SNP (Single Nucleotide Polymorphism) molecular marker influencing pig nipple number character and application

Abstract

The invention discloses four novel SNP (Single Nucleotide Polymorphism) molecular markers influencing the porcine nipple number character and nucleotide sequences containing the corresponding molecular markers. The four SNP molecular markers comprise Cgt, Cgt, Cgt, Cgt, Cgt, Cgt, Cgt, Cgt, Cgt, Cgt, Cgt, Cgt, Cgt, Cgt, Cgt, Cgt, Cgt, Cgt T mutation; or Agt at the 47369817bp position of the 12th chromosome; g mutation; or Tgt at the 135350586bp position of the No.15 chromosome; c mutation; or Tgt at the 607635bp position of the No.17 chromosome; a mutation. By applying one or more of the four SNP molecular markers, the nipple number character of the sow can be efficiently and safely bred, screened individuals with dominant allele types are reserved and bred, and a sow strain with the multi-nipple number character can be bred; and the nipple number character of the sow can be subjected to genetic improvement. By adopting the SNP molecular marker to breed the nipple characters of the sows, the breeding period can be shortened, the reproductive performance of the sows is improved, and the economic value and market competitiveness of the sows are further improved.

Description

Technical Field

[0001] The invention relates to the field of molecular biotechnology and genetic breeding, and in particular to a SNP molecular marker affecting the trait of pig nipple number and its application. Background Art

[0002] The reproductive performance of pigs is one of the important indicators to measure their economic value. Among them, the number of nipples is a complex trait directly related to the survival rate and production efficiency of piglets. It has medium heritability, and the heritability evaluation value is usually between 0.1 and 0.5. The number of nipples directly affects the sow's milk production and the number of suckled piglets, thereby affecting the health and survival rate of piglets. Therefore, selecting the nipple number trait is an effective strategy to improve the production performance of sows in the pig industry.

[0003] There is a certain positive correlation between nipple number and litter size. The combination of a large number of nipples and a high litter size is an important physiological basis for achieving high reproductive capacity in sows. Although substantial progress has been made in the genetic improvement of litter size in recent years, the nipple number trait has not been systematically selected and improved, resulting in some sows having more piglets than their nipples can feed, affecting piglet weight gain and mortality, and increasing production costs and management difficulties. Therefore, the development and use of new molecular breeding markers to increase the number of pig nipples has important scientific significance and industrial value for achieving genetic improvement of breeding performance in sows.

[0004] Genome-wide association studies (GWAS) is a method that integrates genetics, statistics, and computer science. It uses high-density molecular markers screened across the genome to scan the entire genome of the study population, analyzes the association between the molecular marker data obtained by the scan and the phenotypic traits through statistical methods, and then combines genetic knowledge to analyze and identify the genetic variation of the phenotypic traits or the related candidate genes that affect the phenotypic traits. In the field of pig breeding, GWAS has been widely used in the study of nipple number traits, and many studies have reported gene loci and candidate genes related to nipple number. However, its research results usually have population heterogeneity, and its genetic basis and the main effect genes that control the pig nipple number trait are still unclear.

[0005] In order to improve the accuracy and reliability of GWAS results, Meta-analysis methods are also applied to pig breeding research. Meta-analysis, also known as meta-analysis or comprehensive analysis, can enhance the probability of discovering new associations and reduce false negative results by statistically synthesizing information from multiple independent studies, thereby improving the test power and accuracy of the results. The application of Meta-analysis in pig breeding has not only improved the number and accuracy of GWAS results, but also provided strong support for analyzing the genetic basis of important economic traits in pigs. Summary of the invention

[0006] The purpose of the present invention is to provide a new SNP molecular marker affecting the number of pig nipples and its application, so as to increase the number of sow nipples, thereby improving its reproductive performance and achieving genetic improvement of breeding pig reproductive performance.

[0007] According to a first aspect of the present invention, a SNP molecular marker affecting the nipple number trait of pigs is provided, and the SNP molecular marker includes a C>T mutation located at the 47855059bp position of chromosome 8 of the pig genome Ensembl Sscrofa11.1 version (hereinafter referred to as "yz_8_47855059 molecular marker"); or an A>G mutation located at the 47369817bp position of chromosome 12 of the pig genome Ensembl Sscrofa11.1 version (hereinafter referred to as "rs341593917 molecular marker"); or a T>C mutation located at the 135350586bp position of chromosome 15 of the pig genome Ensembl Sscrofa11.1 version (hereinafter referred to as "yz_rs81341835 molecular marker"); or a SNP molecular marker located at the 47369817bp position of chromosome 12 of the pig genome Ensembl Sscrofa11.1 version (hereinafter referred to as "rs341593917 molecular marker"); The T>A mutation at the 607635bp position of chromosome 17 in the Sscrofa11.1 version (hereinafter referred to as "yz_17_607635 molecular marker"). Selecting any one or more of the above four SNP molecular markers can increase the number of nipples of the selected sows, improve the reproductive performance of the selected sow group, and further improve the economic value of the sows.

