuvant therapy, so as to maximize the benefits for patients.

[0003] At present, some studies have explored methods to predict the pathological response to neoadjuvant therapy, such as based on immune signatures or intestinal flora, but the results are inferior to surgical diagnosis [6-13]. Minimal residual disease (MRD) detection has gradually emerged and matured in the field of solid tumors in recent years, mainly using circulating tumor DNA (ctDNA) as a detection marker [12, 14-16]. MRD can not only predict recurrence, but also monitor the efficacy. However, in general, the amount of ctDNA released by tumors into plasma is very low, so a highly sensitive detection method is required. Here, we developed an ultra-high sensitivity MRD detection method and applied it to a clinical trial of ESCC. The results showed that all MRD-negative patients were pathologically diagnosed as pCR, suggesting that this technology can replace traditional surgery to determine the pathological response of patients after neoadjuvant therapy in advance, thereby determining whether the patient needs to undergo surgical treatment. In addition, using this technology to detect postoperative blood can screen out patients who need further adjuvant treatment. Summary of the invention

[0004] The purpose of the present invention is to detect MRD in peripheral blood cfDNA of ESCC patients through personalized customized panels, so as to predict the pathological response of neoadjuvant therapy and the effect after surgical treatment, so as to screen out patients who can avoid esophagectomy and those who need further adjuvant treatment.

[0005] The present invention provides a method for predicting the pathological response of ESCC patients after neoadjuvant therapy and the effect of surgical treatment based on the detection of ctDNA MRD, comprising the following steps:

[0006] (1) Peripheral blood was collected from patients before neoadjuvant therapy, after completion of neoadjuvant therapy (before surgery), and after surgery, and plasma was separated and cfDNA was extracted;

[0007] (2) constructing a library for the cfDNA in (1);

[0008] The method of "library construction" is detailed in patent CN110669823A.

[0009] (3) design of ESCC patient-specific panels, including site selection and primer design;

[0010] The "Design of ESCC patient-specific panel" is described below.

[0011] (4) using (3) to perform targeted amplification of the library in (2) (including preparation of single-stranded templates and two rounds of nested PCR amplification), and sequencing;

[0012] The method of "targeted amplification" is detailed in patent CN110669823A.

[0013] (5) Perform bioinformatics analysis on the sequencing results of (4) to determine whether the mutation is true or false.

[0014] The “bioinformatics analysis” is as follows: tracing back the DNA molecular sequencing data with the same random tag sequence, the same DNA insert fragment length, and the same breakpoints at both ends of the DNA insert fragment to a molecular cluster, where the number of molecules in the cluster is required to be ≥2 and the consistency rate of molecular mutations in the cluster is required to be >80%.

[0015] The “determining whether a mutation is true or false” is described in detail below.

[0016] (6) Based on the analysis results of (5), the MRD status of the sample is determined, and the ctDNA ratio in the blood, i.e., the MRD value, is calculated to predict the pathological response of ESCC patients after neoadjuvant therapy or the effect of surgical treatment.

[0017] The “determination of the MRD status of the sample” is: when 2 or more mutations are detected positive in the patient's cfDNA sample, the sample is judged to be MRD positive; otherwise, it is MRD negative.

[0018] For details on the method of “calculating the proportion of ctDNA in blood”, please refer to the article

[17] .

[0019] The present invention protects a method for designing an ESCC patient-specific panel:

[0020] (1) Exome capture sequencing and exon mutation analysis were performed on tumor tissues and paired blood leukocytes from ESCC patients;

[0021] (2) For each patient's exon mutation list, after IGV verification, the final mutation list is determined. The driver genes and high-frequency mutation genes of the tumor are selected, and a total of n tumor-specific mutation sites are selected;

[0022] The n may specifically be 40.

[0023] (3) Design primers to detect n tumor-specific mutation sites. Use Oligo software and the UCSC website to design two pairs of primers upstream and downstream of the mutation site for nested amplification. For primer design principles, refer to patent CN115896238A. Finally, the primer combination for this patient (including primer set I, primer set II, primer set III and primer set IV, see patent CN115896238A for details) was formed.

[0024] The n may specifically be 40.

[0025] The above-mentioned specific panel design method can be used for any tumor patients, not limited to ESCC patients, and different primer combinations can be designed for different patients.

[0026] The present invention also protects the use of any of the above-mentioned primer combinations in the preparation of a kit for detecting tumor mutations in blood cfDNA samples.

[0027] In the above application, the tumor may be ESCC.

[0028] The present invention also protects a method for determining the authenticity of a mutation detected in a blood cfDNA sample:

[0029] The target patient's detection primer combination was used to perform the same targeted amplification experiment on the target patient sample and the library of 10 healthy person cfDNA, and the same sequencing and analysis were performed. The primer combination is primer set I, primer set II, primer set III and primer set IV designed according to the target patient's tumor tissue mutation (see patent CN115896238A for details). There are no tumor-specific mutations of the target patient in the cfDNA of healthy people, that is, there are no mutations in the same position and type as those of tumor patients. When the mutation type of the target patient's cfDNA at the corresponding design site is consistent with the mutation type of its tumor tissue, and the mutation frequency is greater than the frequency of the same type of mutation at the site of any healthy person cfDNA, and the number of molecular clusters supporting the mutation is at least greater than the number of molecular clusters of the same type of mutation at the site of any healthy person cfDNA, then the mutation is positive.

[0030] The present invention also protects a kit for detecting tumor-specific mutations in blood cfDNA samples, comprising the above-mentioned primer combination, reagents for DNA extraction, reagents for DNA library construction, reagents for library purification, reagents for library amplification and other materials for library construction.

