Gene combination for tumor DNA methylation detection and application thereof

Abstract

The invention discloses a gene combination for tumor DNA methylation detection and application of the gene combination. The gene combination comprises genes RNF135, SEPTIN9, SGIP1, SHOX2, TSHR, Twist, VIM, RASSF1A, DBNL and EMX1. The invention further discloses a kit for tumor DNA methylation detection and application of the kit. According to the invention, the identification of the tissue source of the tumor is facilitated, and after the tumor sample is obtained, the tissue source and the cancer type of the tumor sample can be objectively and accurately distinguished through the detection and conjoint analysis of the methylation level of the gene, so that the targeted treatment can be carried out on the patient.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology, and in particular relates to a gene combination for detecting tumor DNA methylation and an application thereof. Background Art

[0002] Cancer is a major public health problem in my country. According to the "China Cancer Incidence and Mortality in 2022" released by the National Cancer Center, there are an estimated 4.8247 million new cancer cases and 2.5742 million new cancer deaths in my country in 2022, which seriously affects the life, health and safety of the Chinese people. At present, the diagnosis of cancer mainly relies on pathological examination, including cell morphology examination and immunohistochemical analysis. This type of examination has become the "gold standard" for cancer diagnosis due to its low cost and high specificity. However, in actual clinical applications, traditional pathological examinations still have disadvantages including long examination time and low sensitivity, which directly leads to the inability of clinicians to quickly and accurately judge the patient's condition. Especially for metastatic cancer, it is difficult for some patients with metastatic cancer to find the primary lesion (ie, tumor with unknown primary lesion), which also increases the difficulty for doctors to make clinical decisions.

[0003] Carcinoma of unknown primary (CUP) refers to a metastatic lesion that is diagnosed as a malignant tumor by pathological examination, but it is still difficult to determine the metastatic tumor at the primary site anatomically after comprehensive examinations such as clinical, imaging, pathological, and laboratory indicators. CUP usually manifests as widespread metastasis throughout the body, with highly invasive biological characteristics and clinical behavior, often with lymph node or non-lymph node masses as the first clinical manifestation, and has the characteristics of early dissemination, invasive growth, and unpredictable metastatic pattern. Due to its complex pathogenesis and pathological process, it is different from common primary tumors, and its tumor heterogeneity is high. Most patients lack effective treatment methods due to unclear diagnosis, resulting in poor prognosis. The clinical treatment of CUP patients is mainly based on traditional chemotherapy, but empirical chemotherapy is not effective, lacks specificity, and cannot significantly improve the survival prognosis of patients. Therefore, early and efficient diagnosis of CUP and targeted treatment of patients based on this are of great significance for providing high survival prognosis for patients.

[0004] Tumor examinations are mainly divided into imaging examinations, serological tumor marker examinations, endoscopic examinations, and pathological examinations. Among them, pathological examinations based on tissue biopsy are the "gold standard" for tumor diagnosis, but this method still has many inconveniences when used in clinical practice.

[0005] Although immunohistochemical analysis can usually narrow the scope of diagnosis or distinguish some tissue types, this requires the combination of information such as the range of primary sites, sensitivity and specificity. Especially in the case of CUP with a wide range of possible primary sites, the lack of reference conditions greatly reduces the accuracy of immunohistochemical analysis. A recent meta-analysis showed that if the pathologist is unaware of the primary site and clinical data, the proportion of immunohistochemical analysis that can accurately identify the primary site of metastatic cancer is only 66%, and among patients who initially present with CUP, only 30% of patients can eventually determine the primary site. Another study showed that immunohistochemical analysis combined with a comprehensive analysis of histology, imaging and clinical manifestations ultimately made an accurate diagnosis for only 36% of patients, and about half of the patients did not receive an accurate diagnosis, which may be one of several primary cancers. In addition, there is currently a serious shortage of pathologists in my country, and it is difficult to fully meet the needs of pathological diagnosis with the resources of large public hospitals alone. Therefore, a low-cost, accurate, and clinical decision-making technology that does not require experienced doctors is needed to assist or even replace pathological examinations.

