Antisense nucleic acids for LMNA mutant carrier treatment

Abstract

The present invention relates to an isolated antisense molecule capable of inhibiting expression of an LMNA gene in a mammalian cell wherein the antisense molecule comprises an antisense nucleic acid strand substantially complementary to a target region of a transcript encoded by an LMNA gene wherein the antisense nucleic acid strand is complementary to at least SNP rs538089, SNP rs505058 or SNP rs4641 in the target region.

Description

Technical Field

[0001] The present invention relates to antisense molecules suitable for treating cardiac diseases. More specifically, the present invention relates to siRNA and shRNA suitable for treating cardiac laminopathy, in particular dilated cardiomyopathy. Background Art

[0002] Currently used treatments for heart failure have successfully improved symptoms and survival in most forms of heart failure. However, for a minority of patients, these evidence-based treatments do not interrupt disease progression, leaving these patients with treatment-resistant heart failure. Ironically, this often involves young patients with inherited forms of heart failure, including those caused by mutations in the lamin A / C (LMNA) gene.

[0003] Currently, more than 450 LMNA mutations have been reported, which cause a wide range of diseases (laminopathies) including dilated cardiomyopathy.

[0004] It is an object of the present invention to provide a method for treating heritable forms of heart failure caused by mutations in the LMNA gene. Summary of the invention

[0005] The present invention provides an isolated antisense molecule capable of reducing or inhibiting the expression of an allele of the LMNA gene in mammalian cells, wherein the antisense molecule comprises an antisense nucleic acid chain that is substantially complementary to a target region of a transcript encoded by the LMNA gene, wherein the antisense nucleic acid chain is complementary to at least SNPrs538089, SNP rs505058 or SNP rs4641 in the target region.

[0006] Preferably, the antisense molecule is capable of reducing the expression of a mutant LMNA allele. In a most preferred embodiment, the antisense molecule is capable of reducing the expression of a mutant LMNA allele while allowing a reduction in the expression of a non-mutated LMNA allele.

[0007] Preferably, the isolated antisense molecule is selected from:

[0008] a. double-stranded nucleic acid (dsNA) or a chemically modified version thereof; or

[0009] b. Antisense Oligonucleotides (ASOs).

[0010] Preferably, the dsNA is RNA, more preferably, the dsNA is a short hairpin (shRNA) or a small interfering RNA (siRNA). Preferably, the dsNA is dsRNA.

[0011] According to the present invention, the preferred isolated antisense molecules comprise antisense nucleic acid chains of 15-30 nucleotides in length. Preferably, the antisense nucleic acid chain is complementary to at least 7, more preferably 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 nucleotides in the target region. In some embodiments, if the antisense molecule specifically binds to the mutant LMNA allele, one or two mismatches may exist between the antisense nucleic acid chain and the target region. Preferably, the antisense nucleic acid chain is complementary to at least 7, more preferably 8, 9, 10, 11 or 12 consecutive nucleotides. Preferably, the target region comprises at least 15, 16, 17, 18 or 19 nucleotides of the target region.

[0012] In a preferred embodiment of the isolated antisense molecule, the target region comprises a nucleic acid sequence selected from the group consisting of:

[0013] i.GAUGACCUGCUCCAUCACCACCACGUGAGUGGUAGCCGCCGCUGA (SEQ ID NO: 1);

[0014] ii.GAUGACCUGCUCCAUCACCACCAUGUGAGUGGUAGCCGCCGCUGA (SEQ ID NO: 2);

[0015] iii.GAUGACCUGCUCCAUCACCACCACGGCUCCCACUGCAGCAGCUC (SEQ ID NO: 3); and

[0016] iv.GAUGACCUGCUCCAUCACCACCAUGGCUCCCACUGCAGCAGUC(SEQ ID NO:4);

[0017] Or a nucleic acid sequence that is at least 80% homologous to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4. More preferably, it is selected from a nucleic acid sequence that is at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4.

[0018] In another preferred embodiment, the target region comprises a nucleic acid sequence selected from the group consisting of:

[0019] i.CCUGCUCCAUCACCACCACGUGAGUGGUAGCCGCCGC (SEQ ID NO: 5);

[0020] ii.CCUGCUCCAUCACCACCAUGUGAGUGGUAGCCGCCGC (SEQ ID NO: 6);

[0021] iii. CCUGCUCCAUCACCACCACGGCUCCCACUGCAGCAGC (SEQ ID NO: 7); and

[0022] iv.CCUGCUCCAUCACCACCAUGGCUCCCACUGCAGCAGC (SEQ ID NO:8); or

[0023] A nucleic acid sequence that is at least 80% homologous to SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8. More preferably, it is selected from nucleic acid sequences that are at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homologous to SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8.

[0024] In a preferred embodiment of the isolated antisense molecule according to the present invention, the antisense nucleic acid strand comprises a nucleic acid sequence having a continuous strand of at least 12, 13, 14, 15, 16, 17, 18 or 19 nucleotides, and the at least 12, 13, 14, 15, 16, 17, 18 or 19 nucleotides are selected from the nucleic acid sequence according to SEQ ID NO: 151, SEQ ID NO: 152, SEQ ID NO: 153 or SEQ ID NO: 154. Preferably, the antisense nucleic acid strand comprises the antisense strand or a nucleic acid analogue sequence thereof as defined in Table 1. Preferably, the antisense nucleic acid strand further comprises a sense strand or a nucleic acid analogue sequence thereof as defined in Table 1. Preferably, the isolated antisense comprises a nucleic acid sequence selected from the group consisting of the sequences shown in SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73 and SEQ ID NO: 74.

[0025] In a preferred embodiment of the isolated dsNA, the dsNA comprises a sense nucleic acid strand having a length of 15-30 nucleotides; and wherein the sense nucleic acid strand is complementary to the antisense nucleic acid strand and the sense nucleic acid strand and the antisense nucleic acid strand form a duplex region.

[0026] Preferably, the antisense strand and the sense strand are operably connected via a loop chain to form a hairpin structure, which comprises a duplex structure and a loop structure. The loop structure may comprise 4 to 13 nucleotides, such as 4, 5 or 6 nucleotides. Preferably, the loop comprises the sequence UCAAGAC.

[0027] In a preferred embodiment of the isolated double-stranded nucleic acid (dsNA) or antisense oligonucleotide (ASO), the length of the antisense nucleic acid chain is preferably 15-30 nucleotides. Preferably, the dsNA is a shRNA as follows: an isolated antisense strand comprising an RNA having a length of 15-30 nucleotides, preferably 19 nucleotides, and having a 5' end and a 3' end, wherein the antisense strand is preferably complementary to at least 15 nucleotides in the target region, and wherein preferably, the 5' end of the RNA sense strand is operably linked to a G nucleotide to form the first segment of the RNA, and the isolated antisense strand of the RNA having a length of 15-30 nucleotides has a 5' end and a 3' end, wherein preferably, at least 12 nucleotides of the antisense strand and the sense strand are complementary to each other and preferably form a small interfering RNA (siRNA) duplex under physiological conditions. Preferably, the siRNA silences only one allele of the LMNA gene in the cell. The duplex formed by the two strands of RNA can be 15 to 25 base pairs in length, preferably 19 base pairs in length. The length of the antisense strand is preferably 19 nucleotides. The length of the sense strand is preferably 19 nucleotides.

[0028] In the present invention, the sense strand and antisense strand of RNA are operably connected through an RNA loop chain to form a hairpin structure to form a "duplex structure" and a "loop structure". The length of these loop structures can be 4 to 13, more preferably, 4 to 10 nucleotides. For example, the length of the loop structure can be 4, 5 or 6 nucleotides. shRNA can also include a single-stranded overhang region. Such a single-stranded overhang can be a 3' single-stranded overhang region or a 5' single-stranded overhang region. The length of the single-stranded overhang region can be, for example, 1-6 nucleotides. In a preferred embodiment, the 5' single-stranded overhang has a nucleic acid sequence CCGG. In a preferred embodiment, the 3' single-stranded overhang has a nucleic acid sequence G.

[0029] The present invention also provides a nucleic acid encoding the isolated double-stranded nucleic acid or ASO of the present invention. In a preferred embodiment, the antisense RNA of the present invention, such as shRNA, is encoded by an oligonucleotide having the following structure: 5′-CCGGAA-19bp sense strand-TCAAGAC-19bp antisense strand-TTTTTTTG-3′ and reverse 5′-AATTCAAAAAAA-19bp sense strand-GTCTTGA-19bp antisense strand-TT-3′. Here, the sense strand is the target sequence of the mRNA, and the antisense strand is the reverse complementary sequence, which will eventually bind to the mRNA and induce its breakage and / or inhibition.

[0030] The present invention also provides an expression cassette, which comprises a nucleic acid encoding the antisense nucleic acid strand according to the present invention. In a preferred embodiment, the nucleic acid encoding the antisense nucleic acid strand according to the present invention comprises a nucleic acid sequence shown in any one of SEQ ID NOs: 75-150.

[0031] These expression cassettes may also include a promoter. Such a promoter may be a regulated promoter or a constitutive promoter. Examples of suitable promoters include CMV, RSV, pol II or pol III promoters. The expression cassette may also include a polyadenylation signal, such as a synthetic minimal polyadenylation signal. The expression cassette may also include a marker gene. In an embodiment, the expression cassette includes 2 nucleic acids encoding the antisense nucleic acid strands according to the present invention, wherein the first nucleic acid encodes an antisense strand that reduces a lamin A isoform, and the second nucleic acid encodes an antisense strand that can reduce a lamin C isoform. The expression of the antisense nucleic acid strand is preferably regulated, so that only one antisense nucleic acid strand is or can be expressed in a target cell.

[0032] The present invention provides a vector comprising the above-mentioned expression cassette. In addition, the vector may comprise two expression cassettes, the first expression cassette comprising a nucleic acid encoding the antisense strand of the RNA duplex, and the second expression cassette comprising a nucleic acid encoding the sense strand of the RNA duplex. Examples of suitable vectors include adenovirus, lentivirus, adeno-associated virus (AAV), poliovirus, HSV or murine leukemia virus vectors. In a preferred embodiment, the vector is a lentiviral vector. In another preferred embodiment, the vector is AAV. Preferably, the expression cassette encodes any of the above-mentioned ASOs or dsNAs.

