A primer combination, kit and application thereof for rapid identification of authenticity of gene-edited soybean seeds

Abstract

The present invention relates to the field of molecular biology technology, and in particular to a primer combination, a kit and an application thereof for rapid authenticity identification of gene-edited soybean seeds. The KASP primer combination and the kit provided by the present invention can accurately and rapidly identify whether the GmFAD2-1A gene and the GmFAD2-1B gene are edited, and can accurately distinguish whether the editing site is homozygous or heterozygous, and then judge whether it is a gene-edited soybean AE15-18-1 seed, the detection time is shortened to 45 minutes, the sensitivity is 0.25 ng, the specificity is strong, the detection cost is low, the detection efficiency is high, and it has good application prospects.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular to a primer combination for rapid authenticity identification of gene-edited soybean seeds, a kit and applications thereof. Background Art

[0002] Soybean is one of the most important economic crops in the world. Gene-edited soybean AE 15-18-1 is a quality-improved high-oleic soybean developed by Shunfeng Biotechnology Co., Ltd. The soybean was obtained by editing the GmFAD2-1A gene and GmFAD2-1B gene simultaneously through the CRISPER-CAS system. Therefore, it is urgent to develop an efficient, stable and low-cost identification method for distinguishing homozygous and heterozygous gene-edited soybean AE 15-18-1 and wild-type (unedited) soybean seeds for subsequent quality and safety supervision of gene-edited soybean seeds.

[0003] Chinese invention patent CN 118374635 A discloses a primer and method for detecting gene-edited soybeans based on KASP technology, which is used to detect GmFAD2-1A and GmFAD2-1B gene-edited soybeans. The study found that although the patent CN118374635 A describes the minimum detection limit (sensitivity) concentration as 0.0625ng / μL, 1.5μL of DNA template was added to the actual reaction system for drying, and the actual detection limit DNA template amount was 0.09375ng, and the sensitivity implementation scheme did not set up heterozygous gene-edited soybean samples; in addition, the universal primer sequence provided in the patent has base mismatches compared with the original sequence. The actual detection using the patented method found that the GmFAD2-1A gene was not amplified, and the GmFAD2-1B gene amplification signal value was low, and the effect was poor. Summary of the invention

[0004] In view of the above-mentioned deficiencies in the prior art, the purpose of the present invention is to provide a primer combination, a kit and its application for rapid identification of authenticity of gene-edited soybean seeds, which are used to accurately identify homozygous, heterozygous and wild-type soybeans edited with GmFAD2-1A gene and GmFAD2-1B gene, and are also used for purity detection of gene-edited soybeans, with the detection time shortened to 45 minutes, low detection cost and high detection efficiency, and have good application prospects.

[0005] In order to achieve the above-mentioned object of the invention, the technical solution adopted by the present invention is:

[0006] In a first aspect, a primer combination for rapid authenticity identification of gene-edited soybean seeds is provided, which is selected from any one or more of the following groups:

[0007] (1) A first primer set, comprising a first specific primer, a second specific primer and a first universal primer, wherein the nucleotide sequence of the first specific primer is shown in SEQ ID No. 1, the nucleotide sequence of the second specific primer is shown in SEQ ID No. 2; and the nucleotide sequence of the first universal primer is shown in SEQ ID No. 3;

[0008] (2) A second primer set, comprising a third specific primer, a fourth specific primer and a second universal primer, wherein the nucleotide sequence of the third specific primer is shown in SEQ ID No.4, the nucleotide sequence of the fourth specific primer is shown in SEQ ID No.5; and the nucleotide sequence of the second universal primer is shown in SEQ ID No.6.

[0009] Furthermore, the gene-edited soybeans are gene-edited soybeans obtained after gene editing of the GmFAD2 gene; the GmFAD2 gene includes GmFAD2-1A and GmFAD2-1B.

[0010] Furthermore, the first primer set is used to detect the GmFAD2-1A gene, and the second primer set is used to detect the GmFAD2-1B gene.

[0011] Furthermore, the 5' end of the specific primer is connected to a fluorescent label.

