KASP molecular markers related to beige and yellow pigment content in millet and their applications
By developing a KASP primer set and kit for detecting deoxyribonucleic acid at position 50552775 on chromosome 3 of the millet genome, the problem of seedling identification of millet rice color and yellow pigment content was solved, enabling rapid and accurate breeding-assisted selection, shortening the breeding cycle and improving breeding efficiency.
Patent Information
- Application Number
- CN202510122711.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-26
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2045-01-26
AI Technical Summary
In existing technologies, the identification of millet beige and yellow pigment content needs to be carried out after mature harvest, resulting in a long breeding cycle and complex identification. In particular, the identification time point for beige traits is limited, making it difficult to meet breeding needs.
A KASP primer set and kit were developed to detect the genotype of deoxyribonucleic acid at position 50552775 on chromosome 3 of the millet genome. Through PCR amplification and fluorescence signal scanning, the color and yellow pigment content of millet rice can be rapidly identified at the seedling stage. This provides new applications for the KASP primer set and kit, including identifying or assisting in the identification of color and yellow pigment content of millet rice, screening for yellow or white millet, and assisting in breeding.
It enables rapid and accurate identification of millet color and yellow pigment content during the seedling stage, shortens the breeding cycle, improves breeding efficiency, provides more selection time points, and significantly accelerates the process of millet quality breeding.
Smart Images

Figure GDA0005606999120000041 
Figure GDA0005606999120000051 
Figure GDA0005606999120000061
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and particularly relates to KASP molecular markers related to the millet rice color and yellow pigment content and their applications. Background Art
[0002] Millet (Setaria italica Beauv.) belongs to the Panicoideae subfamily of the Poaceae family, anciently known as "millet", and becomes millet after hulling. It began to be domesticated in northern China about ten thousand years ago and has a long cultivation history. Millet has strong tolerance to abiotic stresses, especially drought and infertile soils, and is an important food crop and the local staple food crop in the dry farming areas of China; at the same time, millet is considered a health-care nutritional food because it is rich in nutrients such as protein, fat, dietary fiber, vitamins, calcium, iron, and zinc, and its consumption is increasing rapidly.
[0003] The quality of millet is determined by internal and external attributes such as appearance, taste, and flavor, among which the appearance quality is the most intuitive index for consumers to evaluate. The rice color of millet is an extremely important index of appearance quality. The vast majority of millet turns into yellow millet after hulling, and the difference in yellow pigment content is the main reason for the different shades of yellow of millet. Research shows that the yellow pigment components of millet are mainly carotenoids such as lutein, zeaxanthin, and a small amount of β-carotene. The germplasm resources of millet are very rich, and the rice color shows various manifestations. According to the analysis results of the rice color of 2562 millet varieties, in addition to the yellow millet with the highest proportion, there are also white millet, green millet, red millet, gray millet, black millet, etc., among which white millet accounts for 3.7%. The yellow pigment content of white millet is generally lower than 10 mg / kg, and the overall rice color is milky white due to the low yellow pigment content, similar to the color of rice, and it is a type welcomed by consumers other than yellow millet. With the improvement of people's living standards and the increase in the demand for diverse appearances, white millet occupies a certain position in the market due to its unique rice color appearance and has received increasing attention.
[0004] Currently, most white millet varieties are local breeds, such as "Niumaobai," "Leshan Bainuo," and "Baiyuxianggu." Generally, these varieties have poor agronomic traits. Breeders typically cross them with another variety possessing superior agronomic traits to obtain white millet varieties with excellent agronomic characteristics. However, this traditional breeding method suffers from problems such as long breeding cycles and complex identification processes. Especially for the rice color trait, phenotypic identification and trait selection can only be conducted after maturity and harvest, resulting in a long identification cycle and limited timeframes. Molecular marker breeding, also known as marker-assisted selection (MAS), utilizes molecular markers closely linked to the target gene to accurately identify the genotypes of different individuals in the hybrid offspring, thereby assisted in selection breeding. For millet rice color, using molecular markers related to the rice color trait for identification in the field during the seedling stage can greatly facilitate breeding operations, shorten the breeding cycle, and accelerate the breeding process. Summary of the Invention
[0005] The technical problem to be solved by this invention is how to identify the content of millet color and yellow pigment.