[0008] According to a second aspect of the present invention, there is provided an application of a SNP molecular marker in the selection of sow nipple number traits, the SNP molecular marker comprising a C>T mutation located at the 47855059bp position of chromosome 8 of the pig genome Ensembl Sscrofa11.1 version; or an A>G mutation located at the 47369817bp position of chromosome 12 of the pig genome Ensembl Sscrofa11.1 version; or a T>C mutation located at the 135350586bp position of chromosome 15 of the pig genome Ensembl Sscrofa11.1 version; or a T>A mutation located at the 607635bp position of chromosome 17 of the pig genome Ensembl Sscrofa11.1 version. Therefore, by selecting and breeding these four SNP molecular markers for the sow nipple number trait, retaining the dominant genotype individuals with a large number of nipples, and then expanding the breeding, the number of nipples of sows can be increased generation by generation, the selection and breeding of the sow nipple number trait can be achieved, the breeding cycle can be shortened, and the reproductive performance of sows can be improved.

[0009] According to the third aspect of the present invention, there is provided an application of a SNP molecular marker in breeding a sow strain with a high nipple number, wherein the SNP molecular marker includes a C>T mutation located at the 47855059bp position of chromosome 8 of the pig genome Ensembl Sscrofa11.1 version; or an A>G mutation located at the 47369817bp position of chromosome 12 of the pig genome Ensembl Sscrofa11.1 version; or a T>C mutation located at the 135350586bp position of chromosome 15 of the pig genome Ensembl Sscrofa11.1 version; or a T>A mutation located at the 607635bp position of chromosome 17 of the pig genome Ensembl Sscrofa11.1 version. Thus, a sow strain with a high nipple number can be obtained, which has better reproductive performance and economic value and better market competitiveness.

[0010] In certain embodiments, the application method comprises the following steps:

[0011] S1: Detecting the SNP molecular markers in gilts;

[0012] S2: selecting the individuals with the TT genotype at the 47855059bp position of chromosome 8 detected in step S1 as breeding sows, and breeding the breeding sows;

[0013] or selecting an individual with a GG genotype at the 47369817bp position of chromosome 12 detected in step S1 as a breeding sow, and breeding the breeding sow;

[0014] or selecting an individual with the CC genotype at the 135350586bp position of chromosome 15 detected in step S1 as a breeding sow, and breeding the breeding sow;

[0015] or selecting an individual with the TT genotype at the 607635bp position of chromosome 17 detected in step S1 as a breeding sow, and breeding the breeding sow;

[0016] S3: The SNP molecular markers are detected in the piglets born from mating in step S2, and the piglets are kept according to the genotypes described in step S2, and then bred to cultivate a sow strain with a large number of nipples.

[0017] According to the fourth aspect of the present invention, there is provided an application of a SNP molecular marker in improving the nipple number trait of sows, wherein the SNP molecular marker includes a C>T mutation located at the 47855059bp position of chromosome 8 of the pig genome Ensembl Sscrofa11.1 version; or an A>G mutation located at the 47369817bp position of chromosome 12 of the pig genome Ensembl Sscrofa11.1 version; or a T>C mutation located at the 135350586bp position of chromosome 15 of the pig genome Ensembl Sscrofa11.1 version; or a T>A mutation located at the 607635bp position of chromosome 17 of the pig genome Ensembl Sscrofa11.1 version. Thus, by applying one or more of the above four SNP molecular markers, the nipple number trait of sows can be selected and bred, thereby improving the nipple number trait of sows and improving the reproductive performance and economic value of sows.