[0033] The present invention also provides a cell comprising an expression cassette according to the present invention. Preferably, the cell is a mammalian cell, preferably a human cell. Preferably, the cell is a cardiac cell, preferably a human induced pluripotent stem cell-derived cardiomyocyte (hiPSC-CM).

[0034] The present invention also provides a pharmaceutical composition for reducing the expression of LMNA gene in an organism, which comprises the antisense molecule of the present invention and a pharmaceutically acceptable carrier.

[0035] The present invention also comprises isolated antisense molecules according to the present invention for use in medical treatment.

[0036] The present invention also provides an isolated antisense molecule according to the present invention, a nucleic acid encoding an isolated antisense molecule according to the present invention, an expression cassette according to the present invention or an expression vector according to the present invention, and a pharmaceutical composition for treating heart failure according to the present invention. Preferably, the treatment is a laminopathy, preferably, a treatment of dilated cardiomyopathy.

[0037] The present invention also provides a method for selecting an antisense molecule suitable for treating a disease caused by an autosomal dominant mutation occurring on a mutant allele in a gene, the method comprising:

[0038] a. providing a nucleic acid sample from a subject suffering from a disease caused by an autosomal dominant mutation occurring on a mutant allele in a gene;

[0039] b. determining the heterozygosity of a mutant allele in said gene that is the cause of said disease;

[0040] c. determining the presence of a heterozygous SNP in the gene;

[0041] d. determining the nucleic acid sequence of the target region of the heterozygous SNP comprising the mutant allele of the gene;

[0042] e. Selecting isolated antisense molecules that are complementary to the target nucleic acid strand.

[0043] In a preferred embodiment, the antisense molecule is as described herein. Preferably, the gene is the LMNA gene. Preferably, the SNP is selected from rs538089, rs505058 or rs4641.

[0044] The disease is heart failure, in particular a laminopathy, such as dilated cardiomyopathy.

[0045] The present invention also provides a method for reducing the expression of a mutant LMNA allele in a cell in vitro, comprising the following steps:

[0046] (a) introducing an antisense molecule of the present invention into a cell, wherein when the antisense molecule is introduced into a cell expressing a LMNA mutant allele, the expression of the LMNA mutant allele is reduced; and

[0047] (b) maintaining the cells produced in step (a) for a sufficient period of time to obtain degradation of the mRNA transcript of the LMNA mutant allele, thereby reducing the expression of the LMNA mutant allele in the cells. Preferably, the expression of the LMNA mutant gene is at least 20%. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 An overview of the siRNAs designed and tested is shown. The black outline rectangle shows that exon 10 is shared between lamin A and lamin C isoforms. After SNP rs4641 (bold nucleotides, C nucleotides = C allele; T nucleotides = T allele), lamin C continues to connect to exon 10B (grey shaded rectangle), but lamin A continues to connect to exon 11 (grey filled rectangle) and exon 12 (not shown). shRNAs are designed for each specific isoform and target either the C allele or the T allele.

[0049] Figure 2 Shown is a summary of the results of RNA targeting lamin C in LMNAH222P hiPSC-CMs. Figure 2 A shows the relative expression of C allele, T allele and total lamin A after treatment with shRNA targeting the C allele of rs4641 in lamin C. Figure 2 B shows the relative expression of C allele, T allele and total lamin C after treatment with shRNA targeting the C allele of rs4641 in lamin C. Figure 2 C shows the relative expression of C allele, T allele and total lamin A after treatment with shRNA targeting the T allele of rs4641 in lamin C. Figure 2 D shows the relative expression of C allele, T allele and total lamin C after treatment by shRNA targeting the T allele of rs4641 in lamin C. Bars represent mean and error bars represent SEM. N=4-12 in 3-4 experiments.

[0050] Figure 3 Shown is an overview of the results of shRNA targeting LMNA H222P and the C allele of rs4641 of lamin A in healthy hiPSC-CMs. Figure 3 A shows the relative expression of C allele, T allele and total lamin A after treatment with shRNA targeting the C allele of rs4641 of lamin A in LMNAH222 PhiPSC-CMs. Figure 3B shows the relative expression of C allele, T allele and total lamin C after treatment with shRNA targeting the C allele of rs4641 of lamin A in LMNA H222P hiPSC-CMs. Figure 3 C shows the relative expression of C allele, T allele and total lamin A after treatment with shRNA targeting the C allele of rs4641 of lamin A in healthy hiPSC-CMs. Figure 3 D shows the relative expression of C allele, T allele and total lamin C after treatment with shRNA targeting the C allele of rs4641 of lamin A in healthy hiPSC-CMs. Bars represent mean and error bars represent SEM. N=4-9 from 2-3 experiments.

[0051] Figure 4 Summary of the results of shRNA targeting LMNA H222P and the T allele of rs4641 of lamin A in healthy hiPSC-CMs is shown. Figure 4 A shows the relative expression of C allele, T allele and total lamin A after treatment with shRNA targeting the T allele of rs4641 of lamin A in LMNA H222 PhiPSC-CMs. Figure 4 B shows the relative expression of C allele, T allele and total lamin C after treatment with shRNA targeting the T allele of rs4641 of lamin A in LMNA H222P hiPSC-CMs. Figure 4 C shows the relative expression of C allele, T allele and total lamin A after treatment with shRNA targeting the T allele of rs4641 of lamin A in healthy hiPSC-CMs. Figure 4 D shows the relative expression of C allele, T allele and total lamin C after treatment with shRNA targeting the T allele of rs641 of lamin A in healthy hiPSC-CMs. Bars represent mean and error bars represent SEM. N=5-9 from 2-3 experiments.

[0052] Figure 5Shown is the improvement of nuclear roundness after downregulation of mutant LMNA alleles by shRNAT17 targeting the T allele of rs4641 in LMNAH222P hiPSC-CMs. H222P hiPSC-CMs were treated with negative control shRNA (NC), allele-specific shRNA C17 downregulated wild-type LMNA alleles by targeting the C allele of rs4641 (C17), and allele-specific shRNA T17 downregulated mutant LMNA alleles by targeting the T allele of rs4641 (T17). 3 different differentiations N=305-364. Black bars represent mean values, ***=p<0.001.

[0053] Figure 6 Schematic diagram of targeted siRNA is shown. The LMNA gene encodes 2 mRNA splice isoforms, LMNA and LMNC. SNPrs4641 (in bold) is the last nucleotide shared by both isoforms in the middle of exon 10, after which LMNC is not spliced ​​and terminates in exon 10, while LMNA is spliced ​​to exon 11 immediately after rs4641. Due to splicing, we need to design LMNA (lower face of siRNA) and LMNC (upper face of siRNA) specific siRNAs, and we tested the allele-specificity of this siRNA sequence as shown in the accompanying figure. Note that the siRNA sequence is written from 3' to 5', while all other sequences are written from 5' to 3'.

[0054] Figure 7 Shown is shRNA design and its conversion into active siRNA. Virus-encoded shRNA is composed of 2 complementary sequences (grey shading), with non-complementary sequences in the middle. These sequences, when they are transcribed from viruses, can form a hairpin structure, in which the complementary part combines and the non-complementary part forms a loop. This loop is removed by enzyme Dicer, thereby forming siRNA duplexes. For this duplex, so-called guide strand or antisense strand (dark grey shading) is incorporated into the RNA-induced silencing complex, thereby combining and degrading (degrade) targeting mRNA, while other passenger strands or sense strands of siRNA duplexes are degraded.

[0055] Figure 8 Shown are the effects of shRNA targeting the C allele of LMNA on the allele-specific expression of LMNA splice isoforms and LMNC splice isoforms, respectively. A&C show the allele-specific expression of the wild-type (C) allele and mutant (T) allele of LMNA and LMNC, respectively, and the effect of total LMNA expression on the expression of the SCR negative control condition. B&D show the percentage of expression of mutant (T) and wild-type alleles (C) of LMNA and LMNC, respectively, to visualize the balance between the expression of the two alleles.

[0056] Fig. 9 Schematic representation of the mismatches of shRNA-C17 and shRNA-T17 targeting LMNA splice isoforms. The original sequence and the shRNA with the corresponding additional mismatches (underlined in bold) are shown in the figure. Note that the siRNA sequence is written from 3' to 5', while all other sequences are written from 5' to 3'.

[0057] Fig.10 The effect of additional mismatches of shC17 targeting the C allele of LMNA is shown. A&C: Allele-specific expression of wild-type (C) and mutant (T) alleles of LMNA and LMNC and the effect of total LMNA / C expression on expression of SCR negative control conditions are shown, respectively. B&D show the percentage expression of mutant (T) and wild-type alleles (C) of LMNA and LMNC, respectively.

[0058] Fig.11 The effects of shRNA targeting the T allele of LMNA on the allele-specific expression of LMNA and LMNC splice isoforms are shown respectively. A&C show the allele-specific expression of the wild-type (C) allele and mutant (T) allele of LMNA and LMNC, respectively, and the effect of total LMNA expression on the expression of the SCR negative control condition. B&D show the expression percentages of mutant (T) and wild-type alleles (C) of LMNA and LMNC, respectively, to visualize the balance between the expression of the two alleles.

[0059] Fig.12 The effect of additional mismatching of hT17 targeting the T allele of LMNA is shown. A&C show the allele-specific expression of the wild-type (C) allele and mutant (T) allele of LMNA and LMNC, respectively, and the effect of total LMNA / C expression on the expression of the SCR negative control condition. B&D show the percentage expression of the mutant (T) and wild-type alleles (C) of LMNA and LMNC, respectively, to visualize the balance between the expression of the two alleles.

[0060] Fig.13 The effects of shRNA targeting the C allele of LMNC on the allele-specific expression of LMNC and LMNA splice isoforms are shown, respectively. A&C show the effects of allele-specific expression of wild-type (C) alleles and mutant (T) alleles of LMNC and LMNA, respectively, and total LMNA / C expression on the expression of SCR negative control conditions. B&D show the percentage expression of mutant (T) and wild-type alleles (C) of LMNC and LMNA, respectively, to visualize the balance between the expression of the two alleles.

