Molecular marker located in chromosome 3 and related to yield character of Vicia sativa L. and application of molecular marker

Abstract

The invention discloses a molecular marker located in chromosome 3 and related to yield traits of Vicia sativa L. and application of the molecular marker, and belongs to the technical field of biology. The molecular marker is named as VsChr3168325060, and the nucleotide sequence of an insertion or deletion fragment of the molecular marker is shown as SEQ ID NO. 3. The nucleotide sequences of the primer pair used for amplifying the InDel molecular marker VsChr3168325060 are as shown in SEQ ID NO. 1 to 2. By means of the molecular marker, the breeding efficiency can be greatly improved, and the function of rapidly screening high-yield vicia sativa materials at the molecular level is achieved.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a molecular marker located on chromosome 3 and related to yield traits of pea arils and an application thereof. Background Art

[0002] With the rapid development of breeding technology, current breeding methods mainly include traditional breeding and molecular breeding. In the breeding process, the selection of target traits mainly depends on the performance of genotype and phenotype. Molecular marker-assisted breeding uses the close linkage relationship between molecular markers and genes related to target traits. By detecting molecular markers, the existence of target genes can be indirectly determined, thereby achieving accurate selection of target traits. This method has the significant advantages of fast speed, high accuracy and no restrictions on environmental conditions. The screening of target trait genotypes by molecular markers greatly shortens the breeding cycle, accelerates breeding efficiency, and overcomes many challenges faced in traditional breeding methods. At present, the development and application of molecular marker technology based on genome-wide association analysis (GWAS) has become a research hotspot and a frontier of competition in the field of breeding.

[0003] Vicia sativa L. is an important self-pollinating annual forage legume. It is rich in minerals and vitamins and has a high digestibility. It is suitable for livestock and is considered to be one of the most economically valuable annual legumes in the world. As a multifunctional crop, Vicia sativa plays an important role in both human diet and animal feed. Its seeds can provide humans with abundant starch and protein, and its nutritious stems and leaves are high-quality feed for livestock, which can effectively improve the production performance of livestock. In addition, due to its symbiotic relationship with rhizobia in the soil, it can fix nitrogen from the atmosphere into the soil, thereby significantly reducing the use of chemical fertilizers. It is an important high-quality green manure. With its low cost, high nutritional value, wide range of uses and strong adaptability, Vicia sativa is now widely planted in many parts of the world. Despite the many advantages of Vicia sativa, the improvement of its yield traits remains a challenge. Traditional breeding methods are time-consuming and inefficient, and cannot meet the rapidly growing market demand. In order to accelerate the breeding process of arrow pea and improve its yield and economic benefits, the present invention combines the whole genome association analysis of arrow pea and the third-generation molecular marker technology to develop InDel molecular markers associated with yield traits. This technology can accurately and efficiently locate gene loci related to yield, providing scientific basis and technical support for the breeding of high-yield arrow pea. Summary of the invention

[0004] One of the purposes of the present invention is to provide a molecular marker related to the yield trait of pea.

[0005] The second object of the present invention is to provide the application of the above-mentioned molecular markers related to the yield traits of pea.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] The invention discloses a pair of molecular markers related to the yield trait of pea stalks, which are located on chromosome 3 of pea stalks. The molecular markers are named Vs_Chr3_168325060.

[0008] The molecular marker Vs_Chr3_168325060 is an insertion / deletion fragment on chromosome 3 of the reference genome of V.

[0009]

[0010] A primer pair for amplifying a molecular marker related to the yield trait of pea, the primer pair sequence corresponding to the molecular marker Vs_Chr3_168325060 is:

[0011] Vs_Chr3_168325060-F: CAAGTGTGAGTAAGTGGGGAAA (shown in SEQ ID NO. 1);

[0012] Vs_Chr3_168325060-R: ACTTCTTGGGTGCATTCAATAC (shown in SEQ ID NO. 2).