[0018] In certain embodiments, the application method comprises the following steps:

[0019] S1: Detecting the SNP molecular markers in gilts;

[0020] S2: selecting the individuals with the TT genotype at the 47855059bp position of chromosome 8 detected in step S1 as breeding sows, and breeding the breeding sows;

[0021] or selecting an individual with a GG genotype at the 47369817bp position of chromosome 12 detected in step S1 as a breeding sow, and breeding the breeding sow;

[0022] or selecting an individual with the CC genotype at the 135350586bp position of chromosome 15 detected in step S1 as a breeding sow, and breeding the breeding sow;

[0023] or selecting an individual with the TT genotype at the 607635bp position of chromosome 17 detected in step S1 as a breeding sow, and breeding the breeding sow;

[0024] S3: The SNP molecular markers are detected in the piglets born from mating in step S2, and the piglets are kept according to the genotypes as described in step S2, and then bred to retain the individuals with the dominant genotype in the offspring pigs and eliminate other genotypes to increase the frequency of the dominant allele from generation to generation, thereby improving the nipple number trait of the sow group and improving the nipple number of the offspring sows.

[0025] According to the fifth aspect of the present invention, there is provided an application of a SNP molecular marker for detecting / screening / identifying the teat number trait of a sow, wherein the SNP molecular marker includes a C>T mutation located at the 47855059bp position of chromosome 8 of the pig genome Ensembl Sscrofa11.1 version; or an A>G mutation located at the 47369817bp position of chromosome 12 of the pig genome Ensembl Sscrofa11.1 version; or a T>C mutation located at the 135350586bp position of chromosome 15 of the pig genome Ensembl Sscrofa11.1 version; or a T>A mutation located at the 607635bp position of chromosome 17 of the pig genome Ensembl Sscrofa11.1 version. Thus, one or more of the four SNP molecular markers can be used to safely, efficiently and accurately detect / screen / identify the teat number trait of a sow, facilitating subsequent breeding work.

[0026] In certain embodiments, the sow is a Large White or Landrace sow.

[0027] According to the sixth aspect of the present invention, there is provided an application of a SNP molecular marker in the preparation of a kit for detecting / screening / identifying the teat number trait of sows, wherein the SNP molecular marker includes a C>T mutation located at the 47855059bp position of chromosome 8 of the pig genome EnsemblSscrofa11.1 version; or an A>G mutation located at the 47369817bp position of chromosome 12 of the pig genome EnsemblSscrofa11.1 version; or a T>C mutation located at the 135350586bp position of chromosome 15 of the pig genome EnsemblSscrofa11.1 version; or a T>A mutation located at the 607635bp position of chromosome 17 of the pig genome EnsemblSscrofa11.1 version. Thus, by preparing a corresponding detection kit with one or more of the four SNP molecular markers, the teat number trait of sows can be detected / screened / identified safely, efficiently and accurately, facilitating subsequent breeding work.

[0028] According to the seventh aspect of the present invention, a nucleotide sequence containing a SNP molecular marker affecting the nipple number trait of pigs is provided, the sequence containing a nucleotide sequence as shown in SEQ ID No: 1, and the 101st base M in the sequence represents a C>T base mutation; or containing a nucleotide sequence as shown in SEQ ID No: 2, and the 101st base M in the sequence represents an A>G base mutation; or containing a nucleotide sequence as shown in SEQ ID No: 3, and the 101st base M in the sequence represents a T>C base mutation; or containing a nucleotide sequence as shown in SEQ ID No: 4, and the 101st base M in the sequence represents a T>A base mutation. Thus, the corresponding primers or probes can be designed through the above sequence to detect / screen / identify the SNP molecular marker, and then used for the selection of the nipple number trait of sows, which can improve the nipple number and reproductive performance of sow groups and effectively shorten the breeding period, thereby improving the economic value and market competitiveness of sows.

[0029] According to the eighth aspect of the present invention, there is provided an application of a nucleotide sequence containing a SNP molecular marker affecting the nipple number trait of pigs in detecting / screening / identifying the nipple number trait of sows, wherein the sequence contains a nucleotide sequence as shown in SEQ ID No:1, and the 101st base M in the sequence represents a C>T base mutation; or contains a nucleotide sequence as shown in SEQ ID No:2, and the 101st base M in the sequence represents an A>G base mutation; or contains a nucleotide sequence as shown in SEQ ID No:3, and the 101st base M in the sequence represents a T>C base mutation; or contains a nucleotide sequence as shown in SEQ ID No:4, and the 101st base M in the sequence represents a T>A base mutation. Thus, by designing the nucleotide sequence containing the SNP molecular marker affecting the nipple number trait of pigs into corresponding primers or probes for detecting / screening / identifying the nipple number trait of sows, the nipple number trait of sows can be detected / screened / identified simply, safely and efficiently, laying a foundation for subsequent breeding work.