[0012] Furthermore, the 5' ends of the first specific primer and the third specific primer are connected to a FAM tag, and the 5' ends of the second specific primer and the fourth specific primer are connected to a HEX tag.

[0013] In a second aspect, a method for rapid identification of gene-edited soybean seeds is provided, wherein the method uses the above-mentioned primer combination to detect the soybean sample to be tested.

[0014] Furthermore, the method specifically comprises the following steps:

[0015] Step 1, extracting DNA from the soybean sample to be tested;

[0016] Step 2, perform amplification; the PCR reaction program is: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 5 s, denaturation at 58°C for 20 s, 45 cycles; read the fluorescence signal at 30°C for 30 s.

[0017] Furthermore, the PCR reaction system is that 5 μL contains 2.5 μL of FLU-ARMS V5F 2×PCR MIX, 0.5 μL of primer mixture, and 2 μL of DNA template; the final concentrations of FAM-F and HEX-F in the specific primer mixture are both 0.1 μM, and the final concentration of the downstream universal primer COM is 0.3 μM.

[0018] In a third aspect, a gene-edited soybean seed rapid identification kit is provided, which includes the above-mentioned primer combination.

[0019] In a fourth aspect, the invention provides an application of the above-mentioned primer combination in the rapid identification of homozygous and heterozygous types of gene-edited soybean seeds and purity detection, or in the preparation of a reagent or kit for detecting pure heterozygous types of gene-edited soybeans.

[0020] The beneficial effects of the present invention are:

[0021] The KASP primer combination and the kit provided by the present invention can accurately and quickly identify whether the GmFAD2-1A gene and the GmFAD2-1B gene are edited, and can accurately distinguish whether the editing site is homozygous or heterozygous, and then determine whether it is gene-edited soybean AE15-18-1 seeds. The detection time is shortened to 45 minutes, the sensitivity is 0.25 ng, the specificity is strong, the detection cost is low, the detection efficiency is high, and it has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a homology comparison diagram of the editing sites of the GmFAD2-1A and GmFAD2-1B genes;

[0023] Figure 2 This is a graph showing the preliminary test results of the 1A-FAM-F / 1A-HEX-F / 1A-COM primer combination;

[0024] Figure 3 This is a graph showing the preliminary test results of the 1B-FAM-F / 1B-HEX-F / 1B-COM primer combination;

[0025] Figure 4 This is a graph showing the specificity test results of the 1A-FAM-F / 1A-HEX-F / 1A-COM primer combination;

[0026] Figure 5 This is a graph showing the specificity test results of the 1B-FAM-F / 1B-HEX-F / 1B-COM primer combination;

[0027] Figure 6 Amplification diagram for detecting the editing status of GmFAD2-1A with 100 ng template;

[0028] Figure 7 Amplification diagram for detecting the editing status of GmFAD2-1A with 50 ng template;

[0029] Figure 8 Amplification diagram for detecting the editing status of GmFAD2-1A with 20 ng template;

[0030] Fig. 9Amplification diagram for detecting the editing status of GmFAD2-1A with 10 ng template;

[0031] Fig.10 This is the amplification diagram for detecting the editing of GmFAD2-1A with 5 ng template;

[0032] Fig.11 Amplification diagram for detecting the editing of GmFAD2-1A with 2.5 ng template;

[0033] Fig.12 Amplification diagram for detecting the editing of GmFAD2-1A with 1.25 ng template;

[0034] Fig.13 Amplification diagram for detecting the editing of GmFAD2-1A with 0.625 ng template;

[0035] Fig.14 Amplification diagram for detecting the editing of GmFAD2-1A with 0.25 ng template;

[0036] Fig.15 Amplification diagram for detecting the editing of GmFAD2-1A with 0.125 ng template;

[0037] Fig.16 Amplification diagram for detecting the editing of GmFAD2-1A with 0.05 ng template;

[0038] Fig.17 Amplification diagram for detecting the editing of GmFAD2-1A with 0.025 ng template;

[0039] Fig.18 Amplification diagram for detecting the editing status of GmFAD2-1B with 100 ng template;