[0013] The present invention also discloses the use of the above molecular marker primer pair in assisted breeding of high and low yield traits of peas. Specifically, the molecular marker of the present invention can be used in future molecular marker assisted breeding, by extracting DNA from leaves at the seedling stage, detecting whether the molecular marker of the present invention exists, and then identifying the high and low yield traits of peas. The detection can use the PCR detection method, specifically the above molecular marker primer pair can be used, and the detection can also be performed by sequencing method.

[0014] The present invention also discloses the application of the molecular marker in identifying the yield characteristics of pea oleracea, especially in screening and identifying high-yield pea oleracea. The specific steps for identifying whether pea oleracea has high-yield characteristics are as follows:

[0015] (1) The DNA of the test germplasm was used as a template for PCR amplification, and the primer pair corresponding to the marker Vs_Chr3_168325060 was used as a primer. The reaction system of PCR amplification is shown in Table 1:

[0016] Table 1 PCR amplification reaction system

[0017]

[0018]

[0019] PCR amplification program: pre-denaturation at 98°C for 30s; denaturation at 98°C for 10s, annealing at 55°C for 5s, extension at 72°C for 5s, 35 cycles; extension at 72°C for 5min; storage at 4°C.

[0020] (2) Agarose gel electrophoresis test of PCR products, and judging the yield of peas according to the results:

[0021] If the PCR amplification product is a characteristic band with a length of 354 bp as shown in SEQ ID NO.4, the pea is a low-yield type; if the PCR amplification product is a characteristic band with a length of 250 bp as shown in SEQ ID NO.5, the pea is a high-yield type.

[0022] In addition, a reagent containing the above molecular marker primer pair can be selected to make a kit, which can be used to identify the yield traits of the pea material. Furthermore, the kit can be used to identify or assist in identifying the genotype of the pea. The specific identification method can be:

[0023] (1) extracting genomic DNA of the pea to be tested;

[0024] (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair of the molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product;

[0025] (3) The PCR amplification product is subjected to electrophoresis detection and / or sequencing. If the PCR amplification product is a characteristic band with a length of 354 bp as shown in SEQ ID NO.4, the pea is a low-yield genotype; if the PCR amplification product is a characteristic band with a length of 250 bp as shown in SEQ ID NO.5, the pea is a high-yield genotype. The present invention has the following advantages:

[0026] (1) The molecular markers in the present invention are closely related to the yield traits of pea, and can be applied to molecular marker-assisted breeding of pea yield traits, to the screening of germplasm resources for high-yield pea, and to the genetic improvement of pea.

[0027] (2) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products and high specificity, and can be applied to the breeding practice of pea quickly and with high throughput. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1The figure is the result of genome-wide association analysis of dry weight traits of pea, which is a Manhattan diagram obtained based on EMMAX software analysis. The red sites shown are the InDel positions associated with the present invention.

[0029] Figure 2 Box plot of DW (dry weight) corresponding to different genotypes of the Vs_Chr3_168325060 locus in the genome-wide association analysis. 0 / 0 means that the genotype of the Vs_Chr3_168325060 locus is a low-yield genotype, and 1 / 1 means that the genotype of the Vs_Chr3_168325060 locus is a high-yield genotype. The dots are extreme values ​​of the data, and the values ​​above are the P values ​​for testing differences.

[0030] Figure 3 The sequence differences between the 0 / 0 genotype and the 1 / 1 genotype within the molecular marker Vs_Chr3_168325060 region. Figure 4 This is the electrophoresis diagram of molecular markers amplified from some of the germplasm resources of Aglaonema ovata, and the concentration of agarose gel is 2%. In the figure, M represents DNA marker. DETAILED DESCRIPTION

[0031] The present invention will be described in detail below through specific embodiments. These embodiments are provided to enable a more thorough understanding of the present invention and to fully convey the scope of the present invention to those skilled in the art.

[0032] Unless otherwise specified, the technical means used in the examples are conventional means known to those skilled in the art. The test methods in the following examples are conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can all be purchased from the market.

[0033] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein may be applied to the present invention. The preferred implementation methods and materials described herein are for demonstration purposes only.

