CRISPR-Cas13a-based mycoplasma hyorhinis detection primer and kit and application of CRISPR-Cas13a-based mycoplasma hyorhinis detection primer and kit

Abstract

The invention discloses a mycoplasma hyorhinis detection primer and kit based on CRISPR-Cas13a and application of the mycoplasma hyorhinis detection primer and kit, and belongs to the technical field of mycoplasma hyorhinis detection. The invention discloses an RAA primer pair for detecting mycoplasma hyorhinis, the RAA primer pair comprises a forward primer and a reverse primer, the nucleotide sequence of the forward primer is as shown in SEQ ID NO.15, and the nucleotide sequence of the reverse primer is as shown in SEQ ID NO.16. The invention further discloses a kit for detecting mycoplasma hyorhinis. And an efficient, convenient and high-specificity in-situ rapid detection method is developed to meet the actual requirements of mycoplasma hyorhinis diagnosis.

Description

Technical Field

[0001] The present invention belongs to the technical field of Mycoplasma hyorhinis detection, and specifically relates to a Mycoplasma hyorhinis detection primer, a kit and an application thereof based on CRISPR-Cas13a. Background Art

[0002] Mycoplasma hyorhinis (Mhr) was first discovered and named in 1955. It is a cell wall-free pathogen commonly found in pigs, mainly colonizing the upper respiratory tract and tonsil area of ​​pigs. When pigs have low immunity, Mhr infection can induce multiple serositis (pleurisy, peritonitis, pericarditis and conjunctivitis) and arthritis, and some infected pigs may not even show obvious clinical symptoms. Given the similarity in clinical symptoms between Mhr and pathogens such as Haemophilus parasuis and Streptococcus suis, there are limitations in making a preliminary diagnosis based solely on clinical symptoms and local lesion characteristics. Therefore, in addition to observing clinical symptoms, the detection of pathogens is also the key to diagnosis.

[0003] At present, the detection methods of Mycoplasma hyorhinis mainly include traditional bacterial isolation and culture methods and polymerase chain reaction (PCR) technology. Although the in vitro isolation of Mhr is easier and more rapid than other mycoplasmas, the separation method is affected by many factors (such as culture medium quality, operation skills and sample background), and the success rate fluctuates greatly. In addition, it is difficult to accurately identify Mhr based on colony morphology and biochemical characteristics alone, so it is necessary to combine other detection methods to improve the accuracy of diagnosis. Although PCR technology is simpler than isolation and culture methods, the currently developed methods such as ordinary PCR, nested PCR, fluorescent quantitative PCR and loop-mediated isothermal amplification generally have the disadvantages of complex operation, long time consumption and high equipment requirements. In particular, loop-mediated isothermal amplification technology is prone to false positive results, which limits its wide application in the field. Although serological methods have certain advantages in clinical applications, due to the large number of common antigens between Mhr and Mycoplasma hyopneumoniae, which leads to significant cross-reactions, and the fact that Mhr can effectively escape immune surveillance, it is difficult to detect specific serological diagnostic methods. Therefore, it is particularly important to explore a method that has high sensitivity, high specificity, high accuracy, low equipment requirements, and is suitable for rapid on-site detection.

[0004] Develop an efficient, convenient, and highly specific local rapid detection method to meet the actual needs of Mhr diagnosis. Summary of the invention

[0005] The purpose of the present invention is to develop an efficient, convenient and highly specific local rapid detection method to meet the actual needs of Mhr diagnosis.

[0006] The present invention provides an RAA primer pair for detecting Mycoplasma hyorhinis. The RAA primer pair comprises a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown in SEQ ID NO.15, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.16.