[0040] Fig.19 Amplification diagram for detecting the editing status of GmFAD2-1B with 50 ng template;

[0041] Fig. 20 Amplification diagram for detecting the editing status of GmFAD2-1B with 20 ng template;

[0042] Fig.21 Amplification diagram for detecting the editing status of GmFAD2-1B with 10 ng template;

[0043] Fig. 22 This is the amplification diagram for detecting the editing status of GmFAD2-1B with 5 ng template;

[0044] Fig.23 Amplification diagram for detecting the editing status of GmFAD2-1B with 2.5 ng template;

[0045] Fig.24 Amplification diagram for detecting the editing status of GmFAD2-1B with 1.25 ng template;

[0046] Fig.25 Amplification diagram for detecting the editing status of GmFAD2-1B with 0.625 ng template;

[0047] Fig.26 Amplification diagram for detecting the editing status of GmFAD2-1B with 0.25 ng template;

[0048] Fig. 27 Amplification diagram for detecting the editing status of GmFAD2-1B with 0.125 ng template;

[0049] Fig.28 Amplification diagram for detecting the editing status of GmFAD2-1B with 0.05 ng template;

[0050] Fig.29 Amplification diagram for detecting the editing status of GmFAD2-1B with 0.025 ng template;

[0051] Fig.30 This is the result of GmFAD2-1A gene editing identification in 92 gene-edited soybean seeds;

[0052] Fig.31 This is the GmFAD2-1B gene editing identification result of 92 gene-edited soybean seeds. DETAILED DESCRIPTION

[0053] The specific implementation modes of the present invention are described below so that those skilled in the art can understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific implementation modes. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the attached claims, these changes are obvious, and all inventions and creations utilizing the concept of the present invention are protected.

[0054] Example 1

[0055] KASP primer design:

[0056] Since the gene-edited soybean AE15-18-1 was obtained by editing the GmFAD2-1A and GmFAD2-1B genes simultaneously through gene editing technology, the edited GmFAD2-1A gene has one more "T" base compared to the unedited GmFAD2-1A gene, and the edited GmFAD2-1B gene has 7 missing bases "CAATCAT" compared to the unedited GmFAD2-1B gene. The homology of GmFAD2-1A and GmFAD2-1B genes is extremely high. Figure 1The sequence information before and after editing is shown in SEQ ID No.7-SEQ ID No.10.

[0057] In response to the single base insertion of "T" in the GmFAD2-1A gene, the upstream primer was designed with SNP at the 3' end, the 3' end of the unedited primer was "A", and the 3' end of the edited primer was "T". The downstream universal primer was designed in the SNP region of the GmFAD2-1A gene and the GmFAD2-1B gene, and the 3' end was the SNP site, thereby ensuring the specific amplification of the GmFAD2-1A gene; in response to the deletion of 7 bases "CAATCAT" in the GmFAD2-1B gene, the upstream primer was designed with the 3' end of the unedited primer containing the missing 7 bases, and the 3' end of the edited primer did not contain the 7 missing bases. The downstream universal primer was also designed in the SNP region of the GmFAD2-1A gene and the GmFAD2-1B gene, and the 3' end was the SNP site, thereby ensuring the specific amplification of the GmFAD2-1B gene.

[0058] The primer combination information for detecting GmFAD2-1A and GmFAD2-1B genes before and after editing based on KASP technology is shown in Table 1. The amplified sequence size of GmFAD2-1A gene before and after editing is 64 bp, and the amplified sequence size of GmFAD2-1B gene before and after editing is 64 bp. The 5' ends of 1A-FAM-F and 1B-FAM-F primers are connected to a FAM tag with a nucleotide sequence of "gaaggtgaccaagttcatgct", and the 5' ends of 1A-HEX-F and 1B-HEX-F primers are connected to a HEX tag with a nucleotide sequence of "gaaggtcggagtcaacggatt".