[0061] Fig.14 Schematic representation of mismatches of shRNA-C11, shRNA-C13 and shRNA-T14 targeting LMNC splice isoforms. The original sequence and shRNA with corresponding additional mismatches (underlined in bold) are shown in the figure. Note that siRNA sequences are written from 3' to 5', but all other sequences are written from 5' to 3'.

[0062] Fig.15 The effect of additional mismatching of shCl 1 targeting the C allele of LMNC is shown. A&C show the allele-specific expression of the wild-type (C) and mutant (T) alleles of LMNC and LMNA, respectively, and the effect of total LMNA / C expression on the expression of the SCR negative control condition. B&D show the percentage expression of the mutant (T) and wild-type alleles (C) of LMNC and LMNA, respectively, to visualize the balance between the expression of the two alleles.

[0063] Fig.16 The effect of additional mismatch of shC13 targeting the C allele of LMNC is shown. A&C show the allele-specific expression of the wild-type (C) allele and mutant (T) allele of LMNC and LMNA, respectively, and the effect of total LMNA / C expression on the expression of the SCR negative control condition. B&D show the percentage of expression of the mutant (T) and wild-type allele (C) of LMNC and LMNA, respectively, to visualize the balance between the expression of the two alleles.

[0064] Fig.17 The effects of shRNA targeting the T allele of LMNC on the allele-specific expression of LMNC and LMNA splice isoforms are shown, respectively. A&C show the allele-specific expression of the wild-type (C) allele and mutant (T) allele of LMNC and LMNA, respectively, and the effect of total LMNA / C expression on the expression of the SCR negative control condition. B&D show the expression percentage of the mutant (T) and wild-type alleles (C) of LMNC and LMNA, respectively, to visualize the balance between the expression of the two alleles.

[0065] Fig.18 The effect of additional mismatching of shT14 targeting the T allele of LMNC is shown. A&C show the allele-specific expression of the wild-type (C) allele and mutant (T) allele of LMNC and LMNA, respectively, and the effect of total LMNA / C expression on the expression of the SCR negative control condition. B&D show the percentage expression of the mutant (T) and wild-type allele (C) of LMNC and LMNA, respectively, to visualize the balance between the expression of the two alleles. DETAILED DESCRIPTION

[0066] The present invention is based on the surprising discovery of allele-specific silencing of the LMNA gene by expressing small interfering RNA (siRNA). The inventors significantly reduced the expression of the specific allele of the gene by targeting the region of the gene containing the single nucleotide polymorphism rs4641. The inventors determined the sequence of the PCR amplicon containing rs4641 by using genomic DNA from a healthy control group and a LMNA H222P human induced pluripotent stem cell (hiPSC) line, and then found that the two hiPSC lines were heterozygous carriers of SNP rs4641 (C / T) and did not carry other variants.

[0067] SNP rs4641 is the last shared nucleotide from two mRNA isoforms of LMNA, i.e. lamin A and lamin C. Two isoforms share the first 566 amino acids but differ after exon 10 due to alternative splicing. Lamin A continues to connect exons 11 and 12, but lamin C continues to connect exon 10B. Since SNP rs4641 is the last shared nucleotide of two isoforms, the inventors designed isoform-specific siRNA. In addition, LMNA mutations, i.e. mutations that cause disease, can be located at two alleles of SNP (C or T allele), meaning that the inventors designed siRNA on two SNP alleles of lamin A and lamin C isoforms.

[0068] The inventors showed an increase in nuclear circularity after downregulating the mutant allele of LMNA by shRNA targeting the region where silencing was shown to be effective.

[0069] One object of the present invention is to provide a method of treatment in which mutant alleles are suppressed. In order to distinguish mutant alleles from wild-type (= healthy) alleles, the inventors used a common variant of LMNA (SNP rs4641). Therefore, in order to determine the allele that needs to be suppressed, it is necessary to determine the allele in which the mutation is located. For example, if certain mutations are located in the SNP T allele (i.e., mutations and SNP T are cis), the SNP T allele needs to be suppressed. However, if the mutation is located in the SNP C allele (i.e., mutations and SNP C are cis), the SNP C allele needs to be suppressed. Since the inventors suppress mutant alleles independent of the specific mutations that cause laminopathy, the antisense molecules isolated by the present invention are effective for all mutations in the LMNA gene.

[0070] The inventors used a cell line carrying the LMNA H222P mutation. The H222P mutation is located in the rs4641 T allele. Therefore, by suppressing the rs4641 C allele, they may make the disease worse (because the wild type is the healthy allele), but by suppressing the rs4641 T allele, they may alleviate the disease (suppressing the mutant allele).

[0071] I. Definitions

[0072] The term "antisense molecule" refers to an oligonucleotide molecule that comprises a sequence complementary to a target RNA molecule, such as an mRNA, a viral RNA, or other RNA species, and that, after sequence-specific binding, reduces the function of their target RNA. Examples of antisense molecules are provided by the terms antisense oligonucleotides (ASOs), siRNAs, shRNAs, interfering RNA molecules, and antisense oligomers, which terms may be used interchangeably below.

[0073] The term "nucleic acid" refers to deoxynucleotides or ribonucleotides and polymers thereof in single or double-stranded form, consisting of monomers (nucleotides) containing sugars, phosphates, and bases that are purines or pyrimidines. Unless otherwise specified, the term encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties to reference nucleic acids and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly stated. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues (Batzer et al., (1991) Nucleic Acids Research 19:5081; Ohtsuka et al., (1985) J Biol Chem 260:2605-2608; Rossolini et al., (1994) Mol Cell Probes 8:91-98).

[0074] A "nucleic acid fragment" is a portion of a given nucleic acid molecule.

[0075] The term "nucleotide sequence" refers to a polymer of DNA or RNA that may be single-stranded or double-stranded, optionally containing synthetic, non-natural or modified nucleotide bases that can be incorporated into the DNA or RNA polymer.

[0076] The terms "nucleic acid," "nucleic acid molecule," "nucleic acid fragment," "nucleic acid sequence or segment," or "polynucleotide" are used interchangeably and are also used interchangeably with gene, cDNA encoded by a gene, DNA encoded by a gene, and RNA encoded by a gene.

[0077] The term "nucleic acid analog" refers to compounds that are similar (structurally similar) to naturally occurring RNA and DNA. For example, RNA is a nucleic acid analog of naturally occurring DNA. Nucleic acids are nucleotide chains that consist of three parts: a phosphate backbone, a pentose, a ribose or a deoxyribose; and one of four nucleic acid bases. Analogs may have any of these modifications. Typically, analog nucleic acid bases impart different base pairing and base stacking properties, among other things. Examples include universal bases that can pair with all four standard bases, and phosphate-sugar backbone analogs such as PNA. Artificial nucleic acids include peptide nucleic acids (PNA), morpholino and locked nucleic acids (LNA), as well as glycerol nucleic acids (GNA), threose nucleic acids (TNA), and hexose nucleic acids (HNA). Each of these is distinguished from naturally occurring DNA or RNA by changing the molecular backbone.

[0078] The term "nucleic acid analog sequence of a nucleic acid sequence of a certain SEQ ID NO" refers to a nucleic acid sequence similar to the SEQ ID NO. For example, SEQ ID NO: 83 refers to a DNA sequence ccggaaatca ccaccacgtg agtggtcaagacccactcac gtggtggtga ttttttttg. Its RNA analog nucleic acid has thymidine exchanged with uracil. Another example of a nucleic acid analog sequence of the nucleic acid sequence of SEQ ID NO: 83 is a PNA nucleic acid sequence having the same bases.

[0079] The term "chemically modified version of nucleic acid" refers to a chemical modification of one or more nucleotides in a nucleic acid that does not weaken the binding of the nucleic acid to its complementary strand. Lengthy descriptions of many known chemical modifiers are disclosed in PCT patent application WO200370918, which are incorporated by reference and are therefore not repeated herein. Suitable modifications include, but are not limited to, modifications of sugar moieties (i.e., 2' sites of sugar moieties, such as, for example, 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78, 486-504) i.e., alkoxy) or base moieties (i.e., non-natural or modified bases that maintain the ability to pair with another specific base in an optional nucleotide chain). Other modifications include so-called 'backbone' modifications, which include, but are not limited to, replacement of phosphate groups (connecting adjacent ribonucleotides to, for example, thiophosphates, chiral thiophosphates or dithiophosphates).

[0080] The antisense molecules or dsNA molecules of the present invention may be composed of naturally occurring nucleotides or may include at least one modified nucleotide, such as 2'-O-methyl modified nucleotides, nucleotides containing 5'-thiophosphate groups, and terminal nucleotides linked to cholesteryl derivatives or dodecanoic acid didecylamide groups. Alternatively, the modified nucleotides may be selected from the following groups: 2'-deoxy-2'-fluoro modified nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, abasic nucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, phosphoramides, and unnatural bases, including nucleotides.

[0081] The term "isolated and / or purified" refers to the in vitro separation of nucleic acids, for example, DNA or RNA molecules from their natural cell environment and associated with other components of the cell, such as nucleic acids or polypeptides, so that they can be sequenced, replicated and / or expressed. For example, an "isolated nucleic acid" may be a DNA molecule comprising less than 31 sequential nucleotides transcribed into siRNA. Such an isolated siRNA may, for example, form a hairpin structure having a duplex of 21 base pairs in length, which is complementary or hybridized to the sequence of the gene of interest and remains stably bound under stringent conditions. Thus, RNA or DNA "isolated" is that it does not appear at least one contaminating nucleic acid that is usually associated with the natural source of RNA or DNA and preferably does not substantially appear other mammalian RNA or DNA. The phrase "does not appear at least one contaminating source nucleic acid that is usually associated with..." includes the following situations: the nucleic acid is reintroduced into a contaminating source or natural cell, but is located at a different chromosomal position or is flanked by nucleic acid sequences that are not usually found in the source cell, for example, in a vector or plasmid.

[0082] Fragments and variants of the disclosed nucleotide sequences, and proteins or partial length proteins encoded therefrom are also encompassed by the present invention. By "fragment" or "portion" is meant the full length or less of the full length, or amino acid sequence of a polypeptide or protein encoded by a nucleotide sequence. Please note that the terms "polypeptide" and "protein" are used interchangeably. Both terms refer to molecules consisting of chains of amino acid residues bound together by covalent peptide bonds.