[0006] In recent years, with the rapid development of molecular biology technology, tumor diagnostic technology based on molecular detection technology has made great progress, including gene expression spectrum analysis, gene mutation spectrum analysis, DNA methylation analysis, etc. Among them, DNA methylation is one of the earliest discovered by humans and is also one of the most deeply studied epigenetic phenomena. Epigenetics refers to the regulation of gene expression without changing the original sequence of the gene, so that the gene undergoes heritable changes and ultimately leads to changes in the phenotype of the individual (cell). According to the literature that has been reported, some abnormally methylated tumor suppressor genes are not the same between different cancers, that is, specific cancers will specifically methylate one or some tumor suppressor genes. Therefore, increased methylation levels of different genes may point to different primary cancers. Summary of the invention

[0007] In order to address the deficiencies of the prior art, the purpose of the present invention is to propose a gene combination for tumor DNA methylation detection, establish a tumor classification prediction model, be able to identify tumors of different origins, and help doctors make clinical decisions; provide a kit for tumor DNA methylation detection and its use.

[0008] In order to achieve the above object, the present invention adopts the following technical solution:

[0009] A gene panel for tumor DNA methylation detection, comprising genes RNF135, SEPTIN9, SGIP1, SHOX2, TSHR, Twist, VIM, RASSF1A, DBNL and EMX1.

[0010] The aforementioned tumors include lung cancer, liver cancer, gastric cancer, colorectal cancer, kidney cancer, prostate cancer, pancreatic cancer, cervical cancer, breast cancer, urothelial carcinoma and metastatic cancer of unknown primary lesion.

[0011] The present invention establishes a gene marker combination model by combining gene detection, marker combination and data mining algorithm, and uses a multi-gene prediction model to determine the primary site of unknown primary metastatic cancer, which mainly includes the following steps:

[0012] (1) Collect clinical diagnosis data and gene methylation data of tumor samples and build a human cancer gene methylation database;

[0013] (2) Statistical analysis of DNA methylation levels was performed to screen out 10 genes closely related to the origin of tumor tissues, namely RNF135, SEPTIN9, SGIP1, SHOX2, TSHR, Twist, VIM, RASSF1A, DBNL, and EMX1;

[0014] (3) Calculate the above 10 DNA methylation levels, evaluate the tissue origin through the tumor classification prediction model, and determine the tissue origin and tumor type.

[0015] The present invention provides a detection method for tumor molecular typing, comprising the following steps:

[0016] (1) contacting a biological sample obtained from a tumor patient with a biomarker, wherein the biomarker includes the above 10 genes; the biological sample is an ex vivo tumor tissue obtained from the subject, and may be a fresh sample or a formalin-fixed paraffin-embedded (FFPE) sample;

[0017] On this basis, tumor classification is further carried out:

[0018] (2) Detect the methylation levels of 10 genes in the biological sample, and determine the tumor type of the biological sample based on the methylation levels of the 10 genes. Determine the tissue origin and tumor type by comparing with the cancer gene DNA methylation database. The test includes preparing bisulfite-treated genomic DNA from the sample, and the bisulfite-treated genomic DNA is used for polymerase chain reaction (PCR), which can be detected by real-time fluorescent quantitative polymerase chain reaction.

[0019] The application of the above gene combination in the preparation of a kit for detecting tumor DNA methylation.

[0020] Preferably, the aforementioned kit comprises a biomarker, and the biomarker is selected from any one or more of the genes described in claim 1.

[0021] Preferably, the aforementioned biomarker is a nucleic acid, an oligonucleic acid chain or a PCR primer set.

[0022] Preferably, the aforementioned PCR primer set comprises:

[0023] RNF135 gene: the forward primer is shown in SEQ ID NO.1, the reverse primer is shown in SEQ ID NO.2, and the probe is shown in SEQ ID NO.3;

[0024] SEPTIN9 gene: the forward primer is shown in SEQ ID NO.4, the reverse primer is shown in SEQ ID NO.5, and the probe is shown in SEQ ID NO.6;

[0025] SGIP1 gene: the forward primer is shown in SEQ ID NO.7, the reverse primer is shown in SEQ ID NO.8, and the probe is shown in SEQ ID NO.9;

[0026] SHOX2 gene: the forward primer is shown in SEQ ID NO.10, the reverse primer is shown in SEQ ID NO.11, and the probe is shown in SEQ ID NO.12;

[0027] TSHR gene: the forward primer is shown in SEQ ID NO.13, the reverse primer is shown in SEQ ID NO.14, and the probe is shown in SEQ ID NO.15;

[0028] Twist gene: the forward primer is shown in SEQ ID NO.16, the reverse primer is shown in SEQ ID NO.17, and the probe is shown in SEQ ID NO.18;