[0006] To address the aforementioned technical problems, this invention provides a novel use for a substance that detects the genotype of the deoxyribonucleotide at position 50552775 on chromosome 3 of the millet genome.
[0007] This invention provides the application of a substance for detecting the genotype of deoxyribonucleotide at position 50552775 on chromosome 3 of the millet genome in the identification or auxiliary identification of millet color.
[0008] This invention also provides the application of a substance for detecting the genotype of deoxyribonucleotide at position 50552775 on chromosome 3 of the millet genome in the preparation of products for identifying or assisting in the identification of millet rice color.
[0009] This invention also provides the application of a substance for detecting the genotype of deoxyribonucleotide at position 50552775 on chromosome 3 of the millet genome in identifying or assisting in the identification of millet yellow pigment content.
[0010] This invention also provides the application of a substance for detecting the genotype of deoxyribonucleotide at position 50552775 on chromosome 3 of the millet genome in the preparation of products for identifying or assisting in the identification of millet yellow pigment content.
[0011] This invention also provides the application of a substance for detecting the genotype of deoxyribonucleic acid at position 50552775 on chromosome 3 of the millet genome in screening or assisting in the screening of yellow or white millet.
[0012] This invention also provides the application of a substance for detecting the genotype of deoxyribonucleotide at position 50552775 on chromosome 3 of the millet genome in the preparation of products for screening or assisting in the screening of yellow or white millet.
[0013] This invention also provides the application of a substance for detecting the genotype of deoxyribonucleic acid at position 50552775 on chromosome 3 of the millet genome in millet breeding;
[0014] This invention also provides the application of a substance for detecting the genotype of deoxyribonucleotide at position 50552775 on chromosome 3 of the millet genome in the preparation of millet breeding products.
[0015] In the above application, the substance used to detect the genotype of deoxyribonucleotide at position 50552775 on chromosome 3 of the millet genome is the KASP primer set; the KASP primer set consists of forward primer F1, forward primer F2 and reverse primer R;
[0016] The forward primer F1 is either a1) or a2) as follows:
[0017] a1) The single-stranded DNA molecule shown in sequence 1;
[0018] a2) A single-stranded DNA molecule that has undergone substitution and / or deletion and / or addition of one or more nucleotides of sequence 1 and has the same function as sequence 1;
[0019] The forward primer F2 is either a3) or a4):
[0020] a3) The single-stranded DNA molecule shown in sequence 2;
[0021] a4) A single-stranded DNA molecule that has undergone substitution and / or deletion and / or addition of one or more nucleotides of sequence 2 and has the same function as sequence 2;
[0022] The reverse primer R is either a5) or a6):
[0023] a5) The single-stranded DNA molecule shown in sequence 3;
[0024] a6) A single-stranded DNA molecule with one or more nucleotide substitutions and / or deletions and / or additions to sequence 3 that has the same function as sequence 3.
[0025] To address the aforementioned technical problems, this invention provides a KASP primer set for identifying the content of millet color and yellow pigment.
[0026] The KASP primer set provided by this invention for identifying the content of millet color and yellow pigment consists of the above-mentioned forward primer F1, the above-mentioned forward primer F2 and the above-mentioned reverse primer R;
[0027] In the above KASP primer set, the molar ratio of the forward primer F1, the forward primer F2, and the reverse primer R is 2:2:5.
[0028] To address the aforementioned technical problems, the present invention also provides a kit for identifying the content of millet color and yellow pigment.
[0029] The kit provided by this invention for identifying the content of millet color and yellow pigment contains the above-mentioned KASP primer set.