[0083] The term "gene" is used to refer to any nucleic acid fragment related to a biological function. Thus, genes include coding sequences and / or regulatory sequences that they need to express. For example, "gene" refers to a nucleic acid fragment that expresses mRNA, functional RNA or a specific protein, including regulatory sequences. "Gene" also includes, for example, unexpressed DNA segments that form recognition sequences of other proteins. "Gene" can be from various sources, including cloning from a target source or synthesizing and obtaining from known or predicted sequence information, and can include sequences designed to have desired parameters. "Allele" is one of several alternative forms of a gene that occupies a given locus on a chromosome.

[0084] A "variant" of a molecule is a sequence that is substantially similar to the sequence of a native molecule. For nucleotide sequences, variants include those sequences that, due to the degeneracy of the genetic code, encode the same amino acid sequence of a native protein. Naturally occurring allelic variants such as these can be identified using molecular biology techniques, for example, using polymerase chain reaction (PCR) and hybridization techniques. Variant nucleotide sequences also include synthetically derived nucleotide sequences, such as these genes generated, for example, by using site-directed mutagenesis, which encode native proteins, as well as those encoding polypeptides with amino acid substitutions. Typically, the nucleotide sequence variants of the invention have at least 40%, 50%, 60% to 70%, for example, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% to 79%, typically at least 80%, for example, 81%-84%, at least 85%, for example, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% to 98% sequence identity to the native (endogenous) nucleotide sequence.

[0085] "Conservatively modified variations" of a particular nucleic acid sequence refer to those nucleic acid sequences that encode identical or substantially identical amino acid sequences. Due to the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given polypeptide. For example, the codons CGT, CGC, CGA, CGG, AGA, and AGG all encode the amino acid arginine. Thus, at each site of arginine specified by a codon, the codon can be transformed into any of the corresponding codons described without changing the encoded protein. Such nucleic acid variations are "silent variations," which are one of the "conservatively modified variations." Unless otherwise indicated, each nucleic acid sequence encoding a polypeptide described herein also describes each possible silent variation. Those skilled in the art will recognize each codon (except ATG, which is generally the only codon for methionine) in a nucleic acid that can be modified by standard techniques to produce a functionally identical molecule. Therefore, each "silent variation" of a nucleic acid encoding a polypeptide is implicit in each described sequence.

[0086] A "recombinant DNA molecule" is a combination of DNA sequences that have been put together using recombinant DNA techniques and procedures for putting together DNA sequences as described, for example, Sambrook and Russell (2001) "Molecular Cloning". CSHL Press: Long Island, New York, USA.

[0087] A "homologous" DNA or RNA sequence is a sequence naturally associated with a host cell into which it is introduced.

[0088] "Vector" is defined to include, inter alia, any viral vector, and any plasmid, cosmid, bacteriophage or binary vector in double-stranded or single-stranded linear or circular form, which may or may not be self-transmissible or mobilizable, and which can transform a prokaryotic or eukaryotic host by integrating into the cellular genome or existing extrachromosomally (e.g., an autonomously replicating plasmid having an origin of replication).

[0089] As used herein, "expression cassette" means a nucleic acid sequence that can direct the expression of a specific nucleotide sequence suitable for a host cell, which may include a promoter operably connected to a target nucleotide sequence, which is operably connected to a termination signal. It may also include sequences required for the proper translation of the nucleotide sequence. The coding region often encodes a target protein, but may also encode a target functional RNA, such as an antisense molecule, antisense RNA, a non-translated RNA or siRNA in the sense or antisense direction according to the present invention. The expression cassette including the target nucleotide sequence may be chimeric. The expression cassette may also be naturally occurring, but obtained as a recombinant form for heterologous expression. The expression of the nucleotide sequence in the expression cassette may be carried out in a control group of a constitutive promoter or a control group of a regulated promoter, and the constitutive promoter or regulated promoter initiates transcription only when the host cell is exposed to certain specific stimuli. In the case of multicellular organisms, the promoter can also be specific to a specific tissue or organ or development stage.

[0090] "Gene silencing" refers to inhibiting gene expression, e.g., inhibiting expression of a transgene, a heterologous gene, and / or an endogenous gene. Gene silencing can be mediated by processes that affect transcription and / or by processes that affect post-transcriptional mechanisms. In some embodiments, gene silencing occurs when siRNA initiates degradation of the mRNA of a target gene in a sequence-specific manner through RNA interference. In some embodiments, gene silencing can be allele-specific. "Allele-specific" gene silencing refers to the specific silencing of one allele of a gene.

[0091] "RNA interference (RNAi)" is a process of sequence-specific, post-transcriptional gene silencing initiated by siRNA. RNAi is found in a variety of organisms such as fruit flies, nematodes, fungi, and plants, and is believed to be involved in antiviral defense, transduction of transposon activity, and regulation of gene expression. In the RNAi process, siRNA induces degradation of target mRNA, resulting in a sequence-specific reduction, or even inhibition of gene expression.

[0092] "siRNA" or "small-interfering ribonucleic acid" according to the present invention has the meaning known in the art, including the following aspects. siRNA consists of two chains of ribonucleotides that hybridize along complementary regions under physiological conditions. In certain embodiments, the chains are separated, but they are connected by a molecular linker peptide. The individual ribonucleotides can be unmodified naturally occurring ribonucleotides, unmodified naturally occurring deoxynucleotides, or as described elsewhere herein, they can be chemically modified or synthetic.

[0093] "RNA duplex" or "dsRNA" refers to a structure formed by complementary pairing between two regions of an RNA molecule. siRNA "targeting" a gene means that the nucleotide sequence of the duplex portion of the siRNA is complementary to the nucleotide sequence of the LMNA gene. In some embodiments, the length of the duplex of the siRNA is less than 30 nucleotides. In some embodiments, the length of the duplex may be 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, or 10 nucleotides. In some embodiments, the length of the duplex is 19-25 nucleotides. The RNA duplex portion of the siRNA may be a partial hairpin structure. In addition to the duplex portion, the hairpin structure may include a loop portion located between the two sequences forming the duplex. The length of the loop may vary. In some embodiments, the loop is 5, 6, 7, 8, 9, 10, 11, 12, or 13 nucleotides in length. The hairpin structure can also include a 3' or 5' single-stranded overhang portion. In some embodiments, the single-stranded overhang is a 3' or 5' single-stranded overhang of 0, 1, 2, 3, 4, or 5 nucleotides in length.

[0094] The siRNA can be encoded by a nucleic acid sequence, and the nucleic acid sequence can also include a promoter. The nucleic acid sequence can also include a polyadenylation signal. In some embodiments, the polyadenylation signal is a synthetic minimal polyadenylation signal.

[0095] As used herein, "single-stranded nucleotide overhang" refers to unpaired nucleotides or nucleotides that protrude from the duplex structure of a dsRNA when the 3'-end of one strand of the dsRNA extends beyond the 5'-end of the other strand, or vice versa. "Blunt end" or "blunt terminus" means that there are no unpaired nucleotides at the terminus of the dsRNA, i.e., no single-stranded nucleotide overhangs. A "blunt-terminated" dsRNA is a dsRNA that is double-stranded throughout its entire length, i.e., there are no single-stranded nucleotide overhangs at either end of the molecule.

[0096] The term "antisense strand" refers to the strand of a dsRNA that includes a region that is substantially complementary to a target sequence.

[0097] As used herein, the term "region of complementarity" refers to the region on the antisense strand that is substantially complementary to a sequence, eg, a target sequence as described herein.

[0098] As used herein, the term "sense strand" refers to the strand of a dsRNA that includes a region that is substantially complementary to a region of the antisense strand.

[0099] As used herein, "treating" refers to ameliorating at least one symptom of a disease or condition, curing and / or preventing the progression of the disease or condition.

[0100] The term "encoded by" as used herein means that the DNA sequence in the gene or SEQ ID NO is transcribed into the target RNA.

[0101] The term "capable of reducing the expression of the LMNA gene" refers to a process that substantially silences the LMNA gene by RNA interference. RNA interference can be triggered on antisense molecules, including by double-stranded nucleic acids (dsNA) or by single-stranded antisense oligonucleotides (ASOs).

[0102] The "lamin A / C" gene is also known as the LMNA gene. The LMNA gene encodes an mRNA that is spliced ​​into alternative mRNAs that encode different lamins, for example, lamin A or lamin C.

[0103] The process of substantially silencing the LMNA gene by RNA interference is preferably directed to silencing an allele of the LMNA gene specifically, while the expression of the second allele is not altered by the process. In a preferred embodiment, one allele of the LMNA gene is silenced. One of the advantages is that it achieves silencing of the mutant allele, which alleviates the disease phenotype of many heritable forms of heart failure. Currently, more than 450 LMNA mutations have been reported, resulting in a wide range of diseases (laminopathy) including dilated cardiomyopathy. Although mutation hotspots cannot be identified for all of these laminopathy, what they do share is that most of these mutations have a dominant negative effect, indicating that the mutated gene product causes the wild-type product to appear phenotype.

[0104] As used herein, the term "mutant LMNA allele" or "mutant LMNA gene" refers to a variant of an LMNA allele or gene, the product of which has a negative effect on nuclear structure and function. Preferably, the mutant LMNA allele has a dominant negative effect, meaning that heterozygous expression of the mutant allele has a negative effect on nuclear structure and function.

[0105] The terms "antisense oligomer" or "antisense compound" or "antisense oligonucleotide" or "oligonucleotide" are used interchangeably and refer to a sequence of cyclic subunits (i.e., purines or pyrimidines), each carrying a base pairing moiety, connected by intersubunit bonds, which enables the base pairing moieties to hybridize to a target sequence in a nucleic acid (usually RNA) by Watson-Crick base pairing to form an oligomeric heteroduplex within the nucleic acid:target sequence. The cyclic subunits may be based on ribose or other pentose sugars or, in certain embodiments, on morpholino groups. Peptide nucleic acids (PNAs), locked nucleic acids (LNAs) and 2'-O-methyl oligonucleotides and other antisense agents known in the art are also contemplated.