[0029] VIM gene: the forward primer is shown in SEQ ID NO.19, the reverse primer is shown in SEQ ID NO.20, and the probe is shown in SEQ ID NO.21;

[0030] RASSF1A gene: the forward primer is shown in SEQ ID NO.22, the reverse primer is shown in SEQ ID NO.23, and the probe is shown in SEQ ID NO.24;

[0031] DBNL gene: the forward primer is shown in SEQ ID NO.25, the reverse primer is shown in SEQ ID NO.26, and the probe is shown in SEQ ID NO.27;

[0032] EMX1 gene: the forward primer is shown as SEQ ID NO.28, the reverse primer is shown as SEQ ID NO.29, and the probe is shown as SEQ ID NO.30.

[0033] The method for using the above kit comprises the following steps:

[0034] (1) contacting a biological sample containing tumor tissue with a biomarker;

[0035] (2) Determining the DNA methylation level of the marker in the biological sample, and determining the tumor origin of the biological sample based on the DNA methylation level of different markers.

[0036] The DNA methylation level detected by the kit uses a real-time fluorescent quantitative polymerase chain reaction (qPCR) method.

[0037] As an example of the above supplement of the present invention, a method for identifying a primary tumor lesion by using real-time fluorescence quantitative polymerase chain reaction (qPCR) in paraffin-embedded tumor tissue comprises the following steps:

[0038] (1) Obtain paraffin-embedded tissue of tumor tissue;

[0039] (2) Real-time fluorescence quantitative polymerase chain reaction was used to detect the methylation levels of 10 genes in the sample;

[0040] (3) The methylation levels of 10 genes in the sample were detected and compared with the cancer gene DNA methylation database to determine the tissue origin and tumor type.

[0041] The use of the aforementioned kit in the preparation of a reagent for identifying the origin of tumor tissue.

[0042] The benefits of the present invention lie in that: by detecting the methylation levels of 10 genes closely related to the tissue origin of tumors, the present invention constructs a classification prediction model for determining the tissue origin and cancer type of tumor samples, which can assist traditional histopathological examinations to a certain extent, and can improve the survival rate of patients with unknown primary metastatic cancer to a certain extent, thereby improving the survival status of patients; the kit of the present invention can accurately identify the tissue origin of unknown primary metastatic cancer, has a wide range of applications and a high accuracy rate, helps to achieve personalized medication, and has important clinical significance for accurate treatment of patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 This is the qPCR amplification curve for screening related methylation genes in Example 2 of the present invention;

[0044] Figure 2 Optimizing the qPCR amplification curve for the reaction system in Example 3 of the present invention;

[0045] Figure 3 Optimizing the qPCR amplification curve for the reaction procedure in Example 4 of the present invention;

[0046] Figure 4This is the qPCR amplification curve for detecting FFPE samples of clinical renal cancer patients in Example 5 of the present invention. DETAILED DESCRIPTION

[0047] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0048] Example 1. Design of primer probe set

[0049] First, enter the TCGA Wanderer database to query the high methylation differential regions in the CpG sites of the 30 genes screened out, and design primer probe sets based on these high methylation differential regions. The design principles of primer probe sets are as follows:

[0050] (1) A single primer probe contains 2-4 CpG sites.

[0051] (2) Tm value is 58-68℃. T value that is too high or too low will not match the optimal temperature of DNA polymerase.

[0052] (3) The difference in Tm values ​​between the upstream and downstream primers should not exceed 2°C, and should preferably be less than 1°C. If the difference in Tm values ​​between the upstream and downstream primers is too large, the primers will not be able to bind to the template chain at the same time, affecting the amplification efficiency.

[0053] (4) Avoid primers being complementary to themselves or other primer sequences to prevent primer dimerization or self-hairpin structures.

[0054] (5) The proportion of cytosine and guanine in the primer probe is 40%-60%.

[0055] (6) The optimal length of the primer probe is 18-25 bp, generally between 16-30 bp. Too long or too short will cause the Tm value to exceed the optimal range.

[0056] (7) Avoid too many consecutive guanines at the 3' end of the primer, otherwise the end will be too stable, resulting in a local Tm value that is too high.

[0057] The final design results were synthesized by Shanghai Bioengineering Co., Ltd. The specific sequence is as follows:

[0058] RNF135 gene:

[0059] The forward primer is shown in SEQ ID NO. 1: TTAGAGTTGGGTTGGCGGGAG;

[0060] The reverse primer is shown in SEQ ID NO. 2: GAACGTAATAACGCACGCCTA;

[0061] The probe is shown in SEQ ID NO.3: AACCGAAATCACGCACGCCAT.