[0031] The present invention also protects the use of the above-mentioned blood cfDNA detection kit, which can be at least one of the following uses:

[0032] 1) Predict the pathological response of ESCC patients after neoadjuvant therapy;

[0033] 2) stratify ESCC patients after neoadjuvant therapy to determine whether to undergo surgical treatment;

[0034] 3) To examine the efficacy of surgery in ESCC patients;

[0035] 4) To stratify ESCC patients after surgical treatment to determine whether adjuvant therapy should be adopted.

[0036] The present invention provides a method for detecting ctDNA levels, i.e., MRD, in plasma cfDNA of ESCC patients, so as to predict the pathological response of ESCC patients after neoadjuvant therapy or stratify patients after surgical treatment. This method has been verified in a clinical trial cohort of 38 patients, and the results showed that all MRD-negative samples after neoadjuvant therapy were pCR (i.e., negative predictive value 100%). At the same time, postoperative blood MRD analysis showed that postoperative MRD-negative patients did not progress regardless of whether they received adjuvant therapy, while postoperative MRD-positive patients significantly reduced disease progression after receiving adjuvant therapy. Therefore, postoperative MRD detection can screen out target patients who benefit from adjuvant therapy. In summary, the present invention has extremely high guiding value for the clinical treatment of ESCC patients and can maximize the benefits to patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 It is a flow chart of the present invention.

[0038] Figure 2 It is a comparison of ctDNA MRD values ​​in patients with different pathological responses after neoadjuvant therapy.

[0039] Figure 3 The Kaplan-Meier survival analysis was used to compare the survival differences between patients who received adjuvant therapy after surgery and those in the observation group. a. Comparison of the survival differences between patients who received adjuvant therapy and those in the observation group in patients who were MRD-positive after surgery; b. Comparison of the survival differences between patients who received adjuvant therapy and those in the observation group in patients who were MRD-negative after surgery; c. Comparison of the survival differences between patients who received adjuvant therapy and those in the observation group in all patients. DETAILED DESCRIPTION

[0040] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention.

[0041] The experimental methods in the following examples are all conventional methods unless otherwise specified.

[0042] Unless otherwise specified, the test materials used in the following examples are all conventional biochemical reagents.

[0043] The TE buffer in the following examples is a product of Sangon Biotech Co., Ltd., with a product catalog number of B541019-0100.

[0044] In the following examples, ESCC patients gave their informed consent to the contents of the present invention.

[0045] Example 1. Library construction of plasma cfDNA samples from ESCC patients

[0046] 1. Collection and separation of patient blood samples

[0047] Blood was drawn from patients at different time points, including before treatment, after neoadjuvant therapy / before surgery, and 1 month after surgery. The blood was collected in a DNA storage tube (Jiangsu Kangjian Medical Supplies Co., Ltd.), and then centrifuged twice at 4 degrees: first, centrifuged at 2500rpm for 10 minutes, the middle layer is the buffy coat; the supernatant was aspirated and centrifuged at 12,000rpm for 10 minutes to obtain plasma. The plasma and buffy coat were stored at -80°C until DNA extraction.

[0048] 2. Extraction of plasma cfDNA

[0049] Apostle MiniMax High Efficiency cfDNA Isolation Kit (A17622CN-250) was used to extract plasma cfDNA, and the operation was performed as follows according to the instructions.

[0050] (1) Open the metal bath and raise the temperature to 60°C. Take out the nanomagnetic beads in advance, mix thoroughly and equilibrate to room temperature.

[0051] (2) According to the total amount of plasma to be extracted, add the corresponding volume of proteinase K and sample lysate to a 15 ml centrifuge tube in sequence according to Table 1, mix evenly by inverting, and incubate at 60°C for 20 min. (Note: Avoid mixing the sample lysate directly with the proteinase K solution).

[0052] Table 1.

[0053]

[0054] (3) During the incubation period, resuspend and mix the magnetic beads that have been equilibrated to room temperature, then prepare the magnetic bead binding solution according to Table 2 and mix thoroughly.

[0055] Table 2.

[0056]

[0057] (4) After the incubation, place the centrifuge tube on ice for 5 min to equilibrate to room temperature.

[0058] (5) Add the prepared magnetic bead binding solution to the cooled plasma sample and mix by inverting it 10 times (avoid excessive shaking to prevent the generation of a large number of bubbles). Then place the 15 ml centrifuge tube in a four-dimensional rotating mixer and shake the centrifuge tube at medium to high speed for 20 minutes to promote the binding of cfDNA to the magnetic beads.

[0059] (6) Place the 15 ml centrifuge tube in a centrifuge and spin it off. TMPlace the tube on a -15 magnet magnetic stand for 20 min until the mixed liquid becomes clear and the magnetic beads aggregate on the tube wall. Use a pipette to aspirate the supernatant and discard it.

[0060] (7) Remove the 15 ml centrifuge tube from the magnetic stand, add 1 ml of cfDNA Wash solution, and vortex to resuspend the magnetic beads. Transfer the resuspended magnetic bead suspension to a new 1.5 ml low-adsorption centrifuge tube, and keep the 15 ml centrifuge tube used in this step (the centrifuge tube may have residual magnetic beads to be cleaned).

[0061] (8) Place the 1.5 ml low-adsorption tube on the magnetic rack and let it stand for 2 min. Pipette 1 ml of new cfDNA Wash solution into the 15 ml centrifuge tube reserved in step 7 to rinse the tube wall. Vortex to resuspend the magnetic beads.

