DCAPS molecular marker primer linked with brassica napus saline-alkaline tolerance gene BnaC03.RBGB3 and application of dCAPS molecular marker primer
By designing dCAPS molecular marker primers linked to the salt-alkali tolerance gene BnaC03.RBGB3 in Brassica napus, and combining PCR amplification and agarose gel electrophoresis analysis, the problem of low screening efficiency in traditional breeding methods was solved, enabling rapid and accurate identification of salt-alkali tolerance in Brassica napus and promoting the development of rapeseed breeding.
Patent Information
- Application Number
- CN202511599989.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-04
- Publication Date
- 2026-02-10
AI Technical Summary
Traditional rapeseed breeding methods are time-consuming and inefficient, making it difficult to accurately screen individuals with excellent salt and alkali tolerance. Existing technologies are also insufficient for quickly and accurately identifying the salt and alkali tolerance of Brassica napus.
We designed dCAPS molecular marker primers linked to the salt-tolerant gene BnaC03.RBGB3 in Brassica napus, and used PCR amplification and agarose gel electrophoresis analysis to distinguish between high-resistant and high-sensitive genotypes after specific restriction enzyme digestion.
This method enables rapid and accurate identification of salt and alkali tolerance in rapeseed at the seedling stage, improves selection efficiency, and promotes the breeding process of salt and alkali tolerant rapeseed.
Smart Images

Figure CN121496084A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of molecular biology and plant genetic breeding, and particularly provides a dCAPS (Derived Cleaved Amplified Polymorphic Sequences) molecular marker primer linked to a Brassica napus salt-tolerant gene BnaC03.RBGB3 and its application, which is used for identifying the salt-tolerance of Brassica napus. BACKGROUND
[0002] As one of the four major oil crops in the world, the yield and quality of rapeseed are of great significance to the global edible oil market and the feed industry. However, with the intensification of global climate change and soil salinization, rapeseed production is facing severe challenges. Brassica napus, as one of the important types of rapeseed, has strong salt-tolerance and can grow in saline-alkali soil and maintain high yield and quality. Therefore, developing salt-tolerant Brassica napus varieties is of great significance to improve the stress resistance and sustainability of rapeseed production.
[0003] Traditional rapeseed breeding methods mainly rely on phenotypic selection and hybridization breeding, but this method is time-consuming, low-efficiency, and difficult to accurately screen individuals with excellent salt-tolerance characteristics. With the rapid development of molecular biology technology, molecular marker-assisted breeding has become an efficient and accurate breeding method. By identifying genes related to salt-tolerance traits and using molecular markers for rapid screening, breeding efficiency and accuracy can be greatly improved.
[0004] dCAPS molecular marker is a molecular marker method based on PCR amplification and restriction enzyme digestion technology, which has the advantages of simple operation and reliable results. The present application provides a dCAPS molecular marker primer linked to a Brassica napus salt-tolerant gene BnaC03.RBGB3, which can quickly and accurately identify the salt-tolerance of Brassica napus at the seedling stage through PCR amplification and agarose gel electrophoresis analysis. SUMMARY
[0005] The purpose of the present application is to provide a dCAPS molecular marker primer linked to a Brassica napus salt-tolerant gene BnaC03.RBGB3, which can quickly and accurately identify and distinguish high-sensitive and high-resistant rapeseed plants under salt-alkali stress conditions at the seedling stage through PCR amplification and agarose gel electrophoresis analysis method, thereby eliminating non-target plants, greatly improving the selection efficiency, and accelerating the breeding process of salt-tolerant Brassica napus.
[0006] To achieve the above-mentioned purpose, the present application adopts the following technical solutions:
[0007] A dCAPS molecular marker primer linked to the salt-tolerant gene BnaC03.RBGB3 in Brassica napus, the primer comprising a forward primer and a reverse primer, the nucleotide sequence of the forward primer being shown in SEQ ID NO:1 and the nucleotide sequence of the reverse primer being shown in SEQ ID NO:2;
[0008] The primers can specifically amplify the DNA fragment linked to the salt tolerance gene BnaC03.RBGB3 in Brassica napus, for subsequent enzyme digestion and agarose gel electrophoresis analysis.