[0034] Example 1 Development of molecular markers related to pea yield

[0035] The present invention uses the DW (dry weight, unit g) index to evaluate the yield trait of the pea. The higher the value, the higher the yield of the pea. The lower the value, the lower the yield of the pea. After measuring the DW of the pea population, an InDel site was located in the pea through GWAS analysis ( Figure 1The red site is named Vs_Chr3_168325060. This site is located at the 168325060 site on chromosome 3 of the reference genome of the pea (download URL: http: / / dx.doi.org / 10.5524 / 100954). The first allele type of the inserted InDel is 0 / 0; the second allele type of the deleted InDel is 1 / 1. DW distribution box plot of different genotypes of the Vs_Chr3_168325060 site in the pea population ( Figure 2 ), indicating that the dry weight of the 1 / 1 genotype of the pea material was significantly higher than that of the 0 / 0 genotype. At the 168325060 site on chromosome 3 of the pea, the insertion / deletion fragment was AGAGCCTTTGGTTCGAGAAAGGGATCGAAAAGGACTTGTATCGAATGCTTGTTCCTCAACTTTATATCAATGCTCCTACTATTAACTCCCTCCAACATGGTATT (shown in SEQ ID NO.3) ( Figure 3 ), the 0 / 0 type has the inserted fragment of SEQ ID NO.3, while the 1 / 1 type lacks the inserted fragment of SEQ ID NO.3.

[0036] Based on the InDel variation and its upstream and downstream sequences, the following primers were designed using Primer 5.0 software:

[0037] Vs_Chr3_168325060-F: CAAGTGTGAGTAAGTGGGGAAA (shown in SEQ ID NO. 1);

[0038] Vs_Chr3_168325060-R: ACTTCTTGGGTGCATTCAATAC (shown in SEQ ID NO. 2).

[0039] Then, the primers were used to perform PCR amplification on the samples to be tested. The results showed that the PCR product of the low-yield pea sample had a characteristic band of 354 bp, and the PCR product of the high-yield pea sample had a characteristic band of 250 bp.

[0040] Example 2 Verification of the Accuracy of the Molecular Markers Described in the Present Invention

[0041] 222 germplasms were identified, and the specific germplasm materials used are shown in Table 2:

[0042] Table 2 Dry weight indexes of 222 pea germplasm materials and genotypes corresponding to the Vs_Chr3_168325060 locus

[0043]

[0044]

[0045]

[0046]

[0047]

[0048]

[0049] Note: In the table, genotype . / . represents missing genotype.

[0050] 1) using the genomic DNA of the pea to be identified as a template, performing PCR amplification using the primer pair to obtain a PCR product;

[0051] The reaction system of PCR amplification is as follows: template DNA 10-100ng, 10μM forward primer 1μL, 10μM reverse primer 1μL, 2×Taq PCR Master Mix 5μL, deionized water to 10μL; the reaction program of the PCR amplification is preferably: 98℃ pre-denaturation for 30s; 98℃ denaturation for 10s, 55℃ annealing for 5s, 72℃ extension for 5s, 35 cycles; 72℃ extension for 5min; 4℃ storage. 2% agarose gel electrophoresis separation, 140V DC voltage electrophoresis for 1h after spotting, and then read the PCR band type of each sample.

[0052] 2) Determine the genotype of the pea genotype according to the size of the PCR product: when the PCR product of the pea genotype to be identified contains the fragment shown in SEQ ID NO.3, the pea genotype to be identified is 0 / 0 type; when the PCR product of the pea genotype to be identified lacks the fragment shown in SEQ ID NO.3, the pea genotype to be identified is 1 / 1 type;

[0053] Specifically, when the PCR product of the to-be-identified pea contains the fragment shown in SEQ ID NO.3, and the band length of the PCR product is 354 bp (SEQ ID NO.4), the to-be-identified pea is of 0 / 0 type.

[0054] The sequence of SEQ ID NO.4 is as follows:

[0055]

[0056] When the PCR product of the to-be-identified pea lacks the fragment shown in SEQ ID NO.3, the band length of the PCR product is 250 bp (SEQ ID NO.5), and the to-be-identified pea is of 1 / 1 type.

