SNP (Single Nucleotide Polymorphism) molecular marker related to watermelon clausena lansium character and application of SNP molecular marker

Abstract

The invention belongs to the field of molecular biology, and discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to watermelon clausena lansium traits as well as a primer, a kit, application and a method for identifying the related traits, the primer of the SNP marker for identifying the watermelon clausena lansium traits comprises a forward primer F and a reverse primer R; the nucleotide sequences of the forward primer F and the reverse primer R are shown as'primer sequences'. The primer of the SNP marker for watermelon clausena lansium character identification can rapidly identify watermelon clausena lansium characters in the seedling stage, and can effectively solve the problems of low phenotypic identification result reliability, time consumption, high cost, high difficulty and the like.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology and discloses a SNP molecular marker related to the yellow skin trait of watermelon, as well as primers, a kit, an application and a method for identifying the related trait. Background Art

[0002] Fruit peel color is primarily determined by the content and ratio of chlorophyll, carotenoids, and flavonoids. Genes associated with peel color regulate the synthesis of chlorophyll and carotenoids. Chlorophyll synthesis and chloroplast development are the primary factors influencing the yellow-white peel formation of cucurbit crops such as watermelon, cantaloupe, melon, gourd, wax gourd, and zucchini. Magnesium chelatase is a key enzyme in chlorophyll biosynthesis. This enzyme is composed of three subunits: CHLI, CHLD, and CHLH. Mutations in the genes encoding any of these subunits can affect enzyme activity, leading to impaired chlorophyll synthesis and poor chloroplast development. The CHLH subunit is considered the most important component of magnesium chelatase, and chlorosis in various crops is primarily caused by functional mutations in CHLH.

[0003] Watermelon (Citrullus lanatus) is an important economic crop in the Cucurbitaceae family. Rind color is a key agronomic trait and a crucial factor influencing its appearance, quality, and marketability. Breeding watermelons with different rind colors can enrich watermelon phenotypic diversity and meet the needs of diverse consumers. Yellow-rind watermelons, with their novel appearance, significantly enhance consumer purchasing power and enhance their market value. Therefore, breeding high-quality yellow-rind watermelon varieties is key to meeting diverse market demands. Traditional hybrid breeding methods rely on natural mutations, which can lead to blind selection and a long breeding process. Furthermore, due to gene linkage effects, breeding for yellow-rind traits can introduce undesirable traits or lose desirable agronomic traits, limiting the efficiency of yellow-rind watermelon breeding. Therefore, identifying yellow-rind genes and developing molecular markers closely linked to these genes could provide a technical means for rapidly screening and identifying yellow-rind germplasm resources at the seedling stage and accelerating the development of new, superior yellow-rind varieties. Summary of the Invention

[0004] In order to solve the above problems, the present invention discloses a SNP molecular marker related to the yellow skin trait of watermelon and application thereof.

[0005] The present invention is achieved through the following technical solutions:.

[0006] A SNP molecular marker associated with the yellow skin trait of watermelon is located at nucleotide position 290974 on chromosome 4 of the watermelon reference genome ('97103v2' version) and has an A / G polymorphism.

[0007] Furthermore, the above-mentioned SNP molecular marker identifies the watermelon skin color based on the genotype of the site: when the genotype is AA, the watermelon has a green skin; when the genotype is GG or GA, the watermelon has a yellow skin.

[0008] The present invention also discloses a primer pair for detecting the SNP molecular marker according to claim 1 or 2, which consists of a forward primer shown in SEQ ID NO: 1 and a reverse primer shown in SEQ ID NO: 2 in the sequence listing;

[0009] The SEQ ID NO: 1 is: 5'-GGGACTTACCGCTTGTGC-3';

[0010] The SEQ ID NO: 2 is: 5'-GCGAACTGGGTCATCAGG-3'.

[0011] The present invention also discloses a kit for detecting the SNP molecular marker, comprising the primer pair.

[0012] Furthermore, the above-mentioned kit further comprises at least one of a PCR reaction buffer, a dNTPs mixture, and a Taq DNA polymerase.