[0030] According to the ninth aspect of the present invention, there is provided a use of a nucleotide sequence containing a SNP molecular marker affecting the pig nipple number trait in the preparation of a product for detecting / screening / identifying the pig nipple number trait, wherein the sequence contains a nucleotide sequence as shown in SEQ ID No: 1, and the 101st base M in the sequence represents a C>T base mutation; or contains a nucleotide sequence as shown in SEQ ID No: 2, and the 101st base M in the sequence represents an A>G base mutation; or contains a nucleotide sequence as shown in SEQ ID No: 3, and the 101st base M in the sequence represents a T>C base mutation; or contains a nucleotide sequence as shown in SEQ ID No: 4, and the 101st base M in the sequence represents a T>A base mutation. Thus, by using the nucleotide sequence containing the SNP molecular marker affecting the pig nipple number trait to prepare a corresponding detection kit and other products, the sow nipple number trait can be detected / screened / identified efficiently, quickly, safely and without side effects.

[0031] Beneficial effects of the present invention: The present invention discloses 4 new SNP molecular markers that affect the nipple number trait of pigs and nucleotide sequences containing the corresponding molecular markers. By applying one or more of the 4 SNP molecular markers, the nipple number trait of sows can be efficiently and safely selected and bred, and the individuals screened out with the dominant allele genotype can be retained and bred, sow strains with multiple nipple number traits can be cultivated, and the nipple number trait of sows can also be genetically improved. The use of the above-mentioned SNP molecular markers for the selection of sow nipple traits can shorten the breeding period, improve the reproductive performance of sows, and further improve the economic value and market competitiveness of sows. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 This is the Manhattan plot of the Meta-GWAS of the left nipple number trait;

[0033] Figure 2 This is the Manhattan plot of the Meta-GWAS of the right nipple number trait;

[0034] Figure 3 Manhattan plot of the Meta-GWAS for the total nipple number trait. DETAILED DESCRIPTION

[0035] The invention will be further described in detail below in conjunction with the embodiments.

[0036] Example 1. Screening of molecular markers

[0037] (1) Phenotype-pedigree data collection

[0038] The research population of this application is Danish Large White, Chinese Large White, Topek Large White, Danish Landrace, Chinese Landrace, and Topek Landrace, all from the core breeding farm of Guangxi Yangxiang Group Co., Ltd. The phenotypic data such as the number of left nipples, the number of right nipples, and the number of preumbilical nipples were recorded between 2015 and 2022. The total number of nipples is calculated as: total number of nipples = number of left nipples + number of right nipples. After filtering the abnormal phenotypic data, a total of 15,214 pigs were obtained for the nipple number trait observations for phenotype-genotype association analysis.

[0039] (2) Genotyping and quality control

[0040] Ear tissue samples or blood samples were collected from sows, total DNA was extracted, and genotyping of qualified DNA samples was performed using the pig 80K functional locus gene chip [Shadow Gene, CHN, DNBSEQ-T7 (MGI)]. PLINKv2.0 software was used for quality control, and the conditions were: SNP sites at unknown positions and on sex chromosomes were eliminated, and the individual detection rate was retained ≥ 90%; SNP detection rate ≥ 90%; minimum allele frequency ≥ 0.01; Hardy-Weinberg equilibrium P value ≥ 10 -6 The missing loci were filled with beagle software (version 4.1). After filling, quality control was performed again, and the quality control conditions were the same as before. 7506 pigs were obtained with both phenotypic and genotypic data for subsequent analysis.

[0041] (3) Principal component analysis and quality control

[0042] This application uses PLINKv2.0 software to evaluate the population structure. Principal component analysis (PCA) was performed on the SNP chip data after quality control, the first five principal component characteristics were calculated, and the first three principal components were taken to draw the principal component result diagram. Since Danish Landrace and Chinese Landrace could not be distinguished on the first three principal components, they were analyzed as a group in the subsequent analysis. According to the results, the discrete groups outside the 95% confidence interval were eliminated, and finally divided into five groups of Danish Chinese Landrace, Topek Landrace, Danish Large White, Chinese Large White, and Topek Large White, with a total of 7,338 pigs, for subsequent analysis. The original chip data of 5 groups were extracted from the original chip data respectively, and quality control-filling-quality control was performed using PLINK v2.0 software and beagle software (version4.1). The operation steps and quality control conditions were the same as before, and 3729 Danish Large Whites and 74147 SNPs, 250 Chinese Large Whites and 100066 SNPs, 263 Topek Large Whites and 94946 SNPs, 2914 Danish and Chinese Landraces and 88625 SNPs, and 182 Topek Landraces and 69752 SNPs were obtained as the final data analysis.