[0106] Such antisense oligomers can be designed to block or inhibit the translation of mRNA or inhibit the splicing processing of natural precursor pre-mRNA, or induce the degradation of targeted mRNA, and can be "pointed to" or "targeted" to a target sequence hybridized therewith. In certain embodiments, the target sequence is a region surrounding or including the AUG start codon of mRNA, the 3' or 5' splicing site or branch point of the pre-processed mRNA. The target sequence may be within an exon or within an intron or a combination thereof. The target sequence of the splicing site may include an mRNA sequence having 1 to about 25 base pairs at its 5' end downstream of the normal splicing acceptor junction of the pre-processed mRNA. The preferred target sequence for splicing is any region of the pre-processed mRNA, which includes a splicing site or is completely contained in an exon coding sequence or spans a splicing acceptor or donor site. The preferred target sequence in the target region of a gene includes a single nucleotide polymorphism (SNP), which achieves, for example, the degradation of a specific allele carrying a mutation. More generally, the oligomer is "targeted" to a biologically relevant target, such as, in the present invention, when the oligomer is targeted to a nucleic acid of a target in the above manner, the target is the human LMNA gene precursor pre-mRNA encoding the lamin A protein. The antisense oligomer is preferably designed to induce the degradation of a specific allele of the human LMNA gene, such as SNPrs4641 T or SNPrs4641 C alleles carrying a disease-causing mutation in a cis configuration. "Antisense oligonucleotide" (ASO) as used herein means an agent of an unmodified or chemically modified single-stranded nucleic acid molecule (often 15-30 nt in length) that can selectively hybridize to their target complementary sequence in mRNA by Watson-Crick base pairing. The formation of ASO-mRNA heteroduplexes induces the following effects: 1) activation of RNase H endonucleases or endoribonucleases such as bacteria - RNase III and RNase E - leading to degradation of bound mRNA, while leaving the ASO intact; 2) translation arrest through steric hindrance of ribosomal activity; 3) inhibition of mRNA splicing; 4) initiation of cleavage of pre-mRNA. In fact, what effects occur depends on the ASO chemical composition and the location of hybridization, but the subsequent result is specific downregulation of target gene and protein expression.

[0107] The term "rs4641" as used herein refers to the SNP located at chr1: 156137743 (GRCh38.p13). See https: / / www.ncbi.nlm.nih.gov / snp / rs4641 published on April 9, 2021. As used herein, when it is present in a transcript encoded by the LMNA gene, it also refers to the corresponding nucleotide polymorphism.

[0108] The term "LMNA mutation" as used herein refers to a mutation in the LMNA gene which preferably has a dominant negative effect and specifically leads to a laminopathy, more specifically a cardiomyopathy.

[0109] Disclosed herein is a strategy that results in substantial silencing of specifically targeted alleles via RNA interference. Use of this strategy results in significant reduction of in vitro and in vivo expression of the target gene or allele. This strategy is used to reduce the expression of the target gene or allele in order to mimic biological processes or provide treatment for human diseases.

[0110] The term "substantially silences" in the context of silencing an allele as used herein means that the mRNA of the targeted allele is specifically inhibited and / or degraded by the presence of the introduced antisense molecule, such that the expression of the targeted allele is reduced by about 10% to 100% compared to the amount of expression observed when the antisense molecule of the invention is not present. Typically, when the allele is substantially silenced, it will have at least 40%, 50%, 60%, 70%, for example, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, typically at least 80%, for example, 81%-84%, at least 85%, for example, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or even 100% reduced expression compared to when the isolated antisense molecule is not present. In contrast, the expression of the non-targeted allele is not substantially altered compared to the amount of expression observed in the absence of the antisense molecule of the invention. The term "substantially silences" as used herein to silence a gene means that the mRNA of the targeted allele is suppressed and / or degenerated by the presence of the introduced isolated antisense molecule, such that the expression of the targeted allele is reduced by about 10% to 100% compared to the amount of expression observed in the absence of the isolated antisense molecule. Typically, when an allele is substantially silenced, it will have at least 40%, 50%, 60% to 70%, e.g., 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% to 79%, typically at least 80%, e.g., 81%-84%, at least 85%, e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or even 100% reduced expression compared to when the isolated antisense molecule is not present. As used herein, the term "substantially normal activity" means the amount of expression of an allele or gene when the isolated antisense molecule is not introduced into a cell.

[0111] like Figure 1As outlined in the strategy, the inventors developed siRNAs that would specifically eliminate the production of lamin A / C protein from mutant alleles (i.e., alleles with disease-causing mutations). By exploiting the base pair differences between wild-type and mutant alleles, the inventors succeeded in allele-specifically silencing the expression of mutant LMNA mRNA without interfering with the expression of wild-type mRNA. Since lamin A / C are essential proteins, it is extremely important to silence only the mutant alleles. This allele-specific strategy has significant therapeutic potential for treating diseases caused by LMNA mutations, particularly laminopathy, including dilated cardiomyopathy.

[0112] In a preferred embodiment, the length of the antisense nucleic acid chain is 15-30 nucleotides.Preferably, at least 7, more preferably 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 nucleotides are complementary to the antisense nucleic acid chain and the target region.In some embodiments, one or two mispairings may exist between the antisense nucleic acid chain and the target region.Preferably, no more than 2 mispairings, more preferably, no more than 1 mispairing.If it occurs, the mispairing will not interfere, for example, the allele-specific targeting of SNP rs538089, SNP rs505058 or SNP rs4641.There is no complementary mispairing in some preferred embodiments. Suitably, depending on the type of nucleotide changes described by Huang et al., one skilled in the art can design mismatch sites with the highest discrimination potential [Nucleic Acids Res 2009, 37, 7560-7569, doi: 10.1093 / nar / gkp835]. Preferably, the antisense nucleic acid strand is complementary to at least 7, more preferably 8, 9, 10, 11 or 12 consecutive nucleotides. Preferably, the target region comprises at least 15, 16, 17, 18 or 19 nucleotides.

[0113] In a preferred embodiment, the isolated antisense molecule is selected from the group consisting of:

[0114] a. double-stranded nucleic acid (dsNA) or a chemically modified version thereof; or

[0115] b. Single-stranded antisense oligonucleotide (ASO).

[0116] Preferred embodiments of dsNA are synthetic double-stranded small interfering RNA (siRNA) and vector-driven short hairpin RNA (shRNA). Both siRNA and vector-driven shRNA have been shown to be effective in in vitro and in vivo applications, each with their own advantages. The structure of most siRNAs is designed to promote effective incorporation into Ago 2 containing RISC, and RNaseIII containing Dicer-substrate design improves the efficiency of siRNA by at least 10 times by early association and processing of precursor pre-RISC. Vector-driven shRNA uses the host microRNA biological origin channel, which seems to be very efficient. siRNA is more easily chemically modified, and shRNA expression can be regulated and controlled by specific promoters. In addition, allele-specific inhibition by shRNA can be persistent because the vector encoding shRNA can be incorporated into the genome of the cell.

[0117] In an embodiment, in order to achieve intracellular expression of therapeutic siRNA, preferably, the RNA molecule is constructed to contain two complementary strands or hairpin sequences (such as 21-bp hairpins) and represent the following sequence: a sequence pointing to a target region encoded by a partial LMNA gene containing SNP rs538089, SNPrs505058 or SNP rs4641. siRNA or a nucleic acid encoding siRNA is introduced into a target cell, such as a diseased heart cell. siRNA reduces protein expression of the target mRNA and the targeted, mutated allele.

[0118] In an embodiment, the dsRNA of the present invention is chemically modified to enhance stability. The nucleic acid of the present invention can be synthesized and / or modified by methods widely recognized in the art, such as those described in "Current protocols in nucleic acid chemistry", Beaucage, SL et al., (Edrs.), John Wiley & Sons, Inc., New York, USA, which are incorporated herein by reference. Chemical modifiers may include but are not limited to 2' modification, introduction of non-natural bases, covalent bonding to ligands, replacement of phosphate bonds with thiophosphate bonds, and combinations thereof. In this embodiment, the integrity of the duplex structure is strengthened by at least one and preferably two chemical bonds. Chemical bonding can be achieved by any of various known techniques, such as by introducing covalent bonds, ionic bonds or hydrogen bonds; hydrophobic interactions, van der Waals forces or stacking effects; by metal ion coordination, or by using purine analogs and combinations thereof. Preferably, chemical groups that can be used to modify dsRNA include, but are not limited to: methyl blue; bifunctional groups, preferably, bis(2-chloroethyl)amine; N-acetyl-N′-(p-acetaldehydebenzoyl)cystamine; 4-thiouracil; and psoralen. In a preferred embodiment, the connecting peptide is a hexaethylene glycol connecting peptide. In this case, the dsRNA is produced by solid phase synthesis, and the hexaethylene glycol connecting peptide is incorporated according to standard methods (e.g., Williams, DJ, and KB Hall, Biochem. (1996) 35: 14665-14670). In a specific embodiment, the 5′-end of the antisense strand and the 3′-end of the sense strand are chemically connected via a hexaethylene glycol connecting peptide. In other embodiments, at least one nucleotide of the dsRNA comprises a phosphorothioate or dithiophosphate group. The end of the dsRNA is preferably formed by a triple helix structure.

[0119] The construct encoding the therapeutic siRNA is configured so that one or more strands of the siRNA are encoded by a nucleic acid that is immediately adjacent to a promoter and is controlled by the promoter, which means that the promoter will drive the expression of the nucleic acid after introduction into the target cell. The construct is introduced into the target cell, such as by injection, thereby reducing the expression of the target-allele in the cell.

[0120] The present invention provides an expression cassette comprising a nucleic acid encoding at least the antisense nucleic acid strand. In some embodiments, the expression cassette comprises a nucleic acid encoding a completely isolated antisense molecule according to the present invention.

[0121] In an embodiment, the siRNA of the present invention can form a hairpin structure comprising a duplex structure and a loop structure. The loop structure can contain from 4 to 13, more preferably 4-10 nucleotides, such as 4, 5 or 6 nucleotides. Preferably, the loop contains the sequence UCAAGAC. The length of the duplex is less than 30 nucleotides, such as from 19 to 25 nucleotides. The siRNA may also include a single-stranded overhang region. This single-stranded overhang may be a 3' single-stranded overhang region or a 5' single-stranded overhang region. The length of the single-stranded overhang region may be, for example, from 1 to 6 nucleotides.