[0013] The present invention also discloses the use of the SNP molecular marker, primer pair or the kit described in any one of claims 4 to 5 in molecular detection of yellow skin traits in watermelon seedlings.

[0014] The present invention also discloses a method for detecting the yellow skin trait of watermelon using the primer pair, comprising the following steps:

[0015] (a) extracting genomic DNA from the watermelon plants to be tested;

[0016] (b) using the DNA as a template and performing PCR amplification using the primer pair of claim 3;

[0017] (c) Detect the genotype of the SNP site in the amplified product.

[0018] Furthermore, in the above method, step (c) detects the genotype by Sanger sequencing; the sequencing results are analyzed, and the A / G polymorphism at the 143rd site of the forward amplification of the sequencing sequence is judged to be three genotypes of AA, GG and GA based on the SNP polymorphism at this site. The genotype is used to determine whether the watermelon has a yellow skin: the AA genotype is a green-skinned watermelon, the GG genotype is a yellow-skinned watermelon, and the GA genotype is a yellow-skinned watermelon (yellow skin is a dominant trait controlled by a single gene).

[0019] The present invention also discloses a method for identifying the yellow skin trait of watermelon at the seedling stage, comprising:

[0020] (i) performing SNP typing on the watermelon sample using the above-mentioned kit;

[0021] (ii) Determine the skin color based on the typing results: if the SNP site genotype is AA, it is identified as a green-skin watermelon; if it is GG or GA, it is identified as a yellow-skin watermelon.

[0022] Furthermore, in the above identification method, the identification is completed from the cotyledon stage to the two-leaf and one-heart stage of the watermelon.

[0023] SNP markers generally have only two alleles, making it relatively easy to distinguish between homozygous and heterozygous genotypes. They have the advantages of being abundant, densely distributed, and rapidly detected. In recent years, the development of high-throughput sequencing technology has made the development of SNP markers much simpler. This invention utilizes high-throughput sequencing technology in conjunction with linkage analysis methods such as map-based cloning to develop SNP markers that are tightly linked to the yellow peel trait in watermelon. This allows for the precise identification of the yellow peel gene at the seedling stage, which is believed to accelerate the progress of directed genetic breeding for yellow peel-related traits in watermelon.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] (1) A molecular marker (YR-SNP5) tightly linked to the yellow rind trait in watermelon was obtained through screening, laying the foundation for molecular marker-assisted breeding and gene cloning. Using the molecular marker tightly linked to the yellow rind trait of watermelon, the watermelon yellow rind gene was identified, and the selection efficiency was 100% in a sample of 891 individual plants.

[0026] (2) The gene loci located by the molecular markers of the present invention are precise and easy to identify. Because this marker is tightly linked to the watermelon yellow peel gene, the above-mentioned molecular marker method can be used to determine the plant phenotype at the seedling stage, effectively solving the problems of low reliability, time-consuming, high cost, and difficulty in phenotypic identification, making it simple and rapid.

[0027] (3) The molecular markers provided by the present invention can be widely used in the molecular detection of yellow peel genes in molecular-assisted breeding, thereby realizing the industrialization of molecular breeding of genes. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is a phenotypic comparison of the yellow-skinned watermelon female material W-21-4-2, the green-skinned watermelon male material W-21-301, and their hybrid F1 generation plants;

[0029] Figure 2 This is a partial peak diagram of the sequencing results of the sequence amplified by primer YR-SNP5. The arrows in the figure indicate the 143rd nucleotide position of its forward amplification, which is the AA genotype, GA genotype, and GG genotype;

[0030] Figure 3The primer YR-SNP5 provided by the present invention was used to identify 16 watermelon inbred line materials. DETAILED DESCRIPTION

[0031] The present invention will be further described below with reference to the accompanying drawings and examples, and the contents of the examples are not intended to limit the scope of protection of the present invention.