[0007] The present invention provides a kit for detecting Mycoplasma hyorhinis, the kit comprising a RAA isothermal amplification system and a CRISPR / Cas13a detection system;

[0008] The RAA isothermal amplification system comprises the RAA primer pair according to claim 1, reaction dry powder, ABuffer, BBuffer, enzyme-free water and a positive standard plasmid;

[0009] The CRISPR / Cas13a detection system includes crRNA and ssRNA, and the nucleotide sequence of the crRNA is shown in SEQID NO.22.

[0010] It is further defined that the ssRNA is ROX-BHQ1 or FAM-biotin.

[0011] It is further defined that the CRISPR / Cas13a detection system also includes LwaCas13a protein, 10×HOLMESBuffer2, T7 RNAPolymerase, rNTP Mix and RNase inhibitor Murine.

[0012] It is further defined that the concentration of LwCas13a is 40 nM.

[0013] It is further defined that the concentration of crRNA is 300 nM.

[0014] It is further defined that the concentration of ssRNA is 400 nM.

[0015] The present invention provides a method for detecting Mycoplasma hyorhinis for non-therapeutic and non-diagnostic purposes, wherein the specific steps of the method are as follows:

[0016] Step 1: Extract the DNA of the sample to be tested as a RAA reaction template and prepare the RAA detection system;

[0017] Step 2: Prepare the CRISPR / cas13a reaction system, using the RAA product as the template;

[0018] Step 3: Place the prepared CRISPR / cas13a detection system into a multifunctional microplate reader, react at 37°C for 30 cycles, and collect the fluorescence signal every 1 minute; or place the detection system in a 37°C constant temperature water bath and incubate for 30 minutes, then drop the incubated reaction product onto the sample area of ​​the test strip and observe the result within two minutes.

[0019] The present invention provides a RAA-CRISPR / Cas13a visual detection system for Mycoplasma hyorhinis, wherein the system comprises the above-mentioned RAA primer pair or the above-mentioned detection kit.

[0020] The present invention provides an application of a gene shown in SEQ ID NO.3 as a marker for detecting Mycoplasma hyorhinis.

[0021] Beneficial effects: The beneficial effects of the present invention are: a rapid clinical detection system for Mycoplasma hyorhinis based on the SHERLOCK diagnostic platform has been established. The system combines recombinase-assisted amplification (RAA) with the CRISPR-Cas system, and on this basis, intuitive, sensitive and specific nucleic acid detection of Mycoplasma hyorhinis DNA in clinical samples is performed, providing technical support for the early detection of Mycoplasma hyorhinis and later epidemiological investigations, and having more guiding significance for the treatment and prevention of the disease. The sensitivity of the test strip method for detecting Mycoplasma hyorhinis based on RAA-CRISPR / Cas13a established by the present invention can reach 1×10 -1 copies / μL, which is as sensitive as the fluorescence method. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The first RAA primer screening (at a concentration of 1×10 3 copies / μL of Mhr A plasmid as template). M: Marker2000, 1-6: F1 / R1-F6 / R6;

[0023] Figure 2 Second RAA primer screening (using DNA of Mycoplasma hyorhinis as template). M: Marker 2000, 1: F1 / R1, 2: F4 / R6, 3: F6 / R6;

[0024] Figure 3 Screening of crRNA. The X-axis represents time (min), and the Y-axis represents fluorescence intensity;

[0025] Figure 4 Optimization of crRNA and LwaCas13a concentrations. The X-axis represents crRNA concentration, and the Y-axis represents fluorescence intensity;

[0026] Figure 5ssRNA (ROX-BHQ1) concentration optimization. The X-axis represents time (min), and the Y-axis represents fluorescence intensity;

[0027] Figure 6 Sensitivity test results of the method for detecting Mycoplasma hyorhinis based on the combination of RAA-CRISPR / Cas13a system and fluorescence detection (fluorescence method). The X-axis represents the Mhr plasmid concentration, and the Y-axis represents the fluorescence intensity;

[0028] Figure 7 Sensitivity test results of the method for detecting Mycoplasma hyorhinis based on the RAA-CRISPR / Cas13a system combined with a test strip (test strip method);