[0062] (9) Place the 1.5 ml low-adsorption tube on the magnetic stand for 2 min until the liquid becomes clear, and discard the supernatant. Then transfer the rinse solution containing magnetic beads from the 15 ml centrifuge tube back to the 1.5 ml centrifuge tube, remove it from the magnetic stand, vortex for 30 s, and then spin it off.

[0063] (10) Place the 1.5 ml low-absorption tube on a magnetic rack for 2 min until the liquid becomes clear and discard the supernatant.

[0064] (11) Dilute the cfDNA 2nd Wash solution in advance with anhydrous ethanol at a volume ratio of 1:4. Each sample requires at least 2 ml of the prepared 2nd Wash solution (20% 2nd Wash solution, 80% anhydrous ethanol, 0.1% Tween-20).

[0065] (12) Add 1 ml of the prepared secondary wash working solution to a 1.5 ml low adsorption tube, then remove it from the magnetic rack, vortex for 30 seconds, and then spin it off.

[0066] (13) Place the 1.5 ml low-absorption tube on a magnetic rack for 2 min until the liquid becomes clear and discard the supernatant.

[0067] (14) Repeat steps 12-13 once, and then use a 10 μL pipette to remove the remaining liquid in the tube.

[0068] (15) Place the 1.5 ml low adsorption tube on the magnetic stand, open the tube cover, and leave for 3-5 minutes to ensure that the ethanol is completely evaporated. (Avoid excessive drying of the magnetic beads, so that the surface of the magnetic beads no longer reflects light.)

[0069] (16) Add 40 μL of cfDNA Elution Solution into a 1.5 ml centrifuge tube and vortex for 5 min to elute the free DNA from the nanomagnetic beads.

[0070] (17) Place the 1.5 ml low-adsorption tube on a magnetic rack for 2 minutes until the liquid becomes clear, and pipette the supernatant into a new 1.5 ml low-adsorption centrifuge tube. (Store at 4°C for short-term storage and -20°C for long-term storage)

[0071] (18) DNA quantification was performed using the Qubit dsDNA HS Assay Kit (INVITROGEN, Q32854), and fragment distribution quality control was performed using Agilent 2200 Genomic DNA Reagents.

[0072] 3. cfDNA library construction

[0073] NEB HHal enzyme (Cat. No. R0139L) and CutSmart Buffer (Cat. No. B7204S) were used for methylation digestion, and KAPA Hyper Prep Kit (Cat. No. KK8504) was used for library construction.

[0074] 1. Enzyme Digestion

[0075] Take 10-50 ng cfDNA and perform digestion with methylation-sensitive endonuclease on ice. Prepare the reaction system as shown in Table 3 and operate according to the reaction procedure shown in Table 4 to obtain the digestion product.

[0076] Reaction system: Table 3.

[0077] Element Volume (μL) cfDNA X DNase / RNase-Free Water 35-X Restriction Enzyme 10X Buffer 4 Restriction Enzyme 10u / μL 1 Total volume 40

[0078] Reaction procedure: Table 4.

[0079] temperature time 37℃ 30min 65℃ 20min 4℃ ∞

[0080] 2. cfDNA end repair and A addition

[0081] Take the enzyme digestion product of step 1, configure the reaction system according to Table 5, and operate according to the reaction procedure in Table 6.

[0082] Reaction system: Table 5.

[0083]

[0084]

[0085] Reaction procedure: Table 6.

[0086] temperature time 20℃ 30min 65℃ 30min 4℃ ∞

[0087] 3. Connect the connector

[0088] Take out the product of step 2 and configure the reaction system according to Table 7. The procedure is: 20°C, 4h, 4°C overnight.

[0089] Reaction system: Table 7.

[0090] Element Volume (μL) The unrefined product obtained in step 2 48 MC Adapter 1.5 DNase / RNase-Free Water 6.5 Ligation Enzyme 8 Ligation buffer 24 Total volume 88

[0091] After the reaction, the ligation product was purified by adding 105 μL XP magnetic beads (Hieff NGS DNA SelectionBeads, Yisheng Biotechnology, catalog number 12601ES75, the same below), vortexing, leaving at room temperature for 5 minutes, adsorbing on a magnetic rack until clear (about 5 minutes), washing twice with 80% ethanol (200 μL / time), and drying for 5 minutes. Elute with 30 μL water, leaving at room temperature for 10 minutes, adsorbing on a magnetic rack for 5 minutes, and then using a 10 μL dispenser to draw all the supernatant into a new 8-row array.

[0092] 4. Library Amplification

[0093] Take the product of step 3, configure the reaction system according to Table 8, and carry out the reaction procedure according to Table 9.

[0094] Reaction system: Table 8.

[0095] Element Volume (μL) The ligation product obtained in step 3 30 KAPA HIFI mix 35 Race pre_F(50μM) 2.5 Race pre_R(50μM) 2.5 Total volume 70

[0096] Reaction procedure: Table 9.

[0097]

[0098]

[0099] The primer information in Table 8 is as follows:

[0100] Race pre-F: GACACGACGCTCTTCCGAT(5'-3')(SEQ ID NO: 1);

[0101] Race pre-R: GTGGGCTCGGAGATGTGTATAA (5'-3') (SEQ ID NO: 2).

[0102] After the reaction, the amplified library was purified to obtain the whole genome library with MC connector, i.e., MC library: the purification steps were the same as the above step "purification of ligation product", after purification with 105 μL XP magnetic beads (1:1.5), the library was finally eluted with 150 μL Lotion Buffer and quantified by Qubit.