[0032] Example 1

[0033] Obtaining Primers for Linked Molecular Markers for the Yellow Rind Trait in Watermelon

[0034] (1) Acquisition and genetic analysis of the yellow skin trait in watermelon

[0035] This experiment used three advanced watermelon inbred lines: W-21-4-2, W-21-301, and W-21-129. W-21-4-2 exhibits a yellow-green ovary (fruit) peel. After pollination, the peel gradually changes from yellow-green to yellow. In the young fruit stage, the fruit skin is completely yellow, with no streaks, and the flesh is red. The fruit is oval in shape. The petioles, veins, and stems of W-21-4-2 also exhibit a yellow phenotype. W-21-301 maintains a green peel with fine light streaks throughout its growth period, with red flesh and a tall, rounded shape. The petioles, veins, and stems of W-21-129 maintain a green peel with fine light streaks throughout its growth period, red flesh, and an oblong shape with fine light streaks. The petioles, veins, and stems of W-21-129 maintain a green peel with fine light streaks throughout its growth period, red flesh, and an oblong shape with fine light streaks. The petioles, veins, and stems of W-21-129 maintain a green peel with fine light streaks throughout its growth period, red flesh, and an oblong shape with fine light streaks. W-21-4-2 was used as the female parent and hybridized with W-21-301 and W-21-129 as the male parents, respectively, to obtain F1 plants. After self-pollination, W-21-4-2 × W-21-301 and W-21-4-2 × W-21-129 F2 segregating populations were obtained. Both F1 plants exhibited yellow bark, indicating that yellow bark is a dominant trait. In the W-21-4-2×W-21-301 F2 segregating population, 659 plants exhibited yellow skin and 232 plants exhibited green skin. In the W-21-4-2×W-21-129 F2 segregating population, 206 plants exhibited yellow skin and 78 plants exhibited green skin. Genetic analysis showed that in both the W-21-4-2×W-21-301 and W-21-4-2×W-21-129 F2 segregating populations, the chi-square test indicated a 3:1 segregation ratio for yellow skin to green skin, consistent with Mendelian inheritance. In conclusion, yellow skin is considered a dominant quality trait.

[0036] (2) Extraction of watermelon genomic DNA

[0037] Total DNA from leaves of parents, F1 and all F2 segregating populations was extracted using the conventional CTAB method.

[0038] (3) Preliminary localization of watermelon yellow peel genes using the BSA-seq method

[0039] Using the body separation assay (BSA), 30 individuals with extreme yellow skin and 30 individuals with extreme green skin were randomly selected from the W-21-4-2×W-21-301 and W-21-4-2×W-21-129 F2 segregating populations, respectively, to establish the yellow skin pool (YR-pool) and the green skin pool (GR-pool). High-throughput sequencing was performed using an Illumina HiSeq 4000 (Novogene, Beijing, China). After removing low-quality sequencing reads, the SNP index (ΔSNP-index) was calculated for both populations using a sliding window analysis with a 1MB window size and 1Kb increments. A larger ΔSNP-index indicates a greater likelihood of linkage to the trait. A 60% confidence interval threshold was also established; differences exceeding this threshold were considered significant and identified as candidate regions. Combining the SNP-index curves with the chi-square distribution results, we identified a potential candidate region as the 0-4.5Mb region on chromosome 4 of watermelon.

[0040] (4) Fine mapping of candidate genes and development of linkage markers

[0041] Use W-21-4-2×W-21-301F 2:3 The family was finely mapped. First, the whole genome of both parents was resequenced. The sequencing data was analyzed, and Indel and SNP differences were found in the initial positioning area. The sequences on both sides of the differential sites were extracted. Primers were designed using the primer design software Premier 5.0. PCR amplification was performed between the two parents. Indel markers were detected by electrophoresis using 6% denaturing polyacrylamide gel, and SNP markers were detected by first-generation Sanger sequencing for polymorphism detection. Among them, 11 pairs of primers were polymorphic (6 pairs of Indel markers and 5 pairs of SNP markers). The F containing 1345 individual plants was used. 2:3The family further screened 11 pairs of polymorphic primers to identify differences between the marker genotype and the trait phenotype, and obtained exchange plants with the yellow skin gene YR. The polymorphic markers on both sides of the gene shifted in the direction of gradually decreasing exchange plants, narrowing the target segment to between primers YR-SNP-4 and YR-Indel-6, while the number of recombinant plants with marker YR-SNP5 was zero. The results of the Indel markers were combined with plant phenotypes using JoinMap 4.0 software. The results showed that the yellow skin gene YR and the marker YR-SNP5 co-segregated, indicating that the yellow skin trait of watermelon is closely linked to the YR-SNP5 marker. The site of the SNP marker is at nucleotide position 290974 on chromosome 4 of the reference sequence of the watermelon '97103v2' genome version, with an A / G polymorphism. The primers for this SNP marker consist of forward primer F and reverse primer R. The nucleotide sequence is shown in the "amplified sequence fragment";