[0029] Figure 8 Specific detection results of the method for detecting Mycoplasma hyorhinis based on the combination of RAA-CRISPR / Cas13a system and fluorescence signal (fluorescence method). The X-axis represents the name of the pathogen, and the Y-axis represents the fluorescence intensity;

[0030] Fig. 9 Specific detection results of the method for detecting Mycoplasma hyorhinis based on the RAA-CRISPR / Cas13a system combined with a test strip (test strip method). DETAILED DESCRIPTION

[0031] Example 1. Preparation of standard plasmid

[0032] 1. Design of primers for amplification of standard plasmid of Mycoplasma hyorhinis

[0033] Primers were designed according to the sequence of SEQ ID NO. 3, as shown in Table 1, and used for amplification of the Mycoplasma hyorhinis standard plasmid.

[0034] Table 1 Amplification primers

[0035]

[0036] 2. Construction of standard plasmid of Mycoplasma hyorhinis

[0037] The specific primers designed in step 1 were used to amplify the nucleic acid of Mycoplasma hyorhinis to obtain the target fragment for constructing the standard plasmid. The nucleotide sequence information of the specific target fragment is shown in Table 2. The target fragment was recovered and purified, connected to the pMD18-T vector, and a standard plasmid was constructed and named Mhr A plasmid. The plasmid length was 3764 bp. The extracted plasmid was tested for concentration using a NanoDrop spectrophotometer. According to the copy number calculation formula: copies / μL = 6.02×10 23 ×A260(ng / μL)×10 9 / plasmid length (bp) × 660 to calculate the copy number of the constructed plasmid. Then, the plasmid was serially diluted tenfold to 1 × 10 8 to 1×10 -2 copies / μL.

[0038] Table 2 Nucleotide sequence of target fragment

[0039]

[0040] Example 2. Establishment of RAA system and design and screening of primers

[0041] 1. RAA Primer Design

[0042] According to the gene sequence of Mycoplasma hyorhinis shown in SEQ ID NO.3, multiple pairs of RAA primers were designed for its conserved region (the RAA primers were all within the range of the target fragment shown in Table 2 of Example 1), as shown in Table 3. Since the RAA amplification product is the template for the subsequent CRISPR reaction system, a T7 promoter (GAAATTAATACGACTCACTATAGGG, SEQ ID NO.4) was added to the 5' end of the forward primer so that it can be recognized and transcribed by T7 RNA polymerase to perform the CRISPR reaction normally.

[0043] Table 3 RAA primer information

[0044]

[0045] 2. Establishment of RAA system

[0046] The RAA amplification system was established according to the instructions of the RAA Nucleic Acid Amplification Kit (Basic Type) of Hangzhou Zhongce Company, as shown in Table 4. The reaction conditions were: 39°C constant temperature water bath, incubation for 30 minutes.

[0047] Table 4 RAA reaction system

[0048]

[0049]

[0050] 3. RAA Primer Screening

[0051] 1) Primer screening using Mhr A plasmid as template

[0052] At a concentration of 1×10 3The Mhr A plasmid with 100 copies / μL was used as a template, and the 6 pairs of primers in Table 3 were used for RAA amplification. According to the reaction system in Table 4, the reaction components were added one by one to the reaction powder provided by the kit, and B Buffer was added to the lid of the reaction powder tube. The lid was closed and mixed by inverting upside down, and then centrifuged briefly. According to the reaction conditions, the amplification reaction was carried out in a 39℃ constant temperature water bath for 30 minutes.

[0053] After the reaction is completed, transfer all the reaction products to a 1.5 ml EP tube, and then add an equal volume of phenol: chloroform: isoamyl alcohol (25:24:1) (it can also be operated directly in the original reaction tube). After thorough mixing, centrifuge at 12000 rpm / min for 5 minutes, and take the supernatant for 2% agarose gel electrophoresis experiment verification.