[0059] Table 1 Primer sequence information

[0060]

[0061] Example 2

[0062] Specificity test:

[0063] DNA extraction was performed using a kit method or CTAB method. For the kit method, DNA was extracted directly according to the instructions. For the CTAB method, the following steps were followed: 200-400 mg of tender leaves or seed powder was selected and placed in a 2 ml centrifuge tube, 400 μl of CTAB extraction buffer (1.5% CTAB, 50 nM Tris-HCl, 25 mM EDTA, 300 mM NaCl) was added and mixed, and the mixture was placed in a 58°C water bath for 30 min, during which time the mixture was mixed several times; an equal volume of chloroform:isoamyl alcohol (24:1) was added and the mixture was gently mixed at room temperature; after centrifugation at 6000 rpm for 5 min, 200 μl of the supernatant was taken and placed in a 1.5 ml centrifuge tube, 2 times the volume of pre-cooled anhydrous ethanol was added and mixed; after centrifugation at 12000 rpm for 5 min, the precipitate was retained and washed three times with 75% ethanol; after drying, 50 μl of ddH2O was added to dissolve the mixture, and the DNA was placed at -20°C for later use.

[0064] The configuration of the PCR reaction system, 5 μL system contains: FLU-ARMS V5F 2×PCR MIX 2.5 μL, primer mixture 0.5 μL, DNA template 2 μL. The final concentrations of FAM-F and HEX-F in the specific primer mixture are both 0.1 μM, and the final concentration of the downstream universal primer COM is 0.3 μM.

[0065] PCR amplification uses a fluorescence detector such as BioRad CFX384 and other platforms. The reaction program is: 95°C pre-denaturation, 5min; 95°C 5s (denaturation), 58°C 20s, 45 cycles; 30°C, 30s to read the fluorescence signal.

[0066] First, the designed primer set was preliminarily tested, and PCR amplification was performed on the homozygous and heterozygous types of gene-edited soybean AE15-18-1 and unedited soybean. It was found that the 1A-FAM-F / 1A-HEX-F / 1A-COM primer combination can accurately identify the homozygous, heterozygous and unedited types of the GmFAD2-1A gene editing, such as Figure 2 ; The 1B-FAM-F / 1B-HEX-F / 1B-COM primer combination can accurately identify the GmFAD2-1B gene editing homozygous, heterozygous and unedited types, such as Figure 3 .

[0067] Secondly, the specificity of the primer set was tested, and the gene-edited soybean AE15-18-1, wild-type unedited soybean (gene-edited soybean AE15-18-1 negative control soybean, Tianlong No. 1, Tianlong No. 2, Zhongdou 48, Zhongdou 70, Zhongdou 72, Zhongdou 86), and a mixed sample with a 1% content of transgenic soybean transformants (GTS40-3-2, MON89788, A5547-127, A2704-12, 356043, 305423, CV127 ... 87701, MON87708, MON87769, MON87705, FG72, DAS81419-2) were used as detection objects for PCR amplification. The results showed that the 1A-FAM-F / 1A-HEX-F / 1A-COM primer combination can accurately identify the homozygous and heterozygous types of the GmFAD2-1A gene editing in the gene-edited soybean AE15-18-1, as well as multiple wild-type unedited soybean samples and mixed samples of transgenic soybean transformants. The detection results were consistent with expectations, such as Figure 4 , indicating that the primer combination has good specificity; the 1B-FAM-F / 1B-HEX-F / 1B-COM primer combination can accurately identify the homozygous and heterozygous types of the GmFAD2-1B gene editing in the gene-edited soybean AE15-18-1, as well as multiple wild-type unedited soybean samples and mixed samples of transgenic soybean transformants. The detection results are consistent with expectations, such as Figure 5 , indicating that the primer combination has good specificity.

[0068] Compared with the invention patent CN 118374635 A, the kit in this application uses a domestic reagent compatible with KASP technology, and the PCR amplification procedure is also simplified from gradient amplification. The detection time is shortened from the previous 90 minutes to about 45 minutes. The kit of this application further saves costs and improves detection efficiency; in specific detection, this application directly uses gene-edited soybean AE15-18-1, wild-type unedited soybean (gene-edited soybean AE15-18-1 negative control soybean, Tianlong No. 1, Tianlong No. 2, Zhongdou 48, Zhongdou 70, Zhongdou 72, Zhongdou Bean 86), a mixed sample with a genetically modified soybean transformant content of 1% (GTS40-3-2, MON89788, A5547-127, A2704-12, 356043, 305423, CV127, MON87701, MON87708, MON87769, MON87705, FG72, DAS81419-2) is used as the detection object. Instead of using simulated mismatched bases to verify the specificity of the detection method amplification, the specific detection scheme of the present application is closer to the actual application scenario.