[0103] Example 2: Design of a tumor patient-specific panel

[0104] 1. Collection and extraction of tumor tissue and blood samples

[0105] Tumor tissue was obtained by ultrasound-guided puncture before treatment, and about 10 mL of blood was collected in the above-mentioned DNA storage tube. Genomic DNA was extracted from tumor tissue using the QIAGEN (QIAamp DNA Mini Kit, 51306) genomic DNA extraction kit. 200 μL of blood buffy coat (i.e., white blood cells) was taken and genomic DNA was extracted using the QIAGEN (QIAamp DNA Blood Kit) blood DNA extraction kit.

[0106] 2. Construction of sequencing libraries for tumor tissue and blood leukocyte samples

[0107] 250 ng of genomic DNA from tumor tissue and blood leukocytes were used to construct the library according to the following steps.

[0108] 1. Genomic DNA Ultrasonication

[0109] (1) Covarias ultrasonic shearing: 250 ng of gDNA was taken for ultrasonic shearing (when the volume of gDNA is small, the volume of TE buffer can be adjusted to make the shearing system 51 μL); covarias micro TUBEs (Covaris, 520077) were used for ultrasonic shearing.

[0110] Interruption system: Table 10.

[0111] Element Volume (μL) dsDNA (250ng) X TE buffer 51-X Total volume 51

[0112] (2) Mix the prepared 51 μL system and add it to the ultrasonic disruption tube. After centrifugation, place it into the ultrasonic disruption instrument.

[0113] Sonication conditions for different sample types: Table 11.

[0114]

[0115]

[0116] (3) After the ultrasound is completed, measure the Qubit and run at 2200 to confirm that the fragment size is 180-200bp. (Note: The ultrasound conditions can be adjusted according to the actual situation of the sample)

[0117] 2. Genomic DNA Library Construction

[0118] The library was constructed using the KAPA Hyper Prep Kit (Cat. No. KK8504) as follows.

[0119] 2.1 End repair

[0120] Prepare the following reaction system in a sterile PCR tube according to Table 12, and then perform the reaction procedure according to Table 13.

[0121] Reaction system: Table 12.

[0122] Element Volume (μL) Fragmented DNA 50 End Repair Buffer II 7 End Repair Enzymes 3 Total volume 60

[0123] Reaction procedure: Table 13.

[0124] temperature time 20℃ 30min 65℃ 30min 4℃ ∞

[0125] 2.2 Connector connection

[0126] The reaction system was prepared according to Table 14, and then the reaction was carried out at 20°C for 1 hour, or at 4°C overnight.

[0127] Reaction system: Table 14.

[0128] Element Volume (μL) The unrepaired product obtained in step X 60 Ligation Buffer 30 ddH2O 8.5 Ligation Enzymes II 10 MC Adapter 1.5 Total volume 110

[0129] After the reaction, perform post-ligation purification: follow the "ligation product purification" in cfDNA library construction and add 132 μL XP beads (1:1.2).

[0130] 2.3 Library amplification

[0131] Take the product of step 3, configure the reaction system according to Table 15, and carry out the reaction procedure according to Table 16.

[0132] Reaction system: Table 15.

[0133] Element Volume (μL) The ligation product obtained in step 3 30 KAPA HIFI mix 35 Race pre_F(50μM) 2.5 Race pre_R(50μM) 2.5 Total volume 70

[0134] Reaction procedure: Table 16.

[0135]

[0136] Purification after MC library amplification: Follow the "ligation product purification" in cfDNA library construction, add 90μL XPbeads, and finally elute with 100μL Elotion Buffer.

[0137] 3. Exon hybridization capture

[0138] Exon hybridization capture was performed using the Agilent SureSelect Human All Exon V6 probe and hybridization capture kit.

[0139] (1) Take the required hybridization library (600 ng, concentrate or add enzyme-free water to 10 μL).

[0140] (2) Prepare Hybridization QXT Blocking Mix on ice according to the system in Table 17.

[0141] Reaction system: Table 17.

[0142] Element Volume (μL) Human Cot-1 DNA (HCD) 5 MC F Blockers (1000μM) 1 MC R Blockers (1000μM) 1 Total volume 7

[0143] (3) Add the DNA library to 7 μL of QXT Blocking Mix, pipette up and down 8-10 times, then cap the tube tightly, vortex at high speed for 5 seconds, centrifuge briefly to collect the liquid on the tube wall to the bottom of the tube, and place the tube in a PCR instrument for reaction according to Table 18.

[0144] Reaction procedure: Table 18.

[0145]

[0146] (4) Prepare capture library hybridization mix according to Table 19.

[0147] Reaction system: Table 19.

[0148] Element Volume (μL) RNase Block 0.5 water 1.5 Capture probe 5 QXT Fast Hybridization Buffer 6 Total volume 13

[0149] (5) When the PCR reaction reaches the third step (1 min at 65°C), add 13 μL of Capture Library Hybridization Mix to the library mixture, pipette up and down 8-10 times to mix, and continue the reaction.

[0150] (6) Elution of hybridization captured library

[0151] a) Preheat Wash Buffer 2 at 65°C in a water bath or heating block, 600 μL per sample

[0152] b) Dynabeads MyOne Streptavidin T1 magnetic beads (life, cat. no. 65602, same below) were rotated at room temperature for 30 min

[0153] c) For each hybridization reaction, transfer 50 μL of Dynabeads MyOne Streptavidin T1 magnetic beads into a 1.5 ml centrifuge tube.