[0054] The results are as follows Figure 1 As shown, RAA-F1 / R1, RAA-F4 / R4, and RAA-F6 / R6 were all clear and single bands, with relatively good sensitivity and specificity.

[0055] 2) Primer screening using Mhr DNA as template

[0056] The same operation was performed on RAA-F1 / R1, RAA-F4 / R4 and RAA-F6 / R6 using the same reaction system and reaction conditions as above to screen out the most suitable primer pair.

[0057] The results are as follows Figure 2 As shown in the figure, the brightness of the three primer pairs is similar and they are all single bands. Figure 1 Based on the results, the RAA-F6 / R6 primer pair was finally selected for subsequent experiments.

[0058] Example 3. Design and synthesis of crRNA

[0059] 1. Design of crRNA

[0060] Four crRNAs were designed according to the target fragments shown in Table 2: Mhr crRNA1, Mhr crRNA2, Mhr crRNA3, and Mhr crRNA4 (the location of crRNA was on the RAA amplified fragment). The DNA chain was synthesized by Shanghai Shenggong Biotechnology Co., Ltd., and from 5' to 3', the DNA chain included a spacer sequence, a direct repeat sequence, and a T7 promoter sequence. The synthesized DNA template was used for the preparation of crRNA, and the required template is shown in Table 5.

[0061] Table 5 DNA template required for synthesizing crRNA

[0062]

[0063]

[0064] 2. Synthesis of crRNA

[0065] 1) Annealing

[0066] The sequences used for the above synthesis were mixed according to the following system: Mhr crRNA IVT (100 μM) 10 μL, T73G IVT (100 μM) 10 μL, NEB Buffer 2.1 10 μL, enzyme-free water 70 μL. The reaction was carried out in a PCR instrument according to the reaction procedure of 95°C for 2 min; cooling to 25°C within 45 min. The concentration of the annealed product was detected using a NanoDrop spectrophotometer and stored at 4°C for a short time.

[0067] 2) Transcription

[0068] The annealed product was transcribed using NEB's HiScribe T7 Quick High Yield RNA Synthesis Kit. The transcription system was (30 μL): NTP Buffer Mix 10 μL, T7 RNA Polymerase 2 μL, annealed product (calculated according to concentration and system) 1 μg, and enzyme-free water was added to 30 μL. Place in a PCR instrument and set to react at 37°C for 16 hours.

[0069] The transcription product was treated with DNase I. The reaction system was as follows: 20 μL of enzyme-free water was added to the transcription product, and then 2 μL of DNase I was added. The product was placed in a PCR instrument and set to react at 37°C for 15 minutes.

[0070] 3) Purification

[0071] The transcripts were transferred into RNA Cleanup kit was used for purification, and the purification process was carried out according to the instructions. The purified product was tested for concentration using a NanoDrop spectrophotometer, and part of the crRNA was diluted to 5 μM and stored at -20°C for later use.

[0072] Example 4. Establishment and optimization of the reaction system for detecting Mycoplasma hyorhinis by fluorescence method and crRNA screening

[0073] 1. Establishment of reaction system

[0074] Using RAA amplification product as template, the reaction system (25 μL) was prepared as follows: 0.5 μL LwaCas13a protein, 2.5 μL 10× HOLMES Buffer 2, 1 μL crRNA, 1 μL ssRNA (ROX-BHQ1), 0.5 μL T7 RNA Polymerase, 2.5 μL rNTP Mix, 1 μL RNase inhibitor Murine, 1.5 μL RAA amplification product and 14.5 μL enzyme-free water. The reaction conditions were: multifunctional microplate reader, 37°C, 30 cycles, and collecting fluorescence signals every 1 min.

[0075] Result determination: In the same test, if there is a significant difference between the fluorescence signal value of the sample to be tested and the average fluorescence signal of the negative control set, P<0.05, it is judged as positive, otherwise it is judged as negative.