[0043] (4) Statistical Model

[0044] 4.1 Genome-wide association analysis model

[0045] This application uses the univariate mixed linear model of GEMMA software to perform genome-wide association analysis on the nipple number traits of the five populations. The univariate mixed linear model is as follows:

[0046] y=Wα+Xβ+μ+ε

[0047] Where y is the phenotype vector, W is the indicator matrix of fixed effects and covariates, which include sex, field, season and the first three principal component characteristics of PCA, α is the corresponding correlation coefficient in each fixed effect; X is the indicator matrix of SNP, β represents the effect vector of SNP; μ is the n×1 random effect matrix, and ε represents the residual.

[0048] 4.2 Meta-analysis model

[0049] This application uses METAL software to combine the weights of the GWAS results of the five groups for meta-analysis. Based on the METAL software, the effect direction and result P value of the target group are converted into Z-scores. The calculation formula of the Z-test statistic (Z-scores) is as follows:

[0050]

[0051] Where Pi is the P value of the i-th group, Δi represents the effect direction of the i-th group, and Ni is the sample size of the i-th group.

[0052] (5) Marker screening

[0053] The results of the meta-analysis were processed and the false discovery rate (FDR) method was used to correct the results. The FDR was set to 0.01 and the threshold formula was:

[0054] P=FDR×n / m

[0055] Among them, FDR is set to 0.01, n is the number of sites with a P value less than 0.01 in the GWAS results, and m is the total number of SNP sites after quality control.

[0056] Draw a Manhattan plot for the effect values ​​of all the above markers to display and filter SNP markers below the threshold line. The results are as follows Figure 1 and 2 As shown, Figure 1 The middle is the Manhattan plot of Meta-GWAS of right nipple number trait. Figure 2This is the Manhattan plot of the Meta-GWAS of the total nipple number trait. A total of 4 SNP molecular markers related to the pig nipple number trait were screened out, namely yz_8_47855059, rs341593917, yz_rs81341835, and yz_17_607635:

[0057] The yz_8_47855059 molecular marker is located at the 47855059bp position of chromosome 8 of the pig genome EnsemblSscrofa11.1 version, which is a C>T base mutation. The nucleotide sequence of the 100bp upstream and downstream of the SNP marker is shown in SEQ ID No:1, where the 101st base M(C / T) Indicates a C>T base mutation:

[0058] TACCTTGCCCTGYTGGGGCTTCCCAGGCATCACTTGCCTTTTTGTGTC

[0059] AGGATCAGAAAACAACGAGGGGAAGAAAGGGGAGGAGCACTTATTT CAGCTG M(C / T )GTGATGGCAACCCAGGGGAAGGTTGGTTAGGAGACT ATAGCAATGTTGACTCAATTTAGTTTTGGACAAGTTTATCCAGAAGGCAAACTTGACTTTCTTG.

[0060] The rs341593917 molecular marker was found in Ensembl (Sscrofa11.1) and is located at 47369817bp of chromosome 12 of the pig genome Ensembl Sscrofa11.1 version. This position is an A>G base mutation. The nucleotide sequence of the 100bp upstream and downstream of the SNP marker is shown in SEQ ID No: 2, where the 101st base M(A / G) Indicates A>G base mutation:

[0061] RCTCGGAGGTGGGGGATGGCACTTGWACTTGGAACCTGGGAAGTGR

[0062] GCCAAKGGACCRGGRTGACCGGGGACAGTGTCTTGTGTCCCTAGGGG AGTGAAC M(A / G)AGGGTGAACTTCYTGTAGTGGTCTGGGCAGATGCY GAGKCAGGGGAGGTTTCCATGCCATCCAGGGGCCATGAGAGATGCCCTCAGTGGAGGGGCCACGT.