[0030] Furthermore, the kit also includes DNA extraction reagents (such as reagents required for DNA extraction using the CTAB method) and other reagents for PCR amplification (such as HiGeno 2×Probe MixA).
[0031] Furthermore, the kit also includes a negative control (such as sterile ultrapure water).
[0032] To address the aforementioned technical problems, this invention also provides new uses for the aforementioned KASP primer set or the aforementioned kit.
[0033] This invention provides the application of the above-described KASP primer set or the above-described kit in any one of the following (X1)-X8):
[0034] X1) Identify or assist in identifying the color of millet grains;
[0035] X2) Identification or auxiliary identification of millet yellow pigment content;
[0036] X3) Screening or assisting in the screening of yellow millet or white millet;
[0037] X4) Millet breeding;
[0038] X5) Prepare products for identification or auxiliary identification of millet color;
[0039] X6) Prepare products for identification or auxiliary identification of millet yellow pigment content;
[0040] X7) Prepare products for screening or auxiliary screening of yellow or white millet;
[0041] X8) is used to prepare millet breeding products.
[0042] To solve the above-mentioned technical problems, the present invention finally provides any one of the following methods (Y1)-Y5):
[0043] Y1) A method for identifying or assisting in the identification of millet color, the method comprising the following steps: detecting whether the genotype of the deoxyribonucleotide at position 50552775 on chromosome 3 of the millet genome is CC or TT, and determining whether the millet is yellow millet or white millet based on the genotype: if the genotype of the millet is TT, then the millet is yellow millet; if the genotype of the millet is CC, then the millet is white millet.
[0044] Y2) A method for identifying or assisting in the identification of yellow pigment content in millet, the method comprising the following steps: detecting whether the genotype of the deoxyribonucleotide at position 50552775 on chromosome 3 of the millet genome to be tested is CC or TT, and determining its yellow pigment content based on the genotype of the millet to be tested: the yellow pigment content of TT genotype millet is higher than that of CC genotype millet;
[0045] Y3) A method for screening or assisting in the screening of yellow millet, including the step of selecting millet varieties with the TT genotype;
[0046] Y4) A method for screening or assisting in screening white millet, including the step of selecting millet varieties with the CC genotype;
[0047] Y5) A method for breeding millet, comprising the step of using yellow or white millet selected according to the method described in Y3) or Y4) as breeding material for breeding.
[0048] The method described above for detecting whether the genotype of the deoxyribonucleic acid at position 50552775 on chromosome 3 of the millet genome is CC or TT includes the following steps: using the genomic DNA of the millet to be tested as a template, performing PCR amplification using the above-mentioned primer set, scanning the obtained amplification product for fluorescence signals, and determining whether the genotype of the millet to be tested is CC or TT based on the fluorescence signals.
[0049] In some embodiments, the PCR amplification reaction system is as follows: 0.07 μL mixed primer solution, 2.5 μL DNA, 2.5 μL HiGeno 2×Probe Mix A. The mixed primer solution consists of 12 μL of 100 μM forward primer F1, 12 μL of 100 μM forward primer F2, 30 μL of 100 μM reverse primer R, and 46 μL ddH2O.
[0050] In some implementations, the PCR amplification reaction program is as follows: 95℃ for 10 min; 95℃ for 30 s, 65-55℃ for 25 s, 10 cycles (Touchdown reaction program decreases by 1.0℃ per cycle); 95℃ for 30 s, 55℃ for 30 s, 35 cycles.
[0051] In some implementations, the fluorescence signal scanning is performed in an ELISA reader, and the genotyping results are displayed using SNPviewer software: if only the fluorescence signal of the FAM gene (blue) is displayed, the genotype of the millet to be tested is TT; if only the fluorescence signal of the HEX gene (red) is displayed, the genotype of the millet to be tested is CC.