[0076] 2.crRNA Screening

[0077] At a concentration of 1×10 5 The Mhr A plasmid with a copy / μL was used as a template to perform RAA amplification according to the steps in Example 2, and the amplified product was used as a template to react according to the system in the above step 1, and enzyme-free water was set as a negative control. Reaction conditions: multifunctional microplate reader, 37°C, 30 cycles, and fluorescence signals were collected every 1 min.

[0078] Results: Figure 3 As shown, the plateau fluorescence values ​​of the four crRNAs for CRISPR reaction are close, but the crRNA2 synthesized by Mhr crRNA A2IVT reaches the plateau fastest for CRISPR reaction and has higher efficiency, so crRNA2 is selected for subsequent experiments. The nucleotide sequence of crRNA2 is: GAUUUAGACUACCCCAAAAACGAAGGGGAC UAAAACUUUGAAAUUUUCUAAAAAUGUAUUAAUA, SEQ ID NO.22.

[0079] 3. Reaction system optimization

[0080] The reaction concentrations of the three components of LwCas13a, crRNA2 and ssRNA in the reaction system were optimized. The concentrations of LwCas13a and crRNA2 were optimized using the chessboard method by fixing other components, and five concentrations of 20 / 40 / 60 / 80 / 100nM were set for LwCas13a (5μM), and five concentrations of 60 / 120 / 180 / 240 / 300nM were set for crRNA2 (5μM). The five concentration values ​​of the two components corresponded one by one according to the chessboard method, and the reaction was carried out according to the above reaction system and reaction conditions, and the optimal concentration was determined according to the fluorescence intensity of the result.

[0081] The concentration of ssRNA (10 μM) (ROX-BHQ1) was optimized, and five concentrations of 80 / 160 / 240 / 320 / 400 nM were set. The reaction was also carried out according to the above reaction system and conditions, and the most appropriate ssRNA reaction concentration was determined according to the reaction rate and fluorescence intensity.

[0082] Results: Figure 4 As shown in the figure, the fluorescence value of the combination of LwCas13a with a final concentration of 40 nM and crRNA2 with a final concentration of 300 nM in the system is higher than that of other combinations, so this concentration is selected as the optimal concentration of LwCas13a and crRNA2. Figure 5 As shown in Table 6, when the final concentration of ssRNA (ROX-BHQ1) in the system is 400 nM, the fluorescence value is the highest and the reaction speed is the fastest, so it is selected as the optimal concentration of ssRNA (ROX-BHQ1). The final reaction system is shown in Table 6.

[0083] Table 6 Final reaction system for fluorescence detection

[0084]

[0085]

[0086] Example 5. Establishment of a reaction system for detecting Mycoplasma hyorhinis by test strip method

[0087] The RAA amplification product was used as a template to prepare the reaction system, as shown in Table 7. The reaction conditions were: incubate in a 37°C constant temperature water bath for 30 minutes, then drop the incubated reaction product onto the sample loading area of ​​the test strip, and observe the results within two minutes.

[0088] Table 7 Test strip method reaction system

[0089]

[0090] Result determination: Under the condition that only the control band appears in the negative control, if bands appear in both the control band and the test band or only the test band appears, it is positive; if only the control band appears, it is negative; if no band appears, the reaction is invalid and needs to be retested.

[0091] The test strip consists of a sample area, a control area, and a test area. The sample area is coated with gold-labeled anti-FAM antibody; the control area is coated with streptavidin; and the test area is coated with anti-mouse antibody (commercial test strip).

[0092] Example 6. Sensitivity detection of the method for detecting Mycoplasma hyorhinis based on RAA-CRISPR / Cass13a

[0093] 1. RAA amplification

[0094] According to the RAA amplification system and reaction conditions in Example 2, 1×10 5 to 1×10 -2 Copies / μL were used as template for amplification, and enzyme-free water was set as negative control to obtain RAA amplification product.