[0063] The yz_rs81341835 molecular marker was found by referring to Ensembl (Sscrofa11.1), which is located at the 135350586bp position of chromosome 15 of the pig genome EnsemblSscrofa11.1 version. This position is a T>C base mutation. The nucleotide sequence of the 100bp upstream and downstream of the SNP marker is shown in SEQ ID No:3, where the 101st base M(T / C) Indicates T>C base mutation: CGCCAGGCCCAGGTGACCYGCCCTCGCCTGCGATGGAGACCAGAGGT GTCACCCTGTTTCGGCTCCTGGAGATGGGACCACAAAAGCTGCAGGC ACTAMG M(T / C) TGGGGTGACAGACATCATGAAAGCCAGGGAGGAAA GCAATCAGGGACCAAGGCCACGTCCACCAGGCAAAGCCAGAGTCAG GGCCAGGCCAGCTCTCTGA.

[0064] The yz_17_607635 molecular marker was found in Ensembl (Sscrofa11.1) and is located at the 607635bp position of chromosome 17 of the pig genome Ensembl Sscrofa11.1 version. This position is a T>A base mutation. The nucleotide sequence of the 100bp upstream and downstream of the SNP marker is shown in SEQ ID No:4, where the 101st base M(T / A) Indicates T>A base mutation:

[0065] TGCTTTATCTAATATAGGCAGGKRAAAAAAAGAGAGTTGGAGAGTCTT

[0066] CGTCCTTTATCACAGAGAAGCCCCACCTATAATCCTCACATTCCCACCT CAA M(T / A) CATCCAAGCCAGCTGAACAAATCTATCCCACCTCCCACAC AACCTGCYTAAACAACGTAAAACAGATCACCGAGCCCATGTCAAAGG AAAGAGTGTCCTA.

[0067] Through the above-mentioned nucleotide sequence containing the SNP molecular marker that affects the pig nipple number trait, primers or probes can be designed to detect the genotype of the SNP molecular marker at the corresponding site, and then the sow nipple number trait can be further selected based on the test results; or primers can be designed through the nucleotide sequence to make corresponding detection kits that are directly used for the detection of SNP molecular markers, and then the sow nipple number trait can be selected based on the detected genotype.

[0068] Example 2: Association analysis between molecular markers and pig teat number traits

[0069] 2.1 Association analysis between yz_8_47855059 molecular marker and pig teat number trait

[0070] The association analysis between the yz_8_47855059 molecular marker and the pig teat number trait was performed using variance analysis and multiple comparisons (R statistical analysis platform) to analyze the differences in the left teat number, right teat number, and total teat number of breeding pigs in different genotype groups (Table 1).

[0071] Table 1 Association analysis of nipple number traits of pigs with different genotypes using yz_8_47855059 molecular marker

[0072]

[0073]

[0074] Note: P<0.05 indicates significant difference, P<0.01 indicates extremely significant difference.

[0075] From the results in Table 1, it can be seen that when the genotype is TT, the number of left nipples, right nipples and total nipples are significantly higher than those of CT and CC genotypes (p<0.01). In the left nipple number trait, the TT genotype is 0.34 more than the CC genotype; in the right nipple number trait, the TT genotype is 0.40 more than the CC genotype; in the total nipple number trait, the TT genotype is 0.75 more than the CC genotype. It can be seen that when the mutant base in the yz_8_47855059 molecular marker is T, the breeder pig may have more nipples, so T is the dominant allele and the TT genotype is the dominant allele, which should be retained during breeding.

[0076] 2.2 Association analysis between rs341593917 molecular marker and pig nipple number trait

[0077] The association analysis between the rs341593917 molecular marker and the pig teat number trait was performed using analysis of variance and multiple comparisons (R statistical analysis platform) to analyze the differences in the number of left teats, right teats, and total teats of breeding pigs in different genotype groups (Table 2).

[0078] Table 2 Association analysis of nipple number traits of different genotypes of sows with rs341593917 molecular marker

[0079]

[0080] Note: P<0.05 indicates significant difference, P<0.01 indicates extremely significant difference.

[0081] From the results in Table 2, it can be seen that when the genotype is GG, the number of left nipples, right nipples and total nipples are significantly higher than AG and AA genotypes (p<0.01). In the left nipple number trait, the GG genotype is 0.06 more than the AA genotype; in the right nipple number trait, the GG genotype is 0.08 more than the AA genotype; in the total nipple number trait, the GG genotype is 0.14 more than the AA genotype. It can be seen that when the mutant base in the rs341593917 molecular marker is G, the pig may have more nipples, so G is the dominant allele, and the GG genotype is the dominant allele, which should be retained during breeding.