[0042] Amplified sequence fragment = SEQ ID No. 3 =

[0043] CTGTTCTTTAGTTTCCCTCCTGATAAGGGAAATGTTGGAACTGCT

[0044] GCATATTTGAATGTCTTCTCATCCATCTTCTCTGTCTTAAAAGA

[0045] CCTAAAAAAGGACGGATATAATGTTGAAGGCCTTCCCGAAACTTCTGAAGCTTTA(G)ATTGAAGATGTTATTCATGACAAAGAGGC GCAATTCAACAGCCCCAATCTCAACATTGCATATAAAATGAATGTTCGTGAATACCAACAATTAACACCTTATTCCACAGCATTGGAAGAGAATTGGGGAAAACCTCCTGGTAATTTGAACTCTGATGGAGAGAATCTGCTGGTGTATGGAAAGCAATATGGAAATGTCTTTCATTGGTGTTCA ACCAACATTCGGATATGAGGGTGATCCGATGAGACTTCTCTTCTCTAAATCTGCTAGCCCCCATCATGGTTTTGCAGCATATTACTCGTATGTTGAGAATATCTTCAAGGCTGATGCAGTTCTTCACTTTGGAACTCATGGTTCACTTGAATTTATGCCCGGAAAGCAAGTCGGAATGAGTG.

[0046] Example 2

[0047] Application of SNP-marked primers in identification of yellow rind traits in watermelon

[0048] The marker primer YR-SNP5 of the present invention was used to perform PCR amplification and sequencing detection in the F1 and F2 population materials of the yellow-skinned female parent W-21-4-2 and the green-skinned male parent W-21-301, and the phenotypic identification method was used as a control.

[0049] Method, to investigate the accuracy of the primers provided by the present invention for identifying the yellow skin trait of watermelon. The specific method is as follows:

[0050] (1) Extract the genomic DNA of the watermelon to be tested.

[0051] (2) adding the primers of the present invention to a PCR reaction system, and performing PCR amplification on the watermelon genomic DNA;

[0052] The PCR amplification reaction system is as follows: The total system of the PCR amplification reaction is 25 μL, including: 2×Hieff Add 12.5 μL of PCR Master Mix, 9.5 μL of ddH₂O, 1 μL each of forward and reverse primers, and 1.0 μL of DNA. The reaction procedure is: 98°C pre-denaturation for 3 min; 35 cycles of 98°C denaturation for 10 s, 58°C annealing for 20 s, and 72°C extension for 30 s; 72°C extension for 5 min, and storage at 4°C. Primer pairs are as follows:

[0053] Forward primer F: 5'GGGACTTACCGCTTGTGC 3'

[0054] Reverse primer R: 5'GCGAACTGGGTCATCAGG 3'

[0055] (3) The amplified product was subjected to first-generation Sanger sequencing and the sequencing results were analyzed. The amplified sequence was shown in SEQ ID NO. 3. The total amplified length of the marker was 540 bp. There was an A / G polymorphism at the 143rd position of the forward amplification of the sequencing sequence. Based on the SNP polymorphism at this position, the genotypes of the sequenced individual strains were interpreted as AA, GG, and GA. Figure 2 This is a partial peak diagram of the amplified sequence sequencing results. The arrows in the figure indicate the different genotypes of the 143rd nucleotide position in the forward amplification, which are GA, AA, and GG from top to bottom. The specific identification results are shown in Table 1.