[0057] The sequence of SEQ ID NO.5 is as follows:

[0058]

[0059]

[0060] The 222 pea materials in Table 2 were analyzed. Except for 6 materials with missing genotypes, 152 pea materials had a genotype of 0 / 0 at the Vs_Chr3_168325060 locus, with an average DW of 18.29972059g, belonging to low-yield pea; 64 pea materials had a genotype of 1 / 1 at the Vs_Chr3_168325060 locus, with an average DW of 22.89925926g, belonging to high-yield pea. The variance analysis showed that the DW difference between high-yield pea and low-yield pea was extremely significant (P<0.01).

[0061] Twenty-four accessions of 222 accessions of V. argentea (accessions numbered 109, 164, 202, 235, 33, 409, 436, 79, 113, 200, 303, 302, 62, 458, 467, 64, 65, 470, 17, 270 and 67) were selected for verification. Figure 4 It can be seen that 7 parts of the pea material amplified a 250bp characteristic band, which is 1 / 1 type. After statistical analysis, the average DW of these 7 pea materials is 22.91833333g; 14 parts of the pea material amplified a 354bp characteristic band, which is 0 / 0 type. After statistical analysis, the average DW of these 14 0 / 0 type pea materials is 12.7675g, which is lower than the DW average value of 7 1 / 1 type pea materials. Variance analysis shows that the DW difference between 0 / 0 type and 1 / 1 type is significant (P<0.01). The 1 / 1 type pea material genotyped by PCR detection results is expected to be a high-yield material, and the actual situation is basically consistent with expectations, with a high accuracy rate. Therefore, the InDel molecular marker of the present invention can effectively identify the yield traits of pea, and can be used for the prediction and screening of high-yield pea varieties.

[0062] The embodiments described above are only preferred embodiments of the present invention and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art, other implementation methods can certainly be easily made by replacement or modification based on the technical contents disclosed in this specification. Therefore, all changes and improvements made on the principles of the present invention should be included in the scope of the patent application of the present invention.

Claims

1. A molecular marker Vs_Chr3_168325060 located on chromosome 3 and associated with the yield trait of pea, characterized in that: The molecular marker Vs_Chr3_168325060 is an insertion / deletion fragment AGAGCCTTTGGTTCGAGAAAGGGATCGAAAAGGACTTGTATCGAATGCTTGTTCCTCAACTTTATATCAATGCTCCTACTATTAACTCCCTCCAACATGGTATT on chromosome 3 of the reference genome of V. argentea, and its corresponding primer pair sequence is: Vs_Chr3_168325060-F: CAAGTGTGAGTAAGTGGGGAAA; Vs_Chr3_168325060-R:ACTTCTTGGGTGCATTCAATAC.

2. Use of the molecular marker described in claim 1 in molecular marker-assisted breeding of pea.

3. The use according to claim 2, characterized in that: The molecular marker is used for identifying or assisting in identifying the yield traits of pea.

4. A method for identifying the high and low yield traits of peas, the method comprising the following steps: (1) extracting genomic DNA of the pea to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair of the molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) Determination is made based on the electrophoresis bands and / or sequencing results of step (2), and the specific criteria are: The genomic DNA of the tested pea was amplified by PCR using primers Vs_Chr3_168325060-F and Vs_Chr3_168325060-R. If the PCR amplification product was a characteristic band with a length of 354 bp as shown in SEQ ID NO.4, the pea was a low-yield type; if the PCR amplification product was a characteristic band with a length of 250 bp as shown in SEQ ID NO.5, the pea was a high-yield type.

5. A kit for identifying the yield of peas, characterized in that Comprising the primer pair described in claim 1.

6. Use of the kit according to claim 5 in identifying the yield genotype of pea.

7. The use according to claim 6, characterized in that: The method for identifying the yield genotype of pea using the kit is as follows: (1) extracting the genomic DNA of the pea to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair of the molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) The PCR amplification product is subjected to electrophoresis detection and / or sequencing. If the PCR amplification product is a characteristic band with a length of 354 bp as shown in SEQ ID NO.4, the pea is a low-yield genotype; if the PCR amplification product is a characteristic band with a length of 250 bp as shown in SEQ ID NO.5, the pea is a high-yield genotype.

Images