[0062] SEPTIN9 gene:

[0063] The forward primer is shown in SEQ ID NO.4: GGAGGTCGTTGTCGTTTGGT;

[0064] The reverse primer is shown in SEQ ID NO.5: CCTACGCGCCCTCACAAA;

[0065] The probe is shown in SEQ ID NO.6: AGGCGGTAGTGCGTAGAACGAG.

[0066] SGIP1 gene:

[0067] The forward primer is shown in SEQ ID NO.7: TGTAGGTTGGTTATTATGTGACG;

[0068] The reverse primer is shown in SEQ ID NO.8: CGACAAACTAACCGAACTACACC;

[0069] The probe is shown in SEQ ID NO.9: AAGGGATTGGTCGAGGTAGCGTAG.

[0070] SHOX2 gene:

[0071] The forward primer is shown in SEQ ID NO. 10: TGGATAGTTAGGTAATTTTCGTTTCG;

[0072] The reverse primer is shown in SEQ ID NO. 11: CAACCAACATAACGTAAACGCCT;

[0073] The probe is shown in SEQ ID NO.12: TCGATCGGGGTCGTACGA.

[0074] TSHR gene:

[0075] The forward primer is shown in SEQ ID NO. 13: TAGTTAGGGTTGCGTGTTCGT;

[0076] The reverse primer is shown in SEQ ID NO. 14: CACTCGCACGCACTCCTTA;

[0077] The probe is shown in SEQ ID NO.15: CCGCGAACGAACCAATATCCTAC.

[0078] Twist Gene:

[0079] The forward primer is shown in SEQ ID NO. 16: TAGACGTAGCGGGTTATGGTT;

[0080] The reverse primer is shown in SEQ ID NO. 17: AATCTTCCGCAACGCGACGAA;

[0081] The probe is shown in SEQ ID NO.18: ACGTGCGGGAGCGTTAGCGTA.

[0082] VIM Gene:

[0083] The forward primer is shown in SEQ ID NO. 19: TGCGTCGGTAGGTGGATTAG;

[0084] The reverse primer is shown in SEQ ID NO. 20: TCTCCCGAAAACGCATAATATCCTCGAC;

[0085] The probe is shown in SEQ ID NO.21: CGTCGAGGTGGAGCGCGAT.

[0086] RASSF1A gene:

[0087] The forward primer is shown in SEQ ID NO. 22: GGAGCGTTTTAATTGTCGAT;

[0088] The reverse primer is shown in SEQ ID NO. 23: CCCGAATCCGCTTACAAC;

[0089] The probe is shown in SEQ ID NO.24: AACCTCTCTATACCGCCGAA.

[0090] DBNL gene:

[0091] The forward primer is shown in SEQ ID NO. 25: TCGGTTCGGTTCGGAAGTTATA;

[0092] The reverse primer is shown in SEQ ID NO. 26: ATAACCACCCGCACGTAA;

[0093] The probe is shown in SEQ ID NO.27: ACTCAAATTCGCCGCCATAACC.

[0094] EMX1 gene:

[0095] The forward primer is shown in SEQ ID NO. 28: TGTTTCGCGGTTTATCGT;

[0096] The reverse primer is shown in SEQ ID NO. 29: AAACGACTCGACTCCCAA;

[0097] The probe is shown in SEQ ID NO.30: AACCGCCGAAAAACGCATC.

[0098] Example 2: Screening of related methylation genes

[0099] The present invention uses 30 FFPE samples of tumor patients obtained from hospitals, extracts gDNA from them, and uses the above 30 primer probe sets to perform qPCR amplification on BisDNA after bisulfite treatment to detect its fluorescence signal. The specific steps are as follows:

[0100] (1) Prepare 40-80 paraffin sections of tumor tissue and process them according to the instructions of the nucleic acid extraction and purification kit. Extract and purify 4-8 paraffin sections in each tube to obtain a total of 300 μL BisDNA. Each sample needs to be tested for 30 genes and 18S genes, totaling 31 tests.

[0101] (2) Place 4-8 paraffin sections in a 2 mL centrifuge tube, add 200 μL of dewaxing and repairing solution, vortex for 15 seconds, centrifuge briefly to remove the attachments on the tube wall and tube cap, and place in a metal bath and heat at 700 rpm and 95°C for 15 minutes.