[0122] The present invention also provides an expression cassette comprising an isolated nucleic acid sequence encoding a first segment, a second segment immediately 3' to the first segment, and a third segment immediately 3' to the second segment, wherein the first and third segments are each less than 30 base pairs in length, and the first and third segments are each more than 10 base pairs in length, and wherein the sequence of the third segment is the complement of the sequence of the first segment, and wherein the isolated nucleic acid sequence functions as a small interfering RNA molecule (siRNA) targeting a target gene. The expression cassette can be contained in a vector, such as a viral vector.

[0123] The expression cassette may also comprise a pol II promoter as described herein. Examples of pol II promoters include regulatable promoters and constitutive promoters. For example, the promoter may be a CMV or RSV promoter. The expression cassette may also comprise a polyadenylation signal, such as a synthetic minimal polyadenylation signal. The nucleic acid sequence may also comprise a marker gene. The expression cassette may be contained in a viral vector. Viral vectors suitable for use in the present invention may be adenovirus, lentivirus, adeno-associated virus (AAV), poliovirus, herpes simplex virus (HSV) or murine leukemia virus vectors.

[0124] The present invention provides methods for reducing the expression of a specific gene product in a cell by contacting the cell with the above-described expression cassette. The present invention also provides methods for treating a patient by administering to the patient a component of the above-described expression cassette.

[0125] The present invention also provides a method for reducing the expression of a specific gene product in a cell by contacting the cell with an expression cassette as described above.

[0126] The present invention also provides a method of treating a patient by administering to the patient a composition comprising an expression cassette according to the present invention. The expression cassette preferably comprises shC17, shC17mm5, shC17mm7, shC13mm17, shT14, shT17, shT17mm5 and shT17mm7 as shown in Example 2.

[0127] II. Nucleic Acid Molecules of the Invention

[0128] The source from which the nucleotide sequence of the nucleic acid molecule can be obtained includes any vertebrate, preferably mammalian, cell source.

[0129] In addition to DNA sequences encoding siRNA, nucleic acid molecules of the invention include single-stranded and double-stranded interfering RNA molecules, which are also used to reduce the expression of a target allele.

[0130] Oligonucleotide-mediated mutagenesis is a method for preparing substitution variants. This technology is known in the art. Briefly, the nucleic acid encoding siRNA can be transformed by hybridizing the oligonucleotide encoding the desired mutation with a DNA template, wherein the template is a single-stranded form of a plasmid or bacteriophage comprising an untransformed or native gene sequence. After hybridization, DNA polymerase is used to synthesize the entire second complementary strand of the template, which is thus incorporated into an oligonucleotide primer, and the transformation selected in the nucleic acid encoding the siRNA is encoded. Usually, an oligonucleotide having a length of at least 25 nucleotides is used. Preferably, the oligonucleotide has 12 to 15 nucleotides, and the template on either side of the nucleotide encoding the selected transformation is completely complementary. This just ensures that the oligonucleotide will appropriately hybridize with the single-stranded DNA template molecule. Oligonucleotides are easily synthesized using techniques known in the art.

[0131] The DNA template can be generated by these vectors, which are derived from bacteriophage M13 vectors (the commercially available M13mp 18 and M13 mp 19 vectors are suitable), or these vectors contain a single-stranded phage origin of replication. Thus, the DNA to be modified can be inserted into these vectors, thereby generating a single-stranded template.

[0132] Alternatively, single-stranded DNA templates can be generated by denaturing double-stranded plasmid (or other) DNA using standard techniques.

[0133] In order to transform the native DNA sequence, the oligonucleotide is hybridized to the single-stranded template under appropriate hybridization conditions.Then add DNA polymerase, typically the Klenow fragment of DNA polymerase I, to use the oligonucleotide as the complementary strand of the synthetic primer synthesis template. Form heteroduplex molecules like this, so that the transformation form of a DNA chain encoding DNA, and the natural, untransformed sequence of another chain (original template) encoding DNA. This heteroduplex molecule is subsequently transformed into a suitable host cell, often a prokaryotic organism such as, Escherichia coli JM101. After cell growth, they are inoculated on agarose plates, and use the oligonucleotide primers labeled with 32-phosphate radioactivity to screen, to identify the bacterial colonies containing the transformed DNA. The transformation region is to be removed subsequently and put into a suitable vector, typically an expression vector typically used for the type of host conversion.

[0134] The method described above can be modified so that homoduplex molecules are produced when both strands of the plasmid contain modifications. The modification is as follows: As described above, a single-stranded oligonucleotide is annealed to a single-stranded template. A mixture of three deoxynucleotides, deoxyribonucleotide adenosine (dATP), deoxyribonucleotide guanosine (dGTP) and deoxyribonucleotide thymidine (dTTP) is combined with a modified thiodine deoxyribonucleotide cytosine called dCTP-(*S) (which can be obtained from Amersham Corporation). This mixture is added to the template-oligonucleotide complex. After DNA polymerase is added to this mixture, a chain of DNA identical to the template except for the modified base is generated. In addition, this new chain of DNA contains dCTP-(*S) instead of dCTP, the purpose of which is to prevent it from being digested by restriction endonucleases.

[0135] After the template strand of the double-stranded heteroduplex is nicked with an appropriate restriction endonuclease, the template strand can be digested with ExoIII nuclease or other appropriate nucleases comprising a region exceeding the site to be transformed. The reaction stops subsequently, leaving only partially single-stranded molecules. The complete double-stranded DNA homoduplex is then formed using DNA polymerase in the presence of all four deoxynucleotide triphosphates, ATP and DNA ligase. The homoduplex molecule can be subsequently converted into an appropriate host cell, such as Escherichia coli JM101.

[0136] III. Expression cassette of the present invention

[0137] For the preparation of expression cassettes, the recombinant DNA sequence or segment can be circular or linear, double-stranded or single-stranded. Usually, the DNA sequence or segment is in the form of a chimeric DNA, such as a plasmid DNA or a vector, which may also contain the coding region, flanked by control sequences that promote the expression of the recombinant DNA present in the transformed cells obtained.

[0138] As used herein, a "chimeric" vector or expression cassette refers to a vector or cassette that includes nucleic acid sequences from at least two different species, or has nucleic acid sequences from the same species linked or associated in a manner that is not found in the "native" or wild-type species.

[0139] In addition to the recombinant DNA sequence as a transcription unit of an RNA transcript or a portion thereof, portions of the recombinant DNA may be untranscribed for regulatory or structural functions. For example, the recombinant DNA may have a promoter active in mammalian cells.

[0140] Other elements that function in the host cell, such as introns, enhancers, polyadenylation sequences and the like, may also be part of the recombinant DNA. Such elements may or may not be essential for the function of the DNA, but may improve the expression of the DNA by affecting the transcription, stability, etc. of the siRNA. Such elements may be included in the DNA in order to obtain optimal performance of the siRNA in the cell.

[0141] Control sequences are DNA sequences necessary for the expression of an operably linked coding sequence in a specific host organism. Control sequences suitable for prokaryotes, for example, include promoters and optional operator sequences and ribosome binding sites. Eukaryotic cells are known to use promoters, polyadenylation signals, and enhancers.

[0142] Operably connected nucleic acids are nucleic acids that have a functional relationship with other nucleic acid sequences. For example, if a promoter or enhancer affects the transcription of a sequence, then the promoter or enhancer is operably connected to a coding sequence; or if it is positioned to promote translation, then the ribosome binding site is operably connected to a coding sequence. Generally, an operably connected DNA sequence refers to a DNA sequence that is connected together and continuous. However, enhancers are not necessarily continuous. Connection is completed by connecting at convenient restriction sites. If these sites are not present, synthetic oligonucleotide adapters or connectors are used according to conventional practice.

[0143] The recombinant DNA introduced into the cell may comprise a selective marker gene or a reporter gene or both to facilitate identification and selection of expressing cells from a cell population that is transfected or infected by a viral vector. In other embodiments, the selective marker may be carried on a single piece of DNA and used for co-transfection procedures. Both sides of the selective screening marker and the reporter gene may have appropriate regulatory sequences for expression in the host cell. Useful selective marker screening markers are known in the art and include, for example, antibiotic resistance genes, such as neogenes and the like.

[0144] Reporter gene is used to identify possible transfected cells and for evaluating the functionality of regulatory sequences. Reporter genes encoding proteins that are easy to detect are well known in the art. In general, reporter gene is a gene that does not exist or is not expressed by a receptor organism or tissue, and it encodes a protein whose expression is shown as some easily detectable characteristics, such as enzymatic activity. For example, reporter gene includes the chloramphenicol acetyltransferase gene (cat) from the Tn9 of Escherichia coli and the luciferase gene from the firefly photinus pyralis. The expression of reporter gene is measured at the appropriate time after DNA is introduced into the receptor cell.

[0145] Conventional methods for constructing recombinant DNA capable of transfecting target cells are known to those skilled in the art, and the same components and methods of construction can be used to produce DNA useful herein. For example, Sambrook and Russell, infra, provide suitable construction methods.

[0146] Recombinant DNA can be easily introduced into host cells, for example, mammalian, bacterial, yeast or insect cells, by transfection of expression vectors consisting of DNA, which encode siRNA by any procedure for introduction into specific cells, such as physical or biological methods, thereby producing cells with recombinant DNA, which is stably integrated into its genome or exists as an episomal element, so that the DNA molecules or sequences of the present invention are expressed by the host cells. Preferably, the DNA is introduced into the host cell via a vector. The host cell is preferably of eukaryotic origin, such as plant, mammalian, insect, yeast or fungal origin, but host cells of non-eukaryotic origin can also be used.

[0147] Physical methods for introducing preselected DNA into host cells include calcium phosphate precipitation, liposome transfection, particle bombardment, microinjection, electroporation and similar methods. Biological methods for introducing target DNA into host cells include the use of DNA and RNA viral vectors. As described below, for mammalian gene therapy, it is desirable to use efficient means for inserting copy genes into the host genome. Viral vectors, and particularly retroviral vectors, have become the most widely used methods for inserting genes into mammals (e.g., human cells). Other viral vectors come from poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses and the like.