[0154] d) Add 200 μL Binding Buffer to each 50 μL Dynabeads MyOne Streptavidin T1 magnetic beads and vortex for 5 seconds.

[0155] Centrifuge briefly, place the tube on a magnetic rack, and remove the supernatant after the solution becomes clear (2 min);

[0156] e) Repeat step 4 twice, rinsing 3 times in total.

[0157] f) Resuspend Dynabeads MyOne Streptavidin T1 magnetic beads in 200 μL Binding Buffer.

[0158] g) Aliquot Dynabeads MyOne Streptavidin T1 magnetic beads into new 8-tube strips, 200 μL per tube.

[0159] h) Place the reacted sample at room temperature for about 2-3 minutes. After the hybridization mixture is cooled to room temperature (the liquid becomes clear), add the hybridization mixture directly to the Dynabeads MyOne Streptavidin T1 magnetic bead solution and mix by inversion (vortex) 3-5 times (seal with sealing film).

[0160] i) Place the mixture on a vortex mixer at 1800 rpm for about 30 minutes at room temperature.

[0161] j) Centrifuge briefly, place the tube on a magnetic rack, let stand until the solution is clear, and remove the supernatant.

[0162] k) Add 200 μL Wash Buffer 1, vortex for 5 seconds to resuspend the beads, and let stand at room temperature for 10 minutes.

[0163] l) Centrifuge briefly, place the tube on a magnetic rack, let stand until the solution becomes clear (2 min), and remove the supernatant.

[0164] m) Add 180 μL of Wash Buffer 2 preheated at 65°C, vortex for 5 seconds to resuspend the beads, and incubate at 65°C in a water bath or heating block for 10 minutes.

[0165] n) Briefly centrifuge, place the tube on a magnetic rack, let stand until the solution is clear, and remove the supernatant.

[0166] o) Repeat steps 12-14 twice, for a total of 3 rinses.

[0167] p) Add 40 μL nuclease-free water and vortex for 5 s to resuspend the beads.

[0168] 4. PCR amplification and enrichment of target fragments

[0169] Prepare the PCR amplification reaction system in a 0.2 ml centrifuge tube according to Table 20.

[0170] Reaction system: Table 20.

[0171] Element Volume (μL) KAPA HiFi HotStart Ready Mix(2X) 50 Primer Mix (Sequencing P5+P7 primers (10μM)) 10 Library Template 40 Total volume 100

[0172] Run the reaction system on the PCR instrument according to Table 21:

[0173] Reaction procedure: Table 21.

[0174]

[0175] After the reaction, the library was purified according to the "ligation product purification" in the cfDNA library construction. The amplified targeted capture DNA library was purified with 100 μL XP magnetic beads, and the DNA concentration was measured after elution with 31 μL Elution Buffer. The obtained captured library was sequenced on the Illumina HiSeqX platform or stored at -20°C.

[0176] 3. Analysis of exome sequencing results of tumor tissues.

[0177] By pairing and analyzing the exome sequencing results of the tumor tissue and the patient's blood leukocytes, the patient's tumor mutation results are obtained (taking the exome sequencing results of a certain patient as an example).

[0178] Table 22. Exon mutation detection results of a patient's tumor tissue (reference sequence is based on hg19)

[0179]

[0180]

[0181] 4. Selecting Patients’ Tumor-Specific Testing Sites

[0182] The tumor driver genes (Table 23) and high-frequency mutation genes were found in the patient's mutation list, and 40 mutation sites were selected (Table 24).

[0183] Table 23. List of tumor driver genes

[0184]

[0185]

[0186] Table 24. Mutation sites included in the target patient-specific panel

[0187]

[0188]

[0189] 5. Primer design for mutation detection sites

[0190] For the 40 selected mutation detection sites of the target patient, two pairs of primers were designed upstream and downstream of the site for nested amplification using Oligo software and the UCSC website. The primer design principles refer to patent CN115896238A. The primer combination for the patient was finally formed (including primer set I, primer set II, primer set III and primer set IV, see patent CN115896238A for details). The primer sequence information for the tumor-specific site amplification of the target patient is shown in Table 25.

[0191] Table 25. Primer sequences for target sites of target patient detection

[0192]

[0193]

[0194]

[0195]

[0196]

[0197] The underlined part in the table is the part where the second-round forward amplification primer GASP2A and the second-round reverse amplification primer GASP2B bind to the Index primer (5'CTFGGCACCCGAG3').

[0198] Example 3. Targeted amplification of plasma cfDNA library and construction of sequencing library

[0199] For detailed information on this targeted amplification technology, see patent CN110669823A.

[0200] 1. Preparation of single-stranded library

[0201] 1. Take 400 ng of the MC library purified in "4. Library amplification" of "III. cfDNA library construction" in "Example 1. Library construction of plasma ctDNA samples of ESCC patients", add water to make the volume to 20 μL, configure the reaction system according to Table 26, and perform the reaction procedure according to Table 27.

[0202] Reaction system: Table 26.

[0203] Element Volume (μL) kapa HIFI 25 BS2355 1 water 4 MC Library 20 Total volume 50

[0204] Reaction procedure: Table 27.

[0205]

[0206]

[0207] The BS2355 primer information in Table 26 is as follows:

[0208] BS2355 upstream primer: GACACGACGCTTCTCGAT (5'-3') (SEQ ID NO: 147);

[0209] BS2355 downstream primer: GTGGGCTCGGAGATGTGTATAA (5'-3') (SEQ ID NO: 148).

[0210] 2. Myone T1 magnetic beads at room temperature for 30 minutes, take 50μL magnetic beads, wash 3 times with 100μL 2*BWB (magnetic stand adsorption for 2 minutes to clarify

[0211] Then resuspend in 50 μL of 2*BWB.