[0102] (3) Add 200 μL of Buffer B, 60 μL of proteinase K, and 60 μL of magnetic beads to a 2 mL centrifuge tube, vortex for 15 seconds, and heat in a metal bath at 700 rpm and 56°C for 15 minutes.

[0103] (4) Remove the centrifuge tube, add 200 μL Buffer C, vortex mix for 3 min, place the sample tube in a magnetic rack and let it stand for 1 min. After the solution is clarified, transfer the supernatant to a new 200 μL centrifuge tube.

[0104] (5) Place the centrifuge column in the collection tube, add 700 μL of Buffer B to the centrifuge column, and transfer all the sample solution in the above 200 μL centrifuge tube to the centrifuge column. Mix by inverting 10 to 15 times, and centrifuge at 12,000 g for 30 seconds.

[0105] (6) Remove the centrifuge column, discard the collection tube, and place the centrifuge column in a new collection tube. Add 200 μL of Buffer W to the centrifuge column and centrifuge again at 12,000 g for 30 seconds.

[0106] (7) Remove the centrifuge column and collection tube, add 200 μL of Buffer D to the centrifuge column, let stand at room temperature for 16 min, and then centrifuge at 12,000 g for 30 s.

[0107] (8) Remove the centrifuge column and collection tube, add 200 μL of Buffer W to the centrifuge column, and centrifuge at 12,000 g for 30 seconds.

[0108] (9) Remove the centrifuge column, discard the collection tube, and place the centrifuge column in a new collection tube. Add 200 μL of Buffer W to the centrifuge column and centrifuge at 12,000 g for 30 seconds.

[0109] (10) Carefully remove the centrifuge column, discard the collection tube, and place the centrifuge column in a new 1.5 mL centrifuge tube. Then, add 30 μL of Buffer E to the centrifuge column and let it stand at room temperature for 3 min. Then, centrifuge at 12,000 g for 30 s.

[0110] (11) Take out the 1.5 mL centrifuge tube and discard the centrifuge column. The centrifuge tube contains the purified BisDNA sample.

[0111] The above BisDNA samples were tested using a fluorescent quantitative PCR instrument, and the Taqman analysis method was selected to detect the FAM fluorescent signal channel. The reaction system and reaction procedure are shown in Table 1 and Table 2. The results are shown in Figure 1 , as shown in Table 3.

[0112] Table 1 qPCR amplification system

[0113]

[0114] Table 2 qPCR amplification program

[0115]

[0116] As shown in Table 3, 10 genes with no more than 3 methylation detection numbers in tumor tissues were selected, including RNF135, SEPTIN9, SGIP1, SHOX2, TSHR, Twist, VIM, RASSF1A, DBNL, and EMX1, a total of 10 genes. Figure 1 The screening results of four genes, PLAC8, RNF135, RNF180, and SCAND3, are shown, corresponding to the first four genes in Table 3, and the marked curve is the curve corresponding to the RNF135 gene.

[0117] Table 3 Results of screening of related methylation genes

[0118] Lung cancer Liver cancer Gastric cancer Colorectal cancer Kidney cancer Prostate cancer Pancreatic cancer Cervical cancer Breast cancer Urothelial carcinoma PLAC8 37.05 33.89 / / / / 39.13 38.07 / / RNF135 / 38.53 / 39.36 / / / / / / RNF180 / 32.77 37.55 36.98 / / / 32.13 / / SCAND3 37.62 35.24 / 35.61 / / 33.89 30.86 / / SEPTIN9 / / / 39.98 37.89 / / / / / SCT 39.53 38.03 / / / 38.03 35.79 35.21 35.68 36.40 SGIP1 / 36.73 / 38.13 / / 35.97 / / / SOX17 / 34.47 38.46 33.82 / / 36.00 35.65 / / SHOX2 / / / / 38.32 / / / / 38.38 TSHR / / / / 38.51 / / / / / Twist / / / / / / 37.42 / / / VIM / / / / / / / / / 36.46 ZNF154 / / / 37.96 36.44 38.03 33.16 / 31.85 / KCNA3 / 36.23 36.55 33.64 / / 39.56 / / / HOXA1 / / 33.64 37.98 / / / 36.97 / / ATAD2 / / 39.56 / 36.67 38.99 / / 37.86 38.64 SPINT2 / 36.59 37.96 / / / 36.79 34.67 36.91 / DBX1 33.64 38.65 39.29 / 36.94 34.24 / / / / PSD / 36.94 39.55 / / / 34.11 36.29 37.66 / RUNX3 / 36.92 36.77 / / 33.67 / / / / RASSF1A 36.44 / / / / / / 36.94 / / DBNL 39.64 / / 36.91 / / / / 38.25 LRRC4 / 39.84 38.15 / / 36.34 / / / 36.87 EFNB2 36.91 / / / 36.99 / 34.68 / 37.99 38.15 EMX1 / / 38.21 / / 36.54 / / 33.67 / APOA5 / / 39.64 38.31 39.64 / / 33.71 36.87 / BDH1 36.97 39.16 36.74 / / / / 35.64 / 39.55 ACP1 / 35.61 38.51 / 39.14 / 34.16 38.51 / / ECE1 36.57 32.95 / / / / / / 39.64 33.48 SCRN1 / / / 39.98 35.62 35.69 38.14 / 34.15 /