[0095] 2. Sensitivity test of fluorescence detection of Mycoplasma hyorhinis

[0096] The RAA product in step 1 was used as a template, and the reaction was carried out according to the final system and reaction conditions for fluorescence detection of Mycoplasma hyorhinis in Example 4, and the results were analyzed using GraphPad Prism v.8.1.2.

[0097] Results: Figure 6 As shown, the concentration of Mhr A plasmid was 1 × 10 5 to 1×10 -1 The fluorescence signal of the RAA amplification product with 100 copies / μL was significantly different from the average fluorescence signal of the negative control (P<0.001), indicating that the sensitivity of the fluorescence method for detecting Mycoplasma hyorhinis based on RAA CRISPR / Cas13a established in the present invention can reach 1×10 -1 copies / μL, good sensitivity.

[0098] 3. Sensitivity test of Mycoplasma hyorhinis by test strip method

[0099] Using the RAA product in step 1 as a template, the reaction was carried out according to the reaction system and reaction conditions of the test strip method in Example 5, the reaction product was dripped onto the sample loading area of ​​the test strip, and the test strip result was observed within two minutes.

[0100] Results: Figure 7 As shown, the negative control (NC) band only appeared in the control line, while for 1×10 5 to 1×10-2 Test strips for plasmid detection at 8 concentrations of copies / μL, 1×10 5 to 1×10 -1 The plasmids with the highest number of copies / μL showed detection line bands, indicating that the sensitivity of the test strip method for detecting Mycoplasma hyorhinis based on RAA CRISPR / Cas13a established in the present invention can reach 1×10 -1 copies / μL, which is as sensitive as the fluorescence method.

[0101] Example 7. Specific detection of Mycoplasma hyorhinis based on RAA-CRISPR / Cass13a

[0102] 1. RAA amplification

[0103] Using nucleic acids of Mycoplasma hyorhinis, Mycoplasma hyopneumoniae, Actinobacillus pleuropneumoniae, Haemophilus parasuis, Streptococcus suis, Pasteurella multocida, porcine blue ear virus, swine influenza virus, porcine circovirus type 2 and pseudorabies virus as templates, and enzyme-free water as a negative control, amplification was performed according to the RAA amplification system and reaction conditions in Example 2 to obtain RAA amplification products.

[0104] 2. Specific detection of Mycoplasma hyorhinis by fluorescence method

[0105] The RAA amplification product in step 1 was used as a template, and the reaction was carried out according to the final system and reaction conditions for fluorescence detection of Mycoplasma hyorhinis in Example 4, and the results were analyzed using GraphPad Prism v.8.1.2.

[0106] Results: Figure 8 As shown, the fluorescence value of Mycoplasma hyorhinis was significantly different from that of other pathogens and negative control (NC) (P<0.001), and the specificity of this method was good.

[0107] 3. Specific detection of Mycoplasma hyorhinis by test strip method

[0108] Using the RAA product in step 1 as a template, the reaction was carried out according to the reaction system and reaction conditions of the test strip method in Example 5, the reaction product was dripped onto the sample loading area of ​​the test strip, and the test strip result was observed within two minutes.

[0109] Results: Fig. 9 As shown, only the test strip of Mycoplasma hyorhinis showed a detection line band, while the strips of other pathogens and the negative control (NC) only showed a control line, all of which showed that the method had good specificity.

[0110] Example 8. Sample detection based on RAA CRISPR / Cas13a detection method for Mycoplasma hyorhinis

[0111] 1. RAA amplification

[0112] According to the RAA amplification system and reaction conditions in Example 2, 15 clinical samples (numbered 1-15) were amplified to obtain amplified products.