[0212] 3. Add 50 μL of amplified product to 50 μL of T1 magnetic bead resuspension solution and shake at 43°C, 1500 rpm for 30 minutes.

[0213] 4. Adsorb on the magnetic stand for 2 minutes, discard the supernatant, add 80μL wash buffer to wash once, shake and centrifuge at room temperature for 10 minutes, adsorb on the magnetic stand for 2 minutes, and discard the supernatant.

[0214] 5. Add 80 μL 0.2 M NaOH (0.1% Tween-H2O), mix well, denature at room temperature for 8 min, place on the magnetic stand for 2 min, and discard the supernatant.

[0215] 6. Add 80 μL wash buffer, mix well, incubate at room temperature for 2 minutes, incubate on a magnetic stand for 2 minutes, and discard the supernatant.

[0216] 7. Resuspend the magnetic beads in 20 μL of water.

[0217] 2. Targeted amplification with tumor-specific primers and sequencing library construction

[0218] The primer pool designed in the "Design of Tumor Patient-Specific Panel" is used in combination with fixed primers to perform two rounds of specific PCR amplification on the cfDNA library, and the amplified product is the sequencing library.

[0219] 1. First round of specific amplification

[0220] Take 10 μL of resuspended magnetic beads for the template of GSP1A, and another 10 μL of magnetic beads for the template of GSP1B. Prepare the reaction system according to Table 28, and perform the reaction procedure according to Table 29.

[0221] Amplification system: Table 28.

[0222] Element Volume (μL) Life super 15 Primer 1355 3 GSP1A mix / GSP1B mix 2 template 10 Total volume 30

[0223] Reaction procedure: Table 29.

[0224]

[0225] Among them, the primer information in Table 28 is as follows:

[0226] Primer 1355: 5'-TCTTTCCCTACACGACGCTCTTCCGAT-3' (SEQ ID NO: 149).

[0227] Purification of amplified products of GSP1A and GSP1B: 54 μL XP magnetic beads were added at a ratio of 1:1.8 for purification, and 25 μL water was added for elution.

[0228] 2. Second round of specific amplification

[0229] Take 10 μL of GSP1 product as the template for GSP2, configure the reaction system as shown in Table 30, and operate according to the reaction procedure in Table 31.

[0230] Note: Primers and templates strictly correspond, that is, GSP1A corresponds to GSP2A, and GSP1B corresponds to GSP2B.

[0231] Reaction system: Table 30.

[0232] Element Volume (μL) Life super 15 GSP2A mix / GSP2B mix 1 Primer RSD (10 μM) 4 template 10 Total volume 30

[0233] Reaction system: Table 31.

[0234]

[0235] The RSD primer information in Table 30 is as follows: the same as the Index primer in patent CN110669823B.

[0236] The amplified products of GSP2A and GSP2B were combined, purified with XP magnetic beads at a ratio of 1:1.5, eluted with 50 μL EB, and the DNA concentration was determined to obtain a sequencing library that can be sequenced on the Illumina NOVAseq platform.

[0237] Example 4. Analysis of cfDNA library targeted amplification sequencing results and calculation of ctDNA MRD value

[0238] Based on the cfDNA sequencing data obtained in "Example 3", the mutation results of the targeted sites were obtained through bioinformatics analysis (Table 32).

[0239] Table 32. List of partial mutation results of cfDNA of target patients

[0240]

[0241] The cfDNA library of "10 healthy people" in Table 32 amplified the specific primer combination of the "target patient" and performed the same data analysis process as the basis for the authenticity of the cfDNA mutation of the "target patient" and whether it was included in the subsequent analysis. The primer combination is designed based on the tumor tissue mutation of the target patient. The tumor-specific mutation of the target patient does not exist in the healthy cfDNA, that is, there is no mutation of the same position and type. When the mutation type of the target patient's cfDNA at the corresponding designed site is consistent with the mutation type of its tumor tissue, and the mutation frequency is greater than the frequency of the same type of mutation of any healthy person's cfDNA at this site, and the number of molecular clusters supporting the mutation is at least greater than the number of molecular clusters of the same type of mutation of any healthy person's cffDNA at this site, the mutation is judged to be positive. Otherwise, the mutation is judged to be negative.

[0242] When two or more mutations in the patient's cfDNA sample are detected as positive (i.e., the mutation is judged to be true), the sample is judged to be MRD-positive; otherwise, it is MRD-negative. Based on the frequency and depth of the target mutations detected in the target patient's cfDNA and the frequency of these mutations in the tumor tissue, the ctDNA ratio is calculated using the maximum likelihood method, and then calibrated using the maximum mutation frequency in the tumor tissue to obtain the final MRD value. The ctDNA MRD value of MRD-negative patients is 0, and the ctDNA MRD value of MRD-positive patients is greater than 0. For details on the algorithm, please refer to reference

[17] .

[0243] Example 5. Blood MRD levels after neoadjuvant therapy can predict the patient's pathological response to neoadjuvant therapy

[0244] We collected samples from 38 ESCC patients, including tumor tissues (obtained by puncture) before treatment and blood at multiple time points (n=38 before treatment, n=38 after neoadjuvant therapy / before surgery, and n=33 after surgery). The library of blood cfDNA samples was constructed according to the steps of Example 1, and then the tumor-specific panel was designed according to Example 2. Then, targeted amplification of tumor-specific primers and sequencing library construction were performed according to Example 3. Finally, the analysis of the targeted amplification sequencing results of the cfDNA library and the calculation of the MRD value were performed according to Example 4, so as to evaluate the clinical significance of the MRD level of blood cfDNA for patients ( Figure 1 The sampling information and MRD levels of these 38 patients are shown in Table 33.