[0009] Furthermore, the DNA fragments amplified by the primers can produce two different restriction enzyme modes under the action of specific restriction enzymes, corresponding to the two genotypes of salt-alkali tolerant rapeseed: the highly resistant and the highly sensitive genotype.
[0010] A method for identifying salt and alkali tolerance in Brassica napus using the dCAPS molecular marker primers as described in claim 1 or 2, comprising the following steps:
[0011] Genomic DNA was extracted from Brassica napus plants;
[0012] Using the genomic DNA as a template, PCR amplification was performed using the dCAPS molecular marker primers described in claim 1 or 2 to obtain the amplification product.
[0013] The amplification products are subjected to specific restriction enzyme digestion.
[0014] Agarose gel electrophoresis analysis was performed, and based on the number and position of bands in the electrophoresis results, two genotypes of salt-alkali tolerance in Brassica napus were distinguished: one highly resistant and the other highly sensitive.
[0015] Furthermore, the specific endonuclease is an enzyme capable of recognizing and cutting a specific sequence in the DNA fragment amplified by the dCAPS molecular marker primers according to claim 1 or 2.
[0016] Furthermore, in the results of the agarose gel electrophoresis analysis, the number of electrophoretic bands for the high-resistance genotype was two, with lengths of 195bp and 23bp, respectively; the number of electrophoretic bands for the high-sensitivity genotype was one, meaning that it could not be cleaved by the specific endonuclease.
[0017] Furthermore, the application of dCAPS molecular marker primers or identification methods in salt-alkali tolerant breeding of Brassica napus involves identifying highly resistant genotypes of Brassica napus with high salt-alkali tolerance using the primers or methods, which can then be used for subsequent salt-alkali tolerant breeding work.
[0018] A method for screening, breeding, or preparing a salt-tolerant variety of Brassica napus includes identifying highly resistant genotype plants of salt tolerance in Brassica napus using the dCAPS molecular marker primers as described in claim 1 or 2 or the identification methods as described in claims 3 to 5, and selecting the highly resistant genotype plants for subsequent screening, breeding, or preparation.
[0019] A kit comprising the dCAPS molecular marker primers as described in claim 1 or 2, reagents and materials for agarose gel electrophoresis analysis, and instructions or guidelines for interpreting the electrophoresis results.
[0020] The beneficial effects of this invention are:
[0021] 1. The dCAPS molecular marker primers provided by this invention can specifically amplify DNA fragments linked to the salt tolerance gene BnaC03.RBGB3 in Brassica napus, providing a basis for subsequent enzyme digestion and agarose gel electrophoresis analysis.
[0022] 2. The method of the present invention can quickly and accurately identify the salt and alkali tolerance of rapeseed at the seedling stage, greatly improving the selection efficiency and providing strong support for the breeding of salt and alkali tolerant rapeseed.
[0023] 3. The new rapeseed varieties with better salt and alkali tolerance bred by the method of this invention are of great significance for improving rapeseed yield and quality, increasing farmers' income, and promoting agricultural development. Attached Figure Description
[0024] Figure 1 The agarose gel electrophoresis results show two haplotypes, Hap1 and Hap2, with Hap1 producing two bands (195bp and 23bp) after digestion, while Hap2 remains a single band after digestion. Detailed Implementation
[0025] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments.
[0026] The purpose of this invention is to provide a dCAPS molecular marker primer linked to the salt-alkali tolerance gene BnaC03.RBGB3 in Brassica napus and its application method, providing a powerful tool for the screening, breeding, and preparation of salt-alkali tolerant Brassica napus varieties.