[0052] The TT genotype mentioned above is a homozygous individual whose deoxyribonucleotide at position 50552775 on chromosome 3 of the millet genome is T.
[0053] The CC genotype mentioned above is a homozygous individual whose deoxyribonucleotide at position 50552775 on chromosome 3 of the millet genome is C.
[0054] The reference genome version number for any of the above-mentioned millet genomes is Setaria italica v2.2.
[0055] The content of any of the yellow pigments mentioned above refers to the total content of lutein, zeaxanthin, and β-carotene.
[0056] The millet or the millet to be tested mentioned above can be any kind of millet germplasm resource, variety, strain or single plant, specifically any kind of millet material in Table 1 and / or Table 2.
[0057] This invention provides a SNP locus associated with the beige and yellow pigment content of millet, located at position 50552775 on chromosome 3 of the millet genome, with a polymorphism of T / C. Based on this SNP locus, this invention also developed the KASP molecular marker KY3 for identifying the beige and yellow pigment content of millet. Experiments have demonstrated that this molecular marker can effectively identify the beige and yellow pigment content of the tested millet. The SNP locus and molecular marker provided by this invention are highly practical in the selection of individual plants and identification of stable lines in the segregating generations of hybrid offspring during the breeding process of beige millet. It allows for the identification of the beige color of millet produced by millet varieties (individual plants and lines) at the seedling stage. Combined with other agronomic properties, it enables the selection of target types, providing breeders with more selection time points instead of waiting until harvest, significantly improving the efficiency of individual plant and line selection in breeding, and accelerating the quality breeding process of millet. Attached Figure Description
[0058] Figure 1 A bar chart showing the correlation between genotype and yellow pigment content phenotypes of 733 millet materials. Note: Gonggu No. 5 is a yellow millet type, and Niumaobai is a white millet type.
[0059] Figure 2Genotyping diagrams of KY3 markers for 88 millet samples. Note: Each dot corresponds to one sample; red dots indicate CC homozygous genotype, blue dots indicate TT homozygous genotype, green dots indicate CT heterozygous genotype, pink dots indicate no signal or weak signal, purple dots indicate indeterminate, and black dots indicate blank control.
[0060] Figure 3 A bar chart showing the association between genotype and yellow pigment content phenotypes in 88 millet samples. Detailed Implementation
[0061] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0062] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0063] The 733 foxtail millet samples (Table 1) and 88 foxtail millet samples (Table 2) in the following examples are all described in the literature “JiaG, Huang X, Zhi H, Zhao Y, Zhao Q, Li W, Chai Y, Yang L, Liu K, Lu H, Zhu C, Lu Y, Zhou C, Fan D, Weng Q, Guo Y, Huang T, Zhang L, Lu T, Feng Q, Hao H, Liu H, Lu P, Zhang N, Li Y, Guo E, Wang S, Wang S, Liu J, Zhang W, Chen G, Zhang B, Li W, Wang Y, Li H, Zhao B, Li J, Diao X, Han B. Ahaplotype map of genomic variations and genome-wide association studies of agronomic traits in foxtail millet (Setaria italica). Nat In Genet. 2013 Aug; 45(8): 957-61, the public can obtain the biological material from the applicant. The biological material is only for repeating the relevant experiments of the present invention and cannot be used for other purposes.
[0064] Example 1: Discovery of SNP markers related to the color and yellow pigment content of millet and development of KASP molecular markers. I. Discovery of SNP markers related to the color and yellow pigment content of millet.
[0065] Correlation analysis was performed on the deep resequencing results and yellow pigment content phenotypes of 733 millet materials (Table 1). Figure 1 Ultimately, a SNP locus associated with the color and yellow pigment content of millet was discovered. This locus is located at position 50552775 on chromosome 3 of the millet genome (Millet reference genome version: Setaria italica v2.2). The polymorphism at this locus is T / C, with two genotypes: TT and CC. The TT genotype is homozygous for the T deoxyribonucleotide at position 50552775 on chromosome 3 of the millet genome; the CC genotype is homozygous for the C deoxyribonucleotide at position 50552775 on chromosome 3 of the millet genome.