[0082] 2.3 Association analysis between yz_rs81341835 molecular marker and pig nipple number trait

[0083] The association analysis between the yz_rs81341835 molecular marker and the pig teat number trait was performed using variance analysis and multiple comparisons (R statistical analysis platform) to analyze the differences in the number of left teats, right teats, and total teats of breeding pigs in different genotype groups (Table 3).

[0084] Table 3 Association analysis of nipple number traits of different genotypes of sows with yz_rs81341835 molecular marker

[0085]

[0086] Note: P<0.05 indicates significant difference, P<0.01 indicates extremely significant difference.

[0087] From the results in Table 3, it can be seen that when the genotype is CC, the number of left nipples, right nipples and total nipples are significantly higher than those of CT and TT genotypes (p<0.01). In the left nipple number trait, CC genotype is 0.39 more than TT genotype; in the right nipple number trait, CC genotype is 0.41 more than TT genotype; in the total nipple number trait, CC genotype is 0.81 more than TT genotype. It can be seen that when the mutant base in the yz_rs81341835 molecular marker is C, the pig may have more nipples, so C is the dominant allele and CC genotype is the dominant allele, which should be retained during breeding.

[0088] 2.4 Association analysis between yz_17_607635 molecular marker and pig teat number trait

[0089] The association analysis between the yz_17_607635 molecular marker and the pig teat number trait was performed using variance analysis and multiple comparisons (R statistical analysis platform) to analyze the differences in the number of left teats, right teats, and total teats of breeding pigs in different genotype groups (Table 4).

[0090] Table 4 Association analysis of teat number traits of different genotypes of sows with yz_17_607635 molecular marker

[0091]

[0092] Note: P<0.05 indicates significant difference, P<0.01 indicates extremely significant difference.

[0093] From the results in Table 4, it can be seen that when the genotype is TT, the number of left nipples, right nipples and total nipples are significantly higher than those of AT and AA genotypes (p<0.01). In the left nipple number trait, the TT genotype is 0.09 more than the AA genotype; in the right nipple number trait, the TT genotype is 0.07 more than the AA genotype; in the total nipple number trait, the TT genotype is 0.17 more than the AA genotype. It can be seen that when the mutant base in the yz_17_607635 molecular marker is T, the breeder pig may have more nipples, so T is the dominant allele and the TT genotype is the dominant allele, which should be retained during breeding.

[0094] Example 3: Application of SNP molecular markers in breeding sow strains with multiple nipples

[0095] S1: Detect one or more SNP molecular markers among yz_8_47855059, rs341593917, yz_rs81341835, and yz_17_607635 in gilts;

[0096] S2: selecting the individuals with the TT genotype of the yz_8_47855059 molecular marker allele detected in step S1 as breeding sows, and breeding the breeding sows;

[0097] or selecting an individual whose rs341593917 molecular marker allele type is GG genotype in step S1 as a sow for breeding, and breeding the sow for breeding;

[0098] or selecting an individual for which the yz_rs81341835 molecular marker allele type detected in step S1 is CC genotype as a sow for breeding, and breeding the sow for breeding;

[0099] or selecting the individual whose yz_17_607635 molecular marker allele type is TT genotype in step S1 as a sow for breeding, and breeding the sow for breeding;

[0100] S3: Detect one or more SNP molecular markers of yz_8_47855059, rs341593917, yz_rs81341835, and yz_17_607635 in the piglets born from mating in step S2, and keep them for breeding according to the genotype described in step S2, and then breed them to cultivate sow strains with a large number of nipples.

[0101] Example 4: Application of SNP molecular markers in improving the number of teats in sows

[0102] S1: Detect one or more SNP molecular markers among yz_8_47855059, rs341593917, yz_rs81341835, and yz_17_607635 in gilts;

[0103] S2: selecting the individuals with the TT genotype of the yz_8_47855059 molecular marker allele detected in step S1 as breeding sows, and breeding the breeding sows;

[0104] or selecting an individual whose rs341593917 molecular marker allele type is GG genotype in step S1 as a sow for breeding, and breeding the sow for breeding;

[0105] or selecting an individual for which the yz_rs81341835 molecular marker allele type detected in step S1 is CC genotype as a sow for breeding, and breeding the sow for breeding;

[0106] or selecting the individual whose yz_17_607635 molecular marker allele type is TT genotype in step S1 as a sow for breeding, and breeding the sow for breeding;

[0107] S3: Detect one or more SNP molecular markers among yz_8_47855059, rs341593917, yz_rs81341835, and yz_17_607635 in the piglets born from mating in step S2, and keep them for breeding according to the genotype as described in step S2, and then breed them, retain the individuals with dominant genotypes in the offspring pigs, and eliminate other genotypes, so as to increase the frequency of dominant alleles from generation to generation, thereby improving the nipple number trait of the sow group and improving the nipple number of offspring sows.