[0113] 2. Two methods based on RAA CRISPR / Cas13a for detecting Mycoplasma hyorhinis were used to react the 15 amplified products mentioned above

[0114] The RAA product in step 1 was used as a template, and the reaction was carried out according to the final system and reaction conditions for fluorescence detection of Mycoplasma hyorhinis in Example 4, and the results were analyzed using GraphPad Prism v.8.1.2.

[0115] Using the RAA product in step 1 as a template, the reaction was carried out according to the reaction system and reaction conditions of the test strip method in Example 5, the reaction product was dripped onto the sample loading area of ​​the test strip, and the test strip result was observed within two minutes.

[0116] Results: As shown in Table 9, the fluorescence method and the test strip method detected 10 consistent positive samples among the 15 clinical samples, and the positive rate was 66.70%.

[0117] 3. Testing the same batch of samples using nested PCR for Mycoplasma hyorhinis

[0118] In order to verify the accuracy of this method, the same batch of samples were tested using nested PCR in the literature. The primer information of this method is shown in Table 8.

[0119] Table 8 Nested PCR primer information

[0120]

[0121] Results: The test results are shown in Table 9, and the positive rate is 53.30%, which shows that the method established by the present invention is completely consistent with the method results in the literature used, which shows that the present invention has reliability and accuracy.

[0122] The 15 samples tested were unknown samples, and the positive samples detected by nested PCR were also detected by the method of the present invention. Therefore, it is shown that the results of the Mycoplasma hyorhinis detection method based on RAA-CRISPR / Cas13a are completely consistent with those of the nested PCR method in the literature. However, the method of the present invention can also detect samples with lower bacterial loads. The present invention can detect 100% of the positive samples.

[0123] Table 9 Clinical sample testing

[0124]

Claims

1. A RAA primer pair for detecting Mycoplasma hyorhinis, characterized in that: The RAA primer pair includes a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown in SEQ ID NO.15, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.

16.

2. A kit for detecting Mycoplasma hyorhinis, characterized in that: The kit includes a RAA isothermal amplification system and a CRISPR / Cas13a detection system; The RAA isothermal amplification system comprises the RAA primer pair according to claim 1, reaction dry powder, A Buffer, B Buffer, enzyme-free water and a positive standard plasmid; The CRISPR / Cas13a detection system includes crRNA and ssRNA, and the nucleotide sequence of the crRNA is shown in SEQ ID NO.

22.

3. The kit according to claim 2, characterized in that The ssRNA is ROX-BHQ1 or FAM-biotin.

4. The kit according to claim 2, characterized in that The CRISPR / Cas13a detection system also includes LwaCas13a protein, 10×HOLMES Buffer 2, T7 RNA Polymerase, rNTP Mix and RNase inhibitor Murine.

5. The kit according to claim 4, characterized in that The concentration of LwCas13a was 40 nM.

6. The kit according to claim 2, characterized in that The concentration of crRNA was 300 nM.

7. The kit according to claim 2, characterized in that The concentration of ssRNA was 400 nM.

8. A method for detecting Mycoplasma hyorhinis for non-therapeutic and non-diagnostic purposes, characterized in that: The specific steps of the method described are as follows: Step 1: Extract the DNA of the sample to be tested as a RAA reaction template and prepare the RAA detection system; Step 2: Prepare the CRISPR / cas13a reaction system, using the RAA product as the template; Step 3: Place the prepared CRISPR / cas13a detection system into a multifunctional microplate reader, react at 37°C for 30 cycles, and collect the fluorescence signal every 1 minute; or place the detection system in a 37°C constant temperature water bath and incubate for 30 minutes, then drop the incubated reaction product onto the sample area of ​​the test strip and observe the result within two minutes.

9. A RAA-CRISPR / Cas13a visual detection system for Mycoplasma hyorhinis, characterized in that: The system comprises the RAA primer pair of claim 1 or the detection kit of any one of claims 2-7.

10. Use of the gene shown in SEQ ID NO.3 as a marker for detecting Mycoplasma hyorhinis.

Images