[0066] The results of genotyping and yellow pigment content detection for 733 millet materials are shown in Table 1 and... Figure 1 As shown, the results indicate that among the 733 millet materials, 704 materials were of the TT genotype, with all millet grains being yellow and an average yellow pigment content of 20.93 mg / kg; and 29 millet materials were of the CC genotype, with all millet grains being white and an average yellow pigment content of 3.23 mg / kg.
[0067] Table 1. Names, genotypes, and yellow pigment content of 733 millet samples.
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088] Note: "NA" indicates unknown source.
[0089] II. Development of the KASP molecular marker KY3 related to the content of millet color and yellow pigment.
[0090] Based on the SNP sites related to the color and yellow pigment content of millet rice identified in step one, a KASP molecular marker was designed to identify the color and yellow pigment content of millet rice. The final designed KASP molecular marker KY3 contains one universal primer Primer_COM and two competitive primers Primer_AlleleX and Primer_AlleleY. These two competitive primers carry FAM and HEX fluorescent groups, respectively. The primer sequences are as follows:
[0091] Primer_AlleleX:5'- GAAGGTGACCAAGTTCATGCT AAGGGAAACACAAGGGATTCTCGTA-3' (Sequence 1, the underlined sequence is the FAM fluorescent sequence);
[0092] Primer_AlleleY:5'- GAAGGTCGGAGTCAACGGATT GGGAAACACAAGGGATTCTCGTG-3' (Sequence 2, the underlined sequence is the HEX fluorescent sequence);
[0093] Primer_COM: 5'-CACTACCGCATTGCATCGCTGAT-3' (sequence 3).
[0094] Example 2: Validation of the KASP molecular marker KY3
[0095] Test materials: 88 millet materials in Table 2.
[0096] I. Genotyping
[0097] The genotype of the test materials was detected using the KASP molecular marker KY3 designed in Example 1. The specific steps are as follows: First, leaf samples of the test materials were taken at the seedling stage (14 days after germination). Then, genomic DNA (concentration greater than 50 ng / μL) was extracted from the leaf samples using the CTAB method. Then, using the genomic DNA as a template, PCR amplification was performed using the KASP molecular marker KY3 designed in Example 1.
[0098] The PCR amplification reaction system was as follows: 0.07 μL mixed primer solution, 2.5 μL DNA, and 2.5 μL HiGeno 2×Probe MixA (Beijing Jiacheng Biotechnology Co., Ltd.). The mixed primer solution consisted of 12 μL of 100 μM specific primer Primer_AlleleX, 12 μL of 100 μM specific primer Primer_AlleleY, 30 μL of 100 μM universal primer Primer_COM, and 46 μL ddH2O.
[0099] The PCR amplification reaction program is as follows: 95℃ for 10 min; 95℃ for 30 s, 65-55℃ for 25 s, 10 cycles (Touchdown reaction program decreases by 1.0℃ per cycle); 95℃ for 30 s, 55℃ for 30 s, 35 cycles.
[0100] PCR amplification was performed using a microplate reader for fluorescence scanning, and the genotyping results were displayed using SNPviewer software. If only the FAM gene showed a fluorescent signal (blue), the genotype of the tested material was TT; if only the HEX gene showed a fluorescent signal (red), the genotype of the tested material was CC.
[0101] The genotyping results of 88 millet materials are shown in Table 1 and 2. Figure 2 As shown in the figure. The results show that among the 88 samples, 74 samples were of the TT genotype (blue dots), 11 samples were of the CC genotype (red dots), 1 sample was of the CT heterozygous genotype (green dots), 1 sample had a weak signal (pink dots), and 1 sample could not be determined (purple dots).