[0056] Table 1 Results of yellow skin trait identification using the SNP marker primers of the present invention on 801 watermelon samples

[0057]

[0058] As shown in Table 1, all plants with the GG genotype had a yellow skin phenotype, all plants with the AA genotype had a green phenotype, and all plants with the GA genotype had a yellow skin phenotype (yellow skin is a dominant trait controlled by a single gene). The accuracy of the identification results was 100%, indicating that the SNP-marked primers provided by the present invention can be used to identify the yellow skin trait in watermelon.

[0059] Example 3

[0060] 16 watermelon inbred line materials with known peel color were selected, and PCR amplification and sequencing detection was performed on the yellow peel female material W-21-4-2 and the green peel male material W-21-301 to identify their genotypes and investigate the accuracy of the primers provided by the present invention for identifying the yellow peel trait of watermelon. The specific detection method is the same as in Example 2, and the detection results are shown in FIG. Figure 3 .

[0061] Depend on Figure 3 The results show that among the 16 watermelon inbred line materials, 8 are consistent with the genotype of the yellow-skinned maternal material W-21-4-2, and the 143rd base of the amplified products is GG; 8 materials are consistent with the genotype of the green-skinned maternal material W-21-301, and the 143rd base of the amplified products is AA, indicating that the SNP-marked primers provided by the present invention can distinguish materials with yellow-skin phenotype from materials with green-skin phenotype.

[0062] The results of the above examples show that the SNP marker primers for identifying the yellow skin trait of watermelon provided by the present invention not only have accurate identification results, but are also simple and efficient, and can be used for identifying the yellow skin trait of watermelon.

[0063] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention.

[0064] Rather than all embodiments, people can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

[0065] The above embodiments of the present invention are merely examples for the purpose of clearly illustrating the present invention and are not intended to limit the embodiments of the present invention. Those skilled in the art will appreciate that other variations or modifications based on the above description are possible. It is not possible to enumerate all embodiments here. Any obvious variations or modifications arising from the technical solutions of the present invention remain within the scope of protection of the present invention.

Claims

1. A SNP molecular marker associated with the yellow skin trait of watermelon, characterized in that: The molecular marker is located at the 290974th nucleotide position of chromosome 4 of the watermelon reference genome ('97103v2' version) and has an A / G polymorphism.

2. The SNP molecular marker according to claim 1, characterized in that The genotype of this site is used to identify the watermelon skin color: when the genotype is AA, the watermelon has a green skin; when the genotype is GG or GA, the watermelon has a yellow skin.

3. A primer pair for detecting the SNP molecular marker according to claim 1 or 2, characterized in that: It consists of a forward primer shown in SEQ ID NO: 1 and a reverse primer shown in SEQ ID NO: 2 in the sequence listing; The SEQ ID NO: 1 is: 5'-GGGACTTACCGCTTGTGC-3'; The SEQ ID NO: 2 is: 5'-GCGAACTGGGTCATCAGG-3'.

4. A kit for detecting the SNP molecular marker according to claim 1 or 2, characterized in that: Comprising the primer pair according to claim 3.

5. The kit according to claim 4, characterized in that It also contains at least one of a PCR reaction buffer, a dNTPs mixture, and a Taq DNA polymerase.

6. Use of the SNP molecular marker according to claim 1 or 2, the primer pair according to claim 3, or the kit according to any one of claims 4 to 5 in molecular detection of yellow skin traits in watermelon seedlings.

7. A method for detecting the yellow peel trait of watermelon using the primer pair according to claim 3, characterized in that: The following steps are involved: (a) extracting genomic DNA from the watermelon plants to be tested; (b) using the DNA as a template and performing PCR amplification using the primer pair of claim 3; (c) detecting the genotype of the SNP site according to claim 1 in the amplified product.

8. The method according to claim 7, characterized in that In the step (c), the genotype is detected by Sanger sequencing.

9. A method for identifying the yellow skin trait of watermelon at the seedling stage, characterized in that: include: (i) performing SNP typing on the watermelon sample to be tested using the kit according to claim 4 or 5; (ii) Determine the skin color based on the typing results: if the SNP site genotype is AA, it is identified as a green-skin watermelon; if it is GG or GA, it is identified as a yellow-skin watermelon.

10. The method according to claim 9, characterized in that The identification is completed from the cotyledon stage to the two-leaf and one-heart stage of the watermelon.

Images