[0245] Table 33. Sampling information and ctDNA MRD values ​​of 38 patients

[0246]

[0247]

[0248]

[0249]

[0250] Among them, all 38 patients were tested for blood MRD levels after neoadjuvant therapy. 10 patients were MRD negative, and the pathological diagnosis of these patients showed pathological complete remission; 28 patients were MRD positive, except for 1 case of pathological complete remission, 27 cases had major pathological remission or non-major pathological remission (Table 34). Among them, pathological complete remission refers to no residual tumor cells, major pathological remission refers to less than 10% of tumor cells remaining, and non-major pathological remission refers to more than 10% of tumor cells remaining. Therefore, the sensitivity of blood MRD status in predicting pathological response after neoadjuvant therapy is 100%, specificity is 91%, positive predictive value is 96%, and negative predictive value is 100% (that is, when the test is MRD negative, it can be determined that the patient is in pathological complete remission). In addition, the level of blood MRD is positively correlated with the level of pathological response, that is, pathological complete remission < major pathological remission < non-major pathological remission (MRD median values ​​are: 0%, 0.01%, and 0.021%, respectively), see Figure 2 In summary, blood MRD levels after neoadjuvant therapy can predict patients' pathological response to neoadjuvant therapy, especially for identifying pathological complete remission.

[0251] Table 34. Correlation between patient pathological response and plasma MRD after neoadjuvant therapy

[0252]

[0253]

[0254] Example 6: Postoperative blood MRD detection can screen patients who benefit from adjuvant therapy

[0255] The 33 patients also had their blood MRD levels tested after surgery, with 11 cases being MRD-positive and 22 cases being MRD-negative. Of the MRD-positive patients, 7 received adjuvant therapy and no disease progression was found during follow-up; the other 4 patients did not receive adjuvant therapy, and 3 of them had disease progression (P=0.007, Figure 3 a). It is worth noting that among the 22 MRD-negative patients, 5 received adjuvant therapy and 17 did not; regardless of whether they received adjuvant therapy, no disease progression occurred during the follow-up period ( Figure 3b). If the patients were not grouped according to their postoperative MRD levels, adjuvant therapy had no discriminatory effect on progression-free survival among all patients ( Figure 3 c). Therefore, the postoperative MRD level can screen the population that will benefit from adjuvant therapy. Only patients with postoperative MRD-positive patients are likely to benefit from adjuvant therapy, while patients with postoperative MRD-negative patients do not need adjuvant therapy because adjuvant therapy has no effect on the prognosis of these patients.

[0256] The present invention provides a method for detecting plasma MRD based on NGS and customized panels, which has ultra-high sensitivity. By detecting peripheral blood cfDNA of ESCC patients at different treatment time points, the following purposes can be achieved:

[0257] 1. Blood MRD detection after neoadjuvant therapy can predict the effect of neoadjuvant therapy, with a positive predictive value of 96% and a negative predictive value of 100%. Therefore, the present invention is expected to predict the pathological response of neoadjuvant therapy before the patient undergoes surgery, laying the foundation for the development of future clinical trials.

[0258] 2. Blood MRD testing before adjuvant therapy after surgery can screen out people who will benefit from adjuvant therapy. Only MRD-positive patients need to receive further adjuvant therapy.

[0259] Therefore, the present invention has extremely high guiding value for the clinical treatment of ESCC patients and can maximize the benefits to patients.

[0260] References:

[0261] 1.Sung, H., et al., Global Cancer Statistics 2020: GLOBOCAN Estimates ofIncidence and Mortality Wordwide for 36 Cancers in 185 Countries.CA Cancer JClin, 2021.71(3): p.209-249.

[0262] 2.Samson, P., et al., Neoadjuvant Chemotherapy versus Chemoradiation Prior to Esophagectomy: Impact on Rate of Complete Pathologic Response andSurvival in Esophageal Cancer Patients. J Thorac Oncol, 2016.11(12): p.2227-2237.

[0263] 3.Yamasaki,M.,et al.,MμLticenter randomized phase II study ofcisplatin and fluorouracil plus docetaxel(DCF)compared with cisplatin andfluorouracil plus Adriamycin(ACF)as preoperative chemotherapy for resectableesophageal squamous cell carcinoma(OGSG1003).Ann Oncol,2017.28(1):p.116-120.

[0264] 4.Yang,W.,et al.,Neoadjuvant programmed cell death 1 blockadecombined with chemotherapy for resectable esophageal squamous cellcarcinoma.J Immunother Cancer,2022.10(1).

[0265] 5.Smith,J.J.,et al.,Assessment of a Watch-and-Wait Strategy forRectal Cancer in Patients With a Complete Response After NeoadjuvantTherapy.JAMA Oncol,2019.5(4):p.e185896.

[0266] 6.Davey,M.G.,et al.,Evaluating the Role of CircμLating MicroRNAs toAid Therapeutic Decision Making for Neoadjuvant Chemotherapy in BreastCancer:A Prospective,MμLticenter Clinical Trial.Ann Surg,2022.276(5):p.905-912.

[0267] 7.Khakoo,S.,et al.,MRI Tumor Regression Grade and CircμLating TumorDNA as Complementary Tools to Assess Response and Guide Therapy Adaptation inRectal Cancer.Clin Cancer Res,2020.26(1):p.183-192.