[0027] To achieve the above objectives, the present invention adopts the following technical solution:
[0028] 1. Design of dCAPS molecular marker primers:
[0029] This invention designs a dCAPS molecular marker primer linked to the salt-alkali tolerance gene BnaC03.RBGB3 in Brassica napus, including a forward primer and a reverse primer.
[0030] The nucleotide sequence of the forward primer is: GTGGTGCTCCACGCTTTGGTGCTCG (SEQ ID NO:1);
[0031] The nucleotide sequence of the reverse primer is: TGTACCTATCCCCACCTGCAAACCGA (SEQ ID NO:2);
[0032] The primers can specifically amplify the DNA fragment linked to the salt tolerance gene BnaC03.RBGB3 in Brassica napus, which can be used for subsequent enzyme digestion and agarose gel electrophoresis analysis.
[0033] 2. Application methods of dCAPS molecular marker primers:
[0034] Genomic DNA was extracted from Brassica napus plants as a template;
[0035] PCR amplification was performed using the dCAPS molecular marker primers designed above to obtain the amplification products.
[0036] The amplification products are subjected to specific restriction enzyme digestion.
[0037] Agarose gel electrophoresis analysis was performed, and based on the number and position of bands in the electrophoresis results, two genotypes of salt-alkali tolerance in Brassica napus were distinguished: one highly resistant and the other highly sensitive.
[0038] 3. Enzyme digestion pattern and electrophoresis results:
[0039] By using specific restriction enzymes to digest the amplification products, two different digestion modes can be generated, corresponding to the two genotypes of salt-alkali tolerance in Brassica napus: the highly resistant and the highly sensitive genotypes.
[0040] The high-resistance genotype has two electrophoretic bands, with lengths of 195bp and 23bp, respectively; the high-sensitivity genotype has one electrophoretic band, meaning it cannot be cleaved by the specific restriction enzyme.
[0041] application:
[0042] Using the dCAPS molecular marker primers and identification methods described above, highly resistant genotype plants of Brassica napus with salt and alkali tolerance were identified, and these highly resistant genotype plants were selected for subsequent screening, breeding, or preparation.
[0043] A kit is provided comprising the above-mentioned dCAPS molecular marker primers, reagents and materials for agarose gel electrophoresis analysis, and instructions or guidelines for interpreting the electrophoresis results.
[0044] Application prospects:
[0045] The dCAPS molecular marker primers of this invention can be applied to the screening, breeding and preparation of salt-tolerant varieties of Brassica napus. They can quickly and accurately identify highly resistant genotype plants with salt tolerance, providing strong support for subsequent breeding work.
[0046] At the same time, this invention can also provide reference for salt-alkali tolerant breeding of other crops, and promote the development and progress of crop salt-alkali tolerant breeding technology. Specific implementation examples:
[0048] I. Preparation of Experimental Materials and Reagents
[0049] Experimental materials:
[0050] Leaves or seeds of Brassica napus plants (for extracting genomic DNA);
[0051] Sterile water, centrifuge tubes, mortar and pestle, grinding rods, pipettes and other laboratory equipment.
[0052] Reagent preparation:
[0053] DNA extraction reagents (such as CTAB extraction solution, proteinase K, etc.);
[0054] PCR reaction reagents (including Taq enzyme, dNTPs, buffer, MgCl2, forward primer, reverse primer, etc.);
[0055] Restriction endonucleases and their buffers (selecting appropriate enzymes based on the designed dCAPS label);
[0056] Reagents required for electrophoresis, such as agarose, electrophoresis buffer (e.g., TAE or TBE), DNA marker, and loading buffer;
[0057] Ethanol, NaCl, and other reagents are used for DNA precipitation and washing.
[0058] II. Genomic DNA Extraction
[0059] Material selection and grinding:
[0060] Take an appropriate amount of fresh leaves from a Brassica napus plant, rinse them with sterile water, dry them, and grind them into powder in a mortar with liquid nitrogen.