[0069] Example 3

[0070] Sensitivity test:

[0071] According to Example 2, the DNA template was prepared, and the homozygous, heterozygous and unedited soybean DNA templates of gene-edited soybean AE15-18-1 were diluted to 100ng, 50ng, 20ng, 10ng, 5ng, 2.5ng, 1.25ng, 0.625ng, 0.25ng, 0.125ng, 0.05ng, and 0.025ng, respectively. According to the 5μL PCR reaction system, 4 repeated PCR amplifications were performed to determine the sensitivity of the detection method. It was found that the 1A-FAM-F / 1A-HEX-F / 1A-COM primer combination can accurately detect the GmFAD2-1A gene in the homozygous, heterozygous and unedited soybeans of gene-edited soybean AE15-18-1 with template amounts of 100ng, 50ng, 20ng, 10ng, 5ng, 2.5ng, 1.25ng, 0.625ng, and 0.25ng. The DNA template amount below 0.125ng cannot stably identify the three types of soybeans ( Figure 6-Figure 17 ); The 1B-FAM-F / 1B-HEX-F / 1B-COM primer combination can accurately detect the GmFAD2-1B gene in the homozygous and heterozygous types of gene-edited soybean AE15-18-1 and unedited soybeans with template amounts of 100ng, 50ng, 20ng, 10ng, 5ng, 2.5ng, 1.25ng, 0.625ng, 0.25ng, and 0.125ng. The amount of DNA template below 0.05ng cannot stably identify the three types of soybeans ( Figure 18-Figure 29 ); The results showed that the sensitivity of the detection method of the 1A-FAM-F / 1A-HEX-F / 1A-COM primer combination and the 1B-FAM-F / 1B-HEX-F / 1B-COM primer combination developed in this application reached a template amount of 0.25 ng.

[0072] Compared with the sensitivity detection effect in the invention patent CN 118374635 A, the implementation scheme of sensitivity detection in this application is different. This application uses three samples of homozygous edited soybean, heterozygous edited soybean and unedited wild soybean for detection, while the invention patent CN 118374635 A only uses two samples of homozygous edited and unedited wild soybean for detection. First of all, this application is advanced in sample setting. If only homozygous edited soybean and unedited wild soybean are detected in this application, according to the experimental results ( Fig.16 , Fig. 27), the 1A-FAM-F / 1A-HEX-F / 1A-COM primer combination and the 1B-FAM-F / 1B-HEX-F / 1B-COM primer combination can still accurately type a sample of 0.05ng. The minimum detection limit (sensitivity) described in patent CN118374635 A is 0.0625ng / μL, and 1.5μL of DNA template is added to the actual reaction system for drying, the actual detection limit of DNA template is 0.09375ng, and no heterozygous edited soybean samples are set in the scheme. It is obvious that the implementation scheme of the present application is advanced, and the improvement in effect is significant.

[0073] Example 4

[0074] Application of KASP primer combination and its kit in rapid identification of AE15-18-1 seed purity:

[0075] 92 gene-edited soybean AE15-18-1 seeds were randomly selected, and a single seed was ground and a DNA template was prepared according to Example 2. The DNA template was homogenized to about 25 ng / μL, and a 5 μL reaction system was configured according to Example 2. Two repeated PCR amplifications were performed, and the gene-edited soybean AE15-18-1 homozygous, heterozygous, wild unedited soybeans, and blank were set as control samples. The results showed that all 92 seeds were homozygous for the edited GmFAD2-1A gene and GmFAD2-1B gene in the gene-edited soybean AE15-18-1, and the results were completely consistent with the PCR+enzyme digestion test results. The purity of the 92 gene-edited soybean AE15-18-1 seeds was 100%, and all were homozygous edited soybeans. The results show that the 1A-FAM-F / 1A-HEX-F / 1A-COM primer combination and 1B-FAM-F / 1B-HEX-F / 1B-COM primer combination detection methods developed in the present invention can be applied to the rapid identification and appraisal of the purity of gene-edited soybean AE15-18-1 seeds.