[0148] As mentioned above, a "transfected" or "transduced" host cell or cell line refers to a cell line whose genome has been altered or enhanced by the presence of at least one heterologous or recombinant nucleic acid sequence. The host cells of the present invention are usually produced by transfection with antisense molecules, DNA sequences of plasmid expression vectors, viral expression vectors, or isolated linear DNA sequences. The transfected DNA can become a chromosomally integrated recombinant DNA sequence, which consists of a sequence encoding the siRNA.

[0149] In order to confirm the presence of the recombinant DNA sequence in the host cell, a variety of tests can be performed. Such tests include, for example, "molecular biology" tests are known to those skilled in the art, such as RDNA blotting and DNA blotting, RT-PCR and PCR; "biochemical" tests, such as detecting the presence or absence of specific peptides, for example, by immunological means (ELISA and immunoblotting) or by the tests described herein to identify agents falling within the scope of the present invention. Such tests include, for example, "molecular biology" tests well known to those skilled in the art, such as Southern and Northern blotting, RT-PCR and PCR; "biochemical" tests, such as detecting the presence and absence of specific peptides, for example, by immunological means (ELISA and Western blotting) or by the tests described herein to identify agents falling within the scope of the present invention.

[0150] In order to detect and quantify the RNA produced by the introduced recombinant DNA segmentation, RT-PCR can be used. When using this PCR, the RNA first needs to be reverse transcribed into DNA, using an enzyme such as reverse transcriptase, and then using conventional PCR techniques to amplify the DNA. In most cases, although PCR technology is useful, it will not prove the integrity of the RNA product. Further information about the properties of the RNA product can be obtained through Northern blotting. This technology proves the presence of RNA species and provides information about RNA integrity. The presence or absence of RNA species can also be determined by using trace or slot blot Northern hybridization. These techniques are Northern blotting modifications and only prove the presence or absence of RNA species.

[0151] Although Southern blotting and PCR can be used to detect problematic recombinant DNA segments, they do not provide information on whether the preselected DNA segment is expressed. Expression can be assessed by either a peptide product that specifically recognizes the introduced recombinant DNA sequence or by assessing the phenotypic changes resulting from expression of the introduced recombinant DNA segment in the host cell.

[0152] The present invention provides a cell expression system for expressing exogenous nucleic acid material in a mammalian recipient. The expression system, also referred to as a "genetically modified cell", comprises a cell for expressing exogenous nucleic acid material and an expression vector. The genetically modified cells are suitable for administration to a mammalian recipient, where they replace the recipient's endogenous cells. Thus, preferred genetically modified cells are non-immortalized and non-tumorigenic.

[0153] According to one embodiment, the cell is transfected or otherwise genetically modified in vitro. The cell is isolated from a mammal (preferably a human), a nucleic acid introduced into a vector (i.e., transduced or transfected in vitro) is used to express a heterologous (e.g., recombinant) gene encoding an antisense molecule therapeutic agent, and is then administered to a mammalian recipient for in situ delivery of the therapeutic agent. The mammalian recipient may be a human and the cell to be modified is an autologous cell, i.e., the cell is isolated from a mammalian recipient.

[0154] According to another embodiment, the cell is transfected or transduced in vivo or otherwise genetically modified. Cells from a mammalian recipient are transduced or transfected in vivo with a vector containing exogenous nucleic acid material, the vector containing exogenous nucleic acid material is used to express a heterologous (e.g., recombinant) gene encoding a therapeutic agent expressing an antisense molecule, and the therapeutic agent is delivered in situ.

[0155] VI. Delivery Vectors for Expression Cassettes of the Invention

[0156] Selection and optimization of a specific expression vector for expressing a specific siRNA in a cell can be achieved by the following methods: obtaining the nucleic acid sequence of the siRNA, using one or more appropriate control regions (such as a promoter, an insertion sequence); preparing a vector construct comprising a vector, into which the nucleic acid sequence encoding the siRNA is inserted; transfecting or transducing cells cultured in vitro with the vector construct; and determining whether the siRNA is present in the cultured cells.

[0157] Vectors used for cell gene therapy include viruses, such as replication-defective viruses. Exemplary viral vectors are from Harvey sarcoma virus, ROUS sarcoma virus, (MPSV), Moloney murine leukemia virus, and DNA viruses (eg, adenovirus).

[0158] Replication-defective retroviruses can directly synthesize all virion proteins, but cannot make interfering particles. Therefore, these genetically modified retroviral expression vectors have general utility for efficient transduction of nucleic acid sequences in cultured cells, and have particular utility for use in the methods of the present invention. Such retroviruses also have utility for efficient transduction of nucleic acid sequences into cells in vivo. Retroviruses are extensively used to transfect nucleic acid material into cells.

[0159] An advantage of using retroviruses for gene therapy is that the virus inserts the nucleic acid sequence encoding the siRNA into the host cell genome, thereby achieving transfer of the nucleic acid sequence encoding the siRNA to the progeny of the cell when it divides. Promoter sequences in the LTR region have been reported to enhance expression of the inserted coding sequence in a variety of cell types. Some disadvantages of using retroviral expression vectors are: (1) insertional mutagenesis, i.e., insertion of the nucleic acid sequence encoding the siRNA into an undesirable location in the target cell genome, which, for example, results in unregulated cell growth; and (2) the need for target cell proliferation in order to integrate the nucleic acid sequence encoding the siRNA carried by the vector into the target genome.

[0160] Another viral candidate for expression vectors used to transform cells is adenovirus, a double-stranded DNA virus. Adenovirus is infectious in a variety of cell types, including muscle cells and endothelial cells. Adenovirus is also used as an expression vector for muscle cells in vivo.

[0161] Adenovirus (Ad) is a double-stranded linear DNA virus with a 36kb genome. Several characteristics of adenovirus make them useful as transgenic delivery vectors for therapeutic applications, such as promoting gene delivery in vivo. It has been demonstrated that recombinant adenovirus vectors can effectively transfer genes in situ to parenchymal cells of various organs, including lungs, brain, pancreas, gallbladder and liver. This makes these vectors useful for treating methods of hereditary genetic diseases (such as cystic fibrosis), in which the vectors can be delivered to target organs. In addition, the ability of adenovirus vectors to achieve in situ tumor transduction has enabled the development of various anticancer gene therapy methods for non-disseminated diseases. In these methods, vector containment is conducive to cancer cell-specific transduction.

[0162] Similar to retroviruses, adenovirus genomes are suitable for use as expression vectors for gene therapy, i.e., by removing the genetic information that controls the production of the virus itself. Since adenoviruses act in an extrachromosomal manner, recombinant adenoviruses do not suffer from the theoretical problem of insertional mutagenesis.

[0163] Traditionally, several methods have been used to generate recombinant adenoviruses. One method involves directly ligating a restriction endonuclease fragment containing the target nucleic acid sequence to a portion of the adenoviral genome. Alternatively, the target nucleic acid sequence can be inserted into a defective adenovirus as a result of homologous recombination. The desired recombinant is identified by screening for individual plaques generated on a lawn of complementing cells.

[0164] Most adenoviral vectors are based on the adenovirus type 5 (Ad5) backbone, in which an expression cassette containing the target nucleic acid sequence is introduced instead of the early region 1 (E1) or the early region 3 (E3). Viruses in which E1 is deleted are replication-defective and are propagated in human complementing cells (e.g., 293 or 911 cells), which provide the deleted gene E1 and pIX in trans.

[0165] Thus, it is apparent to those skilled in the art that a variety of suitable viral expression vectors can transfer exogenous nucleic acid materials to cells. Selecting an appropriate expression vector to express the therapeutic agent for a particular condition suitable for gene silencing therapy, as well as optimizing the conditions for inserting the selected expression vector into the cell, are within the scope of ordinary skill in the art and do not require undue experimentation.

[0166] In other embodiments, the expression vector is in the form of a plasmid that is transferred to the target cells by one of a variety of methods: physically, electroporation, scraping, microprojectile bombardment, or by cellular uptake as a chemical complex (e.g., calcium or strontium coprecipitation, complexation with lipids, complexation with ligands). Several commercial products are available for cationic liposome complexation, including Lipofectin TM (Gibco-BRL, Gaithersburg, Md.) and Transfectam TM (ProMega, Madison, Wis.). However, the efficiency of transfection by these methods is highly dependent on the nature of the target cells, so the conditions for optimal transfection of nucleic acids into cells using the above procedures must be optimized. Such optimization is within the scope of those skilled in the art without undue experimentation.

[0167] VII. Methods for selecting antisense molecules

[0168] In diseases caused by autosomal dominant mutations, one of the alleles of a gene contains a mutation with a dominant negative effect. Therefore, it is desirable to suppress such mutations occurring in the affected allele while achieving expression of the unaffected allele of the gene. In order to select suitable antisense molecules capable of selectively suppressing, i.e. reducing, the affected allele, a nucleic acid sample from a patient suffering from a disease caused by an autosomal dominant mutation is provided. Many such diseases are known. Non-limiting examples of such diseases include tuberous sclerosis, breast cancer, type I neurofibrillary mitosis, Huntington's disease, hypertrophic cardiomyopathy, polycystic kidney disease, brittle bone disease, chondrodysplasia, centronuclear myopathy and Marfan syndrome. In principle, any such disease can be treated by antisense molecules selected according to the present invention. The method of the present invention requires nucleic acid, preferably a DNA sample of the patient. Any biological sample containing DNA from the patient can be used, including but not limited to, blood sample, saliva, buccal mucosa, etc. RNA can be used in certain embodiments. DNA can be separated from the sample according to methods known in the art. The present invention relates to a method for preparing a novel allele of a gene for the present invention. The method comprises the steps of: determining the existence of an autosomal dominant mutation by determining the nucleotide sequence of the two alleles of the gene that exist. Subsequently, alleles are screened to determine whether there is a heterozygous SNP in the allele of the gene. In a preferred embodiment, heterozygous SNP is determined by selecting a synonymous SNP, because the synonymous SNP is expected to have the highest secondary allele frequency (MAF). The nucleotide sequence of the positive strand of the SNP of the gene is determined by methods known in the art. Subsequently, the antisense molecules of separation are selected to comprise an antisense nucleic acid strand and are substantially complementary to the target region of the transcript of the gene encoding, wherein the antisense nucleic acid strand is at least complementary to the SNP described in the target region.