[0119] Example 3, reaction system optimization

[0120] The original concentration ratio of upstream and downstream primers and probes for each gene was 2:2:1, and the concentration ratio of upstream and downstream primers and probes for each gene needs to be optimized. The final concentration of the original primers in the PCR reaction system is 0.2μM, and the probe is 0.1μM, that is, the concentration of upstream primers-downstream primers-probes for each gene is 0.2-0.2-0.1. Therefore, the final concentration in the PCR reaction system is changed by changing the volume of primers and probes added in the newly prepared PCR reaction system.

[0121] A total of 6 primer-probe concentration ratios were set: 0.4-0.4-0.4, 0.4-0.4-0.2, 0.4-0.2-0.2, 0.2-0.4-0.2, 0.2-0.2-0.2, 0.2-0.2-0.1, and a single-plex test for each gene was set. The positive reference was used as the template DNA for the test. The specific results are as follows: Figure 2 , as shown in Table 4.

[0122] Table 4 Reaction system optimization results

[0123] Primer-probe concentration ratio Ct 0.4-0.4-0.4 35.85 0.4-0.4-0.2 36.51 0.4-0.2-0.2 37.41 0.2-0.4-0.2 37.22 0.2-0.2-0.2 36.83 0.2-0.2-0.1 37.10

[0124] It can be seen from Table 4 that when the concentration ratio is 0.4-0.4-0.4, the Ct value is the smallest and the effect is better.

[0125] Example 4, reaction program optimization

[0126] The original reaction program is shown in Table 2. The amplification temperature needs to be optimized. The original amplification temperature is 60°C. The new amplification temperature gradient is set to 56°C, 58°C, 60°C, 62°C and 64°C. A total of 5 temperature gradients are used to detect the template DNA. The amplification time is 30s. The specific results are shown in Table 5. Figure 3 shown.

[0127] Table 5 Reaction program optimization results

[0128] Amplification temperature Ct 56℃ 36.50 58℃ 36.26 60℃ 36.30 62℃ 37.03 64℃ 37.09

[0129] It can be seen from Table 5 that when the amplification temperature is 58°C, the Ct value is the smallest and the effect is better.

[0130] Example 5. Clinical FFPE sample detection

[0131] In order to verify the clinical performance of the above detection reagent, the present invention collected FFPE samples from 10 patients with renal cancer from the hospital, extracted gDNA from them, and after bisulfite treatment, used the detection reagent of the present invention to detect the methylation levels of the above 10 genes closely related to the origin of tumor tissues.

[0132] The specific operation steps are shown in Example 2, and the test results are shown in Table 6 and Figure 4 .

[0133] Table 6 Clinical performance of FFPE in patients with renal cancer

[0134] 1 2 3 4 5 6 7 8 9 10 RNF135 / / / / / / / / / / SEPTIN9 36.8 33.89 36.58 35.44 33.72 39.36 35.24 36.25 35.15 37.77 SGIP1 / / / / 39.98 / / / / / SHOX2 37.3 34.04 35.24 33.67 35.23 38.7 38.68 38.44 36.17 37.31 TSHR 34.67 36.46 39.02 / 38.37 / / 39.14 36.98 39.53 Twist / / / / / / / 38.38 / / VIM / 36.73 / / / 36.85 / / / / RASSF1A / / / / 38.13 / / / / / DBNL / / / / / / / / / / EMX1 / / / / / / / / / /

[0135] As can be seen from Table 6, SEPTIN9 and SHOX2 genes were detected in FFPE samples of 10 different renal cancer patients, and had lower Ct values. TSHR gene was detected in 7 samples among FFPE samples of 10 different renal cancer patients. Figure 4 The qPCR amplification curves of 10 genes in FFPE samples of 10 renal cancer patients are shown. The marked curve is the curve corresponding to the SEPTIN9 gene of sample No. 1.