[0102] Table 2. KY3 marker typing, yellow pigment content and beige phenotype of 88 millet samples
[0103]
[0104]
[0105]
[0106] Note: "?" indicates a weak signal, and "Uncallable" indicates that the signal cannot be determined.
[0107] II. Yellow pigment content detection
[0108] The content of yellow pigments (total content of lutein, zeaxanthin and β-carotene) in the grains of the tested millet materials was determined according to the method in the literature “Yang Yanbing, Zhang Han, Wang Runfeng, et al. Determination of yellow pigment content in millet grains [J]. Journal of Chinese Cereals and Oils, 2019, 34(03):121-125.”. The specific steps are as follows: 1. Prepare a 0.1 mg / mL β-carotene standard solution: Accurately weigh 5.0000 mg of β-carotene, put it into a 50 mL volumetric flask, add a small amount of chloroform to dissolve it, and then make up to volume with water-saturated n-butanol solution. 2. Prepare a β-carotene standard curve: Take 6 10 mL volumetric flasks, and add 0 μL, 100 μL, 200 μL, 300 μL, 400 μL and 500 μL of β-carotene standard solution to the 10 mL volumetric flasks respectively, and make up to volume with water-saturated n-butanol solution. Using a water-saturated n-butanol blank as a control, the absorbance was measured at 445 nm, repeated three times. A standard curve was plotted with β-carotene mass concentration (μg / mL) on the x-axis and absorbance A on the y-axis. 3. Sample determination: Weigh 1.0000g of millet powder into a 10mL centrifuge tube, add 5.0mL of water-saturated n-butanol, tighten the stopper, and mix on a vortex mixer to fully wet the sample. Place the centrifuge tube on a reciprocating shaker and extract for 3 hours, then let it stand for 10 minutes. Centrifuge at 10000×g for 8 minutes until the liquid is clear, collect the supernatant, and measure the absorbance at 445nm to calculate the yellow pigment content. A water-saturated n-butanol blank was used as a control.
[0109] The results of the detection of yellow pigment content in 88 millet samples are shown in Table 2.
[0110] III. Association Analysis between Genotype and Yellow Pigment Content
[0111] A correlation analysis was performed on the yellow pigment content of the TT and CC genotype test materials. The correlation analysis method is as follows: a two-t test was performed on the phenotypic characteristics of yellow pigment content of the materials separated by the KASP molecular marker KY3 using EXECL software to test whether the difference in yellow pigment content between the TT and CC genotypes was significant.
[0112] The results showed that among the 88 millet materials, the average yellow pigment content of 74 TT genotype millet materials was 23.05 mg / kg, and the beige color was yellow; the average yellow pigment content of 11 CC genotype millet materials was 3.72 mg / kg, and the beige color was white. The yellow pigment content of the TT genotype millet materials was significantly higher than that of the CC genotype millet materials. Figure 3 The above results indicate that this invention has successfully developed a KASP molecular marker based on the SNP site at position 50552775 on chromosome 3 of the millet genome, which can be used to identify the beige and yellow pigment content of millet. By using this KASP molecular marker to detect the genotype of the millet seedlings, the beige and yellow pigment content can be rapidly identified.
Claims
1. The application of substances that detect the genotype of deoxyribonucleotide at position 50552775 on chromosome 3 of the millet genome in the identification or auxiliary identification of millet color; Alternatively, the application of substances that detect the genotype of deoxyribonucleotide at position 50552775 on chromosome 3 of the millet genome in the preparation of products for identification or auxiliary identification of millet rice color; The reference version number of the millet genome is Setaria italica v2.
2.
2. Application of substances that detect the genotype of deoxyribonucleotide at position 50552775 on chromosome 3 of the millet genome in the identification or auxiliary identification of millet yellow pigment content; Alternatively, the application of substances that detect the genotype of deoxyribonucleotide at position 50552775 on chromosome 3 of the millet genome in the preparation of products for identification or auxiliary identification of millet yellow pigment content; The reference version number of the millet genome is Setaria italica v2.