[0076] In summary, the present invention provides a primer combination and a kit for quickly and accurately identifying gene-edited soybean AE15-18-1 seeds based on KASP technology, which can distinguish the authenticity of gene-edited soybean seeds, that is, it can accurately and quickly identify whether the GmFAD2-1A gene and the GmFAD2-1B gene are edited, and can accurately distinguish whether the editing site is homozygous or heterozygous, and then determine whether it is gene-edited soybean AE15-18-1 seeds. The detection time is shortened, the sensitivity is high, the specificity is strong, the detection cost is low, the detection efficiency is high, and it has good application prospects.

[0077] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the present invention can be implemented in other specific forms without departing from the spirit or essential features of the present invention. Therefore, the embodiments should be considered exemplary and non-restrictive in all respects, and the scope of the present invention is defined by the appended claims rather than the above description, and it is intended that all changes falling within the meaning and scope of the equivalent elements of the claims be included in the present invention.

[0078] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. A primer combination for rapid identification of authenticity of gene-edited soybean seeds, characterized in that: The primer combination is selected from any one or more of the following groups: (1) A first primer set, comprising a first specific primer, a second specific primer and a first universal primer, wherein the nucleotide sequence of the first specific primer is shown in SEQ ID No. 1, the nucleotide sequence of the second specific primer is shown in SEQ ID No. 2; and the nucleotide sequence of the first universal primer is shown in SEQ ID No. 3; (2) A second primer set, comprising a third specific primer, a fourth specific primer and a second universal primer, wherein the nucleotide sequence of the third specific primer is shown in SEQ ID No.4, the nucleotide sequence of the fourth specific primer is shown in SEQ ID No.5; and the nucleotide sequence of the second universal primer is shown in SEQ ID No.

6.

2. The primer combination according to claim 1, characterized in that The gene-edited soybeans are gene-edited soybeans obtained after gene editing of the GmFAD2 gene; the GmFAD2 gene includes GmFAD2-1A and GmFAD2-1B.

3. The primer combination according to claim 2, characterized in that: The first primer set is used to detect the GmFAD2-1A gene, and the second primer set is used to detect the GmFAD2-1B gene.

4. The primer combination according to claim 1, characterized in that The 5' end of the specific primer is also connected with a fluorescent label.

5. The primer combination according to claim 1, characterized in that: The 5' ends of the first specific primer and the third specific primer are connected to a FAM tag, and the 5' ends of the second specific primer and the fourth specific primer are connected to a HEX tag.

6. A method for rapid identification of gene-edited soybean seeds, the method using the primer combination described in any one of claims 1-5 to detect the soybean sample to be tested.

7. The method according to claim 6, characterized in that The method specifically comprises the following steps: Step 1, extracting DNA from the soybean sample to be tested; Step 2, perform amplification; the PCR reaction program is: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 5 s, denaturation at 58°C for 20 s, 45 cycles; read the fluorescence signal at 30°C for 30 s.

8. The method according to claim 7, characterized in that The PCR reaction system comprises 2.5 μL of FLU-ARMSV5F 2×PCR MIX, 0.5 μL of primer mixture, and 2 μL of DNA template in 5 μL; wherein the final concentrations of FAM-F and HEX-F in the specific primer mixture are both 0.1 μM, and the final concentration of the downstream universal primer COM is 0.3 μM.

9. A kit for rapid identification of gene-edited soybean seeds, comprising the primer combination described in any one of claims 1-5.

10. Use of the primer combination described in any one of claims 1-5 in the rapid identification of homozygous and heterozygous types and purity detection of gene-edited soybean seeds, or in the preparation of a reagent or kit for detecting pure heterozygous types of gene-edited soybeans.

Images