[0136] In summary, the present invention discloses a group of genes and detection reagents for tumor DNA methylation detection, which can detect 10 gene methylation levels, and are used to distinguish the tissue origin and cancer type of the tumor sample, so as to provide targeted treatment for the patient. Therefore, the applicant declares that the present invention illustrates the detailed detection reagents and detection methods of the present invention through the above embodiments, but the implementation methods of the present invention are not limited to the above embodiments, and any other additions, modifications, substitutions, combinations, simplifications and other substitutions that do not deviate from the spirit and principle of the present invention should be within the scope of protection of the present invention.

[0137] For experimental methods in the examples where specific conditions are not specified, the conditions recommended by the manufacturer of the kit or conventional experimental conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989).

[0138] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein may be applied to the present invention. The preferred implementation methods and materials described herein are for demonstration purposes only.

[0139] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the above embodiments do not limit the present invention in any form, and any technical solution obtained by equivalent replacement or equivalent transformation falls within the protection scope of the present invention.

Claims

1. A gene combination for tumor DNA methylation detection, characterized in that: Includes: genes RNF135, SEPTIN9, SGIP1, SHOX2, TSHR, Twist, VIM, RASSF1A, DBNL and EMX1.

2. The gene combination for tumor DNA methylation detection according to claim 1, characterized in that: The tumors include lung cancer, liver cancer, gastric cancer, colorectal cancer, kidney cancer, prostate cancer, pancreatic cancer, cervical cancer, breast cancer, urothelial carcinoma and metastatic cancer of unknown primary lesion.

3. Use of the gene combination according to claim 1 in preparing a kit for detecting tumor DNA methylation.

4. A kit for detecting tumor DNA methylation, characterized in that: The method comprises a biomarker, wherein the biomarker is selected from any one or more of the genes described in claim 1.

5. The kit for detecting tumor DNA methylation according to claim 4, characterized in that: The biomarker is a nucleic acid, an oligonucleic acid chain or a PCR primer set.

6. The kit for detecting tumor DNA methylation according to claim 5, characterized in that: The PCR primer set includes: RNF135 gene: the forward primer is shown in SEQ ID NO.1, the reverse primer is shown in SEQ ID NO.2, and the probe is shown in SEQ ID NO.3; SEPTIN9 gene: the forward primer is shown in SEQ ID NO.4, the reverse primer is shown in SEQ ID NO.5, and the probe is shown in SEQ ID NO.6; SGIP1 gene: the forward primer is shown in SEQ ID NO.7, the reverse primer is shown in SEQ ID NO.8, and the probe is shown in SEQ ID NO.9; SHOX2 gene: the forward primer is shown in SEQ ID NO.10, the reverse primer is shown in SEQ ID NO.11, and the probe is shown in SEQ ID NO.12; TSHR gene: the forward primer is shown in SEQ ID NO.13, the reverse primer is shown in SEQ ID NO.14, and the probe is shown in SEQ ID NO.15; Twist gene: the forward primer is shown in SEQ ID NO.16, the reverse primer is shown in SEQ ID NO.17, and the probe is shown in SEQ ID NO.18; VIM gene: the forward primer is shown in SEQ ID NO.19, the reverse primer is shown in SEQ ID NO.20, and the probe is shown in SEQ ID NO.21; RASSF1A gene: the forward primer is shown in SEQ ID NO.22, the reverse primer is shown in SEQ ID NO.23, and the probe is shown in SEQ ID NO.24; DBNL gene: the forward primer is shown in SEQ ID NO.25, the reverse primer is shown in SEQ ID NO.26, and the probe is shown in SEQ ID NO.27; EMX1 gene: the forward primer is shown as SEQ ID NO.28, the reverse primer is shown as SEQ ID NO.29, and the probe is shown as SEQ ID NO.

30.

7. Use of the kit according to any one of claims 4 to 6 in the preparation of a reagent for identifying the origin of tumor tissue.

Images