2.
3. Application of substances that detect the genotype of deoxyribonucleic acid at position 50552775 on chromosome 3 of the millet genome in screening or assisting screening of yellow or white millet; Alternatively, the application of substances that detect the genotype of deoxyribonucleic acid at position 50552775 on chromosome 3 of the millet genome in the preparation of products for screening or assisting in the screening of yellow or white millet. The reference version number of the millet genome is Setaria italica v2.
2.
4. Application of substances that detect the genotype of deoxyribonucleotide at position 50552775 on chromosome 3 of the millet genome in breeding millet rice color traits; Alternatively, the application of substances that detect the genotype of deoxyribonucleotide at position 50552775 on chromosome 3 of the millet genome in the preparation of products for breeding millet rice color traits; The reference version number of the millet genome is Setaria italica v2.
2.
5. The application according to any one of claims 1-4, characterized in that: The substance used to detect the genotype of the deoxyribonucleic acid at position 50552775 on chromosome 3 of the millet genome is the KASP primer set; the KASP primer set consists of forward primer F1, forward primer F2 and reverse primer R; The forward primer F1 is the single-stranded DNA molecule shown in sequence 1 of the sequence listing; The forward primer F2 is the single-stranded DNA molecule shown in sequence 2 of the sequence listing; The reverse primer R is the single-stranded DNA molecule shown in sequence 3 of the sequence listing.
6. The application according to claim 5, characterized in that: The molar ratio of the forward primer F1, the forward primer F2, and the reverse primer R is 2:2:
5.
7. Application of the kit for identifying the content of millet rice color and yellow pigment in any of the following X1)-X8): X1) Identification or auxiliary identification of millet color; X2) Identification or auxiliary identification of millet yellow pigment content; X3) Screening or assisting in the screening of yellow millet or white millet; X4) Millet breeding; X5) Prepare products for identification or auxiliary identification of millet color; X6) Prepare products for identification or auxiliary identification of millet yellow pigment content; X7) Prepare products for screening or auxiliary screening of yellow or white millet; X8) Products for millet breeding; The kit contains the KASP primer set as described in claim 5 or 6.
8. Any one of the following methods (Y1)-Y5): Y1) A method for identifying or assisting in the identification of millet color, the method comprising the following steps: detecting whether the genotype of the deoxyribonucleotide at position 50552775 on chromosome 3 of the millet genome is CC or TT, wherein the reference version number of the millet genome is [missing information]. Setaria italica v2.2; Determine whether the millet to be tested is yellow millet or white millet based on the genotype of the millet to be tested: if the genotype of the millet to be tested is TT, then the millet to be tested is yellow millet; if the genotype of the millet to be tested is CC, then the millet to be tested is white millet. Y2) A method for identifying or assisting in the identification of yellow pigment content in millet, the method comprising the following steps: detecting whether the genotype of the deoxyribonucleotide at position 50552775 on chromosome 3 of the millet genome is CC or TT, wherein the reference version number of the millet genome is [missing information]. Setaria italica v2.2; The yellow pigment content of the millet was determined based on the genotype of the millet to be tested: the yellow pigment content of the TT genotype millet was higher than that of the CC genotype millet; Y3) A method for screening or assisting in screening yellow millet, the method comprising the step of selecting millet varieties with the TT genotype according to the method described in Y1); Y4) A method for screening or assisting in screening white millet, the method comprising the step of selecting millet varieties with CC genotype according to the method described in Y1); Y5) A method for breeding millet with a rice color trait, comprising the step of using yellow or white millet selected according to the method described in Y3) or Y4) as breeding materials for breeding.
Citation Information
Patent Citations
SNP markers linked with color of husked millet, and primers and application thereof
CN106939342A
Molecular marker related to yellow pigment content of millet and application thereof
CN113403416A