[0061] DNA extraction:
[0062] Transfer the ground powder to a centrifuge tube, add an appropriate amount of CTAB extraction solution and proteinase K, mix well, and incubate in a 65°C water bath for a period of time, inverting and mixing occasionally.
[0063] After incubation, add an equal volume of chloroform / isoamyl alcohol (24:1) mixture, shake vigorously, centrifuge, and collect the supernatant.
[0064] Repeat the chloroform / isoamyl alcohol extraction steps described above once;
[0065] Take the supernatant, add twice the volume of pre-cooled anhydrous ethanol, gently invert to mix, and then place in a -20°C freezer to precipitate DNA.
[0066] After precipitation, centrifuge to discard the supernatant, wash the precipitate twice with 70% ethanol, dry it, and then dissolve it in an appropriate amount of sterile water.
[0067] DNA concentration and quality testing:
[0068] Use a spectrophotometer or electrophoresis to detect the concentration and quality of the extracted DNA, ensuring that the DNA concentration is appropriate and there is no significant degradation.
[0069] III. PCR Amplification
[0070] PCR reaction system preparation:
[0071] Prepare an appropriate PCR reaction system according to the PCR reagent instructions, including Taq enzyme, dNTPs, buffer, MgCl2, forward primer, reverse primer, and template DNA.
[0072] PCR reaction conditions settings:
[0073] Based on the specificity of the primers and the length of the target fragment, set appropriate PCR reaction conditions, including pre-denaturation temperature and time, denaturation temperature and time, annealing temperature and time, and extension temperature and time. The annealing temperature usually needs to be fine-tuned according to the Tm value of the primers.
[0074] PCR product detection:
[0075] Take an appropriate amount of PCR product for electrophoresis detection to observe whether the target band appears, as well as the clarity and specificity of the band.
[0076] IV. Restriction Enzyme Digestion
[0077] Preparation of the enzyme digestion reaction system:
[0078] Prepare an appropriate digestion reaction system according to the restriction endonuclease's instructions, including digestion buffer, restriction endonuclease, and PCR product.
[0079] Enzyme digestion reaction conditions settings:
[0080] The digestion reaction conditions should be set according to the optimal temperature and time of the restriction endonuclease. Incubation at 37°C or a specific temperature for a period of time is usually required.
[0081] Enzyme digestion product detection:
[0082] After enzyme digestion, take an appropriate amount of the digestion product for electrophoresis detection to observe whether the digestion bands meet expectations.
[0083] V. Agarose Gel Electrophoresis Analysis
[0084] Gel preparation:
[0085] Prepare an agarose gel of appropriate concentration (e.g., 1.5% or 2%) as needed, add an appropriate amount of electrophoresis buffer, and heat to dissolve the agarose. After the agarose solution cools to a suitable temperature, pour it into a gel mold and insert a comb. After the gel solidifies, remove the comb and set aside.
[0086] Electrophoresis sample preparation:
[0087] After thoroughly mixing the enzyme digestion product with the loading buffer, the mixture was loaded into the gel wells. A DNA marker was also added as a molecular weight reference.
[0088] Electrophoresis conditions settings:
[0089] Set appropriate electrophoretic voltage and time for electrophoretic separation. The voltage typically needs to be adjusted between 100-200V, and the time depends on the band migration speed.
[0090] Observation and analysis of electrophoresis results:
[0091] After electrophoresis, the gel is placed under a UV lamp to observe the bands. The salt and alkali tolerance genotype of Brassica napus is determined based on the number and position of the bands. The electrophoretic bands of highly resistant genotypes are usually two (195bp and 23bp), while the electrophoretic bands of highly sensitive genotypes are only one (not cleaved by a specific restriction enzyme).
[0092] III. Application
[0093] Methods for screening, breeding, or preparing salt-tolerant varieties of Brassica napus:
[0094] Using the above-mentioned dCAPS molecular marker primers and identification methods, highly resistant genotype plants of Brassica napus with salt and alkali tolerance can be identified, and these highly resistant genotype plants can be selected for subsequent screening, breeding, or preparation.