[0268] 8.Wang,Y.,et al.,Utility of ctDNA in predicting response toneoadjuvant chemoradiotherapy and prognosis assessment in locally advancedrectal cancer:A prospective cohort study.PLoS Med,2021.18(8):p.e1003741.

[0269] 9.Yi,Y.,et al.,Gut Microbiome Components Predict Response toNeoadjuvant Chemoradiotherapy in Patients with Locally Advanced RectalCancer:A Prospective,Longitudinal Study.Clin Cancer Res,2021.27(5):p.1329-1340.

[0270] 10.Zhang,C.,et al.,An individualized immune signature of pretreatmentbiopsies predicts pathological complete response to neoadjuvantchemoradiotherapy and outcomes in patients with esophageal squamous cellcarcinoma.Signal Transduct Target Ther,2020.5(1):p.182.

[0271] 11.Zhou,J.,et al.,Serial CircμLating Tumor DNA in Predicting andMonitoring the Effect of Neoadjuvant Chemoradiotherapy in Patients withRectal Cancer:A Prospective MμLticenter Study.Clin Cancer Res,2021.27(1):p.301-310.

[0272] 12.Magbanua,M.J.M.,et al.,CircμLating tumor DNA in neoadjuvant-treated breast cancer reflects response and survival.Ann Oncol,2021.32(2):p.229-239.

[0273] 13.McDonald,B.R.,et al.,Personalized circμLating tumor DNA analysisto detect residual disease after neoadjuvant therapy in breast cancer.SciTransl Med,2019.11(504).

[0274] 14.Ococks,E.,et al.,Serial CircμLating Tumor DNA Detection Using aPersonalized,Tumor-Informed Assay in Esophageal Adenocarcinoma PatientsFolowing Resection.Gastroenterology,2021.161(5):p.1705-1708e2.

[0275] 15.Bratman,S.V.,et al.,Personalized circμLating tumor DNA analysis asa predictive biomarker in solid tumor patients treated withpembrolizumab.Nature Cancer,2020.1(9):p.873-881.

[0276] 16.Tie,J.,et al.,CircμLating Tumor DNA Analyses as Mcrkers ofRecurrence Risk and Benefit of Adjuvant Therapy for Stage III ColonCancer.JAMA Oncol,2019.5(12):p.1710-1717.

[0277] 17.ZZhao,D.,et al.,Personalized analysis of minimal residual cancercells in peritoneal lavage fluid predicts peritoneal dissemination of gastriccancerJournal of Hematology&Oncology,2021.14(1):p.164。

Claims

1. A method for predicting the pathological response after neoadjuvant therapy and the efficacy after surgical treatment of patients with esophageal squamous cell carcinoma (ESCC) based on the detection of circulating tumor DNA (ctDNA) minimal residual disease (MRD), comprising the following steps: (1) Collect peripheral blood from patients, separate plasma, and extract cfDNA; (2) constructing a library for the cfDNA in (1); (3) design of ESCC patient-specific panels, including site selection and primer design; (4) using (3) to perform targeted amplification of the library in (2) (including preparation of single-stranded templates and two rounds of nested PCR amplification), and sequencing; (5) Perform bioinformatics analysis on the sequencing results of (4) and then determine whether the mutation is true or false; (6) Based on the analysis results of (5), the MRD status of the sample is determined, and the ctDNA ratio in the blood, i.e., the MRD value, is calculated to predict the pathological response of ESCC patients after neoadjuvant therapy or the effect of surgical treatment.

2. A method for designing ESCC patient-specific panels. (1) Exome capture sequencing and exon mutation analysis were performed on tumor tissues and paired blood leukocytes from ESCC patients; (2) Select the driver genes and high-frequency mutation genes of the tumor, and select a total of n tumor-specific mutation sites; The n may specifically be 40. (3) Designing primers for detecting n tumor-specific mutation sites, and finally forming the primer combination for the patient (including primer set I, primer set II, primer set III and primer set IV); The n may specifically be 40. The above-mentioned specific panel design method can be used for any tumor patients, not limited to ESCC patients, and different primer combinations can be designed for different patients.

3. A method for determining the authenticity of mutations detected in blood cfDNA samples. The target patient's detection primer combination was used to perform the same targeted amplification experiment on the target patient sample and the library of 10 healthy person cfDNA, and the same sequencing and analysis were performed. The primer combination is primer set I, primer set II, primer set III and primer set IV designed according to the target patient's tumor tissue mutation. There are no tumor-specific mutations of the target patient in the cfDNA of healthy people, that is, there are no mutations in the same position and type as those of tumor patients. When the mutation type of the target patient's cfDNA at the corresponding designed site is consistent with the mutation type of its tumor tissue, and the mutation frequency is greater than the frequency of the same type of mutation of any healthy person cfDNA at this site, and the number of molecular clusters supporting the mutation is at least greater than the number of molecular clusters of the same type of mutation of any healthy person cfDNA at this site, the mutation is positive.

4. A kit for detecting tumor-specific mutations in blood cfDNA samples, comprising a primer combination, reagents for DNA extraction, reagents for DNA library construction, reagents for library purification, reagents for library amplification, and other materials for library construction. The application of the kit in 5.4 may be at least one of the following uses: (1) Predict the pathological response of ESCC patients after neoadjuvant therapy; (2) stratify ESCC patients after neoadjuvant therapy to determine whether to undergo surgical treatment; (3) To examine the efficacy of surgery in ESCC patients; (4) Stratify ESCC patients after surgical treatment to determine whether adjuvant therapy should be taken.

Images