Claims

1. SNP molecular markers that affect the number of pig nipples, including: The SNP molecular markers include a C>T mutation located at the 47855059bp position of chromosome 8 of the pig genome Ensembl Sscrofa11.1 version; or an A>G mutation located at the 47369817bp position of chromosome 12 of the pig genome Ensembl Sscrofa11.1 version; or a T>C mutation located at the 135350586bp position of chromosome 15 of the pig genome Ensembl Sscrofa11.1 version; or a T>A mutation located at the 607635bp position of chromosome 17 of the pig genome Ensembl Sscrofa11.1 version.

2. Application of the SNP molecular marker described in claim 1 in the selection and breeding of the nipple number trait of sows.

3. Application of the SNP molecular marker described in claim 1 in breeding sow strains with multiple nipples, wherein: The application comprises the following steps: S1: Detecting the SNP molecular markers as described in claim 1 in gilts; S2: selecting the individuals with the TT genotype at the 47855059bp position of chromosome 8 detected in step S1 as breeding sows, and breeding the breeding sows; or selecting an individual with a GG genotype at the 47369817bp position of chromosome 12 detected in step S1 as a breeding sow, and breeding the breeding sow; or selecting an individual with the CC genotype at the 135350586bp position of chromosome 15 detected in step S1 as a breeding sow, and breeding the breeding sow; or selecting an individual with the TT genotype at the 607635bp position of chromosome 17 detected in step S1 as a breeding sow, and breeding the breeding sow; S3: Detect the SNP molecular markers as described in claim 1 for the piglets born from mating in step S2, and keep them for breeding according to the genotypes as described in step S2, and then breed them to cultivate sow strains with a large number of nipples.

4. Application of the SNP molecular marker described in claim 1 in improving the nipple number trait of sows, wherein: The application comprises the following steps: S1: Detecting the SNP molecular markers as described in claim 1 in gilts; S2: selecting the individuals with the TT genotype at the 47855059bp position of chromosome 8 detected in step S1 as breeding sows, and breeding the breeding sows; or selecting an individual with a GG genotype at the 47369817bp position of chromosome 12 detected in step S1 as a breeding sow, and breeding the breeding sow; or selecting an individual with the CC genotype at the 135350586bp position of chromosome 15 detected in step S1 as a breeding sow, and breeding the breeding sow; or selecting an individual with the TT genotype at the 607635bp position of chromosome 17 detected in step S1 as a breeding sow, and breeding the breeding sow; S3: Detect the SNP molecular markers as described in claim 1 for the piglets born from mating in step S2, and retain them according to the genotypes as described in step S2, and then breed them, retain the individuals with dominant genotypes in the offspring pigs, and eliminate other genotypes, so as to increase the frequency of dominant alleles from generation to generation, thereby improving the nipple number trait of the sow group and improving the nipple number of offspring sows.

5. Use of the SNP molecular marker described in claim 1 in detecting / screening / identifying the nipple number trait of sows.

6. The use according to any one of claims 2 to 5, wherein: The sow is a Large White or Landrace sow.

7. Use of the SNP molecular marker described in claim 1 in the preparation of a kit for detecting / screening / identifying the trait of nipple number in sows.

8. A nucleotide sequence containing a SNP molecular marker affecting the number of nipples in pigs, wherein: The sequence contains the nucleotide sequence shown in SEQ ID No: 1, and the 101st base M in the sequence represents a C>T base mutation; or the sequence contains the nucleotide sequence shown in SEQ ID No: 2, and the 101st base M in the sequence represents an A>G base mutation; or the sequence contains the nucleotide sequence shown in SEQ ID No: 3, and the 101st base M in the sequence represents a T>C base mutation; or the sequence contains the nucleotide sequence shown in SEQ ID No: 4, and the 101st base M in the sequence represents a T>A base mutation.

9. Use of the nucleotide sequence containing the SNP molecular marker affecting the pig nipple number trait as described in claim 8 in detecting / screening / identifying the sow nipple number trait.

10. Use of the nucleotide sequence containing the SNP molecular marker affecting the pig teat number trait as claimed in claim 8 in the preparation of a product for detecting / screening / identifying the pig teat number trait.

Images