[0095] Reagent kit preparation:
[0096] Prepare a kit containing the above-mentioned dCAPS molecular marker primers, reagents and materials for agarose gel electrophoresis analysis, and instructions or guidelines for interpreting the electrophoresis results.
[0097] The kit is easy and quick to use, and is suitable for large-scale screening and identification of salt and alkali tolerance in Brassica napus.
[0098] Through the above specific implementation methods, the accurate application of dCAPS molecular marker primers linked to the salt-alkali tolerance gene BnaC03.RBGB3 in Brassica napus can be ensured, providing strong support for the screening, breeding, and preparation of salt-alkali tolerant Brassica napus varieties.
[0099] The present invention and its embodiments have been described above. This description is not restrictive, and the accompanying drawings are only one embodiment of the present invention; the actual structure is not limited thereto. In conclusion, if those skilled in the art are inspired by this description and design similar structures and embodiments without departing from the spirit of the invention, such designs should fall within the protection scope of the present invention.
Claims
1. A dCAPS molecular marker primer linked to the salt-alkali tolerance gene BnaC03.RBGB3 in Brassica napus, characterized in that: The primers include a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown in SEQ ID NO:1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO:
2. The primers can specifically amplify the DNA fragment linked to the salt tolerance gene BnaC03.RBGB3 in Brassica napus, for subsequent enzyme digestion and agarose gel electrophoresis analysis.
2. The dCAPS molecular marker primer according to claim 1, characterized in that: The DNA fragments amplified by the primers can produce two different restriction enzyme modes under the action of specific restriction enzymes, corresponding to the two genotypes of salt-alkali tolerant rapeseed: the highly resistant and the highly sensitive genotype.
3. A method for identifying the salt and alkali tolerance of Brassica napus using the dCAPS molecular marker primers as described in claim 1 or 2, characterized in that, Includes the following steps: Genomic DNA was extracted from Brassica napus plants; Using the genomic DNA as a template, PCR amplification was performed using the dCAPS molecular marker primers as described in claim 1 or 2 to obtain the amplification product; The amplification products are subjected to specific restriction enzyme digestion. Agarose gel electrophoresis analysis was performed, and based on the number and position of bands in the electrophoresis results, two genotypes of salt-alkali tolerance in Brassica napus were distinguished: one highly resistant and the other highly sensitive.
4. The identification method according to claim 3, characterized in that: The specific endonuclease is an enzyme capable of recognizing and cutting a specific sequence in the DNA fragment amplified by the dCAPS molecular marker primers as described in claim 1 or 2.
5. The identification method according to claim 3 or 4, characterized in that: In the agarose gel electrophoresis analysis, the high-resistance genotype showed two bands with lengths of 195 bp and 23 bp, respectively; the high-sensitivity genotype showed only one band, meaning it could not be cleaved by the specific endonuclease.
6. The application of the dCAPS molecular marker primers according to claim 1 or 2 or the identification method according to claims 3 to 5 in salt-alkali tolerant breeding of Brassica napus, characterized in that: The primers or methods described above were used to identify highly resistant genotypes of Brassica napus that are tolerant to salt and alkali, which can be used for subsequent salt-alkali tolerant breeding work.
7. A method for screening, breeding, or preparing a salt-tolerant variety of Brassica napus, characterized in that: This includes using the dCAPS molecular marker primers as described in claim 1 or 2 or the identification methods as described in claims 3 to 5 to identify highly resistant genotype plants of salt and alkali tolerance in Brassica napus, and selecting the highly resistant genotype plants for subsequent screening, breeding or preparation.
8. A kit comprising the dCAPS molecular marker primers as described in claim 1 or 2, reagents and materials for agarose gel electrophoresis analysis, and instructions or guidelines for interpreting the electrophoresis results.