[0169] In a preferred embodiment, the method for selecting the antisense molecule of the present invention further comprises the step of testing the selected antisense molecule in cells to determine the effect on the reduction of expression of the gene. Preferably, the method comprises determining the effect of the reduction of expression of the mutant and / or non-mutated alleles of the gene. Preferably, the method comprises the step of determining the change of the allelic imbalance of the gene. Preferably, the step is performed on cells from a patient.

[0170] In a preferred embodiment, the isolated antisense molecule is selected from the group consisting of:

[0171] a. double-stranded nucleic acid (dsNA) or a chemically modified version thereof; or

[0172] b. Antisense Oligonucleotides (ASOs).

[0173] Preferably, the dsNA is RNA, more preferably, a short hairpin (shRNA) or a small interfering RNA (siRNA). Preferably, the dsNA is dsRNA.

[0174] The term iRNA as used herein refers to a double-stranded RNA molecule consisting of 15-31 base pairs (bp), preferably 20-25bp, and comprising two RNA molecules. The term shRNA as used herein refers to a single RNA molecule forming a hairpin structure, which comprises a partially double-stranded RNA molecule consisting of 15-31bp, preferably 20-25bp, and a single-stranded loop.

[0175] According to the present invention, in the preferred embodiment of the antisense molecule of separation, the length of the antisense nucleic acid chain is 15-30 nucleotides. Preferably, the antisense nucleic acid chain is complementary to at least 7, more preferably 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 nucleotides in the target region. In some embodiments, one or two mismatches may exist between the antisense nucleic acid chain and the target region. Preferably, the antisense nucleic acid chain is complementary to at least 7, more preferably 8, 9, 10, 11 or 12 continuous nucleotides. Preferably, the target region at least comprises 15, 16, 17, 18 or 19 nucleotides in the target region.

[0176] According to the present invention, in a preferred embodiment of the isolated double-stranded nucleic acid (dsNA), the dsNA comprises a sense nucleic acid chain of 15-30 nucleotides in length; and the sense nucleic acid chain is complementary to the antisense nucleic acid chain and the sense and antisense nucleic acid chains form a duplex region. Preferably, the dsNA is a shRNA as follows: it comprises an antisense nucleic acid chain of 15-30 nucleotides in length, preferably an antisense nucleic acid chain of 19 nucleotides in length and having a 5' end and a 3' end, and a sense chain of 15-30 nucleotides in length and having a 5' end and a 3' end, wherein the antisense nucleic acid chain is preferably complementary to at least 15 nucleotides of the target region, and wherein preferably the 5' end of the sense chain of the RNA is operably connected to a G nucleotide to form the first segment of the RNA, wherein preferably at least 12 nucleotides of the antisense chain and the sense chain are complementary to each other and preferably form a small interfering RNA (siRNA) duplex under physiological conditions.

[0177] Preferably, the antisense strand and the sense strand are operably linked via the RNA loop strand to form a hairpin structure comprising a duplex structure and a loop structure.

[0178] Preferably, the loop structure preferably comprises from 4 to 13, more preferably between 4 and 10 nucleotides. In an embodiment, the loop structure comprises 4, 5 or 6 nucleotides. Preferably, the loop comprises the sequence UCAAGAC.

[0179] The duplex formed by the two strands of RNA can be between 15 and 25 base pairs in length, preferably 19 base pairs in length. The antisense strand is preferably 19 nucleotides in length. The sense strand is preferably 19 nucleotides in length. The shRNA can also include a single-stranded overhang region. This single-stranded overhang can be a 3' single-stranded overhang region or a 5' single-stranded overhang region. The single-stranded overhang region can be, for example, from 1 to 6 nucleotides in length.

[0180] The present invention also includes nucleic acids encoding the isolated antisense molecules of the present invention. In a preferred embodiment, the shRNA of the present invention is encoded by an oligonucleotide having the following structure: forward 5′-CCGGAA-19bp sense strand-TCAAGAC-19bp antisense strand-TTTTTTTG-3′ and / or reverse 5′-AATTCAAAAAAA-19bp sense strand-GTCTTGA-19bp antisense strand-TT-3′. Here, the sense strand has the same sequence as the target sequence in the mRNA, and the antisense strand is its reverse complementary sequence, which will eventually bind to the mRNA and induce its breakage and / or inhibition.

[0181] Preferably, the gene is selected from LMNA, voltage-gated potassium channel subfamily Q member 1 (KCNQ1), neurofibromin 1 (NF1), fibrillin 1 (FBN1), breast cancer gene 1 (BRCA1), BRCA2, tuberous sclerosis complex 1 (TSC1) and TSC2 genes. Preferably, the SNP is selected from rs1057128, rs8234 and rs17215465. Preferably, the disease is heart failure, tuberous sclerosis, breast cancer, type I neurofibrillary mitosis, Huntington's disease, hypertrophic cardiomyopathy, polycystic kidney disease, brittle bone disease, chondrodysplasia, centronuclear myopathy and Marfan syndrome. Preferably, the heart failure is laminopathy, preferably dilated cardiomyopathy.

[0182] The present invention is illustrated by the following non-limiting examples.

[0183] Example

[0184] Example 1

[0185] Materials and methods

[0186] Human iPSC Culture Medium

[0187] The LMNA H222P SV1122 hiPSC cell line from a male patient carrying the LMNA H222P mutation was produced in Hamburg, Germany. The UN1-22 cell line was from a healthy male and fully characterized as previously disclosed (Shinnawi, 2015 Stem Cell Reports 2015; 5: 582-596.). Both cell lines are heterozygous for the SNP rs4641 located at LMNA. We cultured colonies of two hiPSC cell lines in mTeSR-1 (StemCellTechnologies; 85850) on plates coated with 1:500 dilution of growth factor-reduced Matrigel (Corning; FAL356231). We passaged the cells every 4-6 days by dissociating using 0.5 mM EDTA (Invitrogen; 15575-038) and re-seeded them in mTeSR-1 supplemented with 2 μM thiazolidine (Selleck Chemicals; S1459). Except for the first day after passaging, we changed the mTeSR-1 medium every day during passaging.

[0188] Cardiac differentiation of hiPSCs

[0189] We performed cardiac differentiation following a previously published protocol with minor modifications (Burridge, 2014 Nat Methods 2014; 11:855-860). We induced differentiation for 3-5 days by changing to CDM3 medium (RPMI 1640, Gibco 21875; 500 μg / ml human serum albumin, Sigma A9731; 213 μg / ml L-ascorbic acid 2-phosphate, Sigma A8960; 1% penicillin / streptomycin) supplemented with 6 μM CHIR99021 (Stemgent; 04-0004-10) for two days, followed by changing to CDM3 supplemented with 2 μM Wnt-C59 (Selleck Chemicals; S7037) for two days. From day 4 to day 10, we changed the medium every other day to RPMI / B27 medium (RPMI-1640, 2% B27 supplement (minus insulin) (Gibco; A1895601), 1% penicillin / streptomycin). Spontaneous contractions could then be identified on day 8. After day 10, we changed the medium on hiPSC-CMs weekly to glucose-free CDM3 medium (RPMI-1640 (glucose-free), Gibco; 11879) supplemented with 20 mM sodium lactate dissolved in 1 M HEPES-solution (Sigma-Aldrich; L7022) for at least 2 weeks to metabolically select cardiomyocytes. After selection, we changed the medium once a week with glucose-containing CDM3 medium.

[0190] We dissociated purified cardiomyocyte populations by incubation with TrypLE Express (Gibco; 12604) for 15 min and plated them on RPMI / B27 Matrigel-coated plates containing 2 μM thiazolyl for further experiments. We performed all experiments on hiPSC-CMs 40–60 days after initiating differentiation and then repeated each observation in 2 to 4 independent experiments using hiPSC-CMs from different differentiations.

[0191] Plasmid generation

[0192] For shRNA expression, we used the pLKO.1 backbone with puromycin as a selection marker (pLKO.1puro; Addgene; 8453). To clone the shRNA sequences, we designed the following oligonucleotides: forward 5′-CCGGAA-19bp sense strand-TCAAGAC-19bp antisense strand-TTTTTTTG-3′ and reverse 5′-AATTCAAAAAAA-19bp sense strand-GTCTTGA-19bp antisense strand-TT-3′. When the sense strand is the mRNA target sequence, the antisense strand is the reverse complementary sequence that will eventually bind to the mRNA. We designed the shRNA sequences according to Huang et al. (2014). We annealed 1 nmol of these oligonucleotides and then cloned them into the AgeI and EcoRI restriction sites in the pLKO.1-puro plasmid. The shRNA sequences are detailed in Table 1. We confirmed all plasmid sequences by Sanger sequencing and excluded plasmids containing mutations.

[0193] Virus production

[0194] To produce the third-generation lentivirus based on the pLKO.1-puro construct, we used Genejammer (Agilent; 204130) according to the manufacturer's protocol to co-transfect 4 × 10 6 HEK293T cells. The next day, we changed the HEK293T medium to CDM3 medium. 24 hours after the previous change, we collected this medium containing the produced lentivirus and then used it directly for hiPSC-CM transduction.

[0195] Infection of HiPSC-CMs

[0196] We dissociated hiPSC-CMs 2 to 4 days before lentiviral transduction to ensure homogeneous cell populations under different conditions. We added fresh hiPSC-CMs to 6-well plates with virus-containing medium at 2 ml / well. After 24 hours, we removed the virus-containing medium and replaced it with fresh CDM3 medium. After 5 days, we changed the medium and started puromycin selection, adding 8 μg / ml puromycin to CDM3 medium for 48 hours. We harvested the cells after puromycin selection.

[0197] RNA Isolation

[0198] We isolated total RNA from all samples using 1 ml of TriReagent (Sigma Aldrich; T9424). We added TriReagent directly to living cells growing on culture dishes. We performed total RNA isolation according to the manufacturer's protocol.

[0199] Allele-specific qRT-PCR of mRNA

[0200] To detect mRNA expression of each LMNA allele, 250 ng to 1 μg of RNA was treated with DNase I amplification grade (Invitrogen; 18068015) and then reverse transcribed using Superscript II reverse transcriptase (Invitrogen; 18064014) with oligo-dT and random primers according to the manufacturer's protocol. The cDNA was diluted 5 times and 2 μl was used as input for qPCR.

[0201] qPCR was performed on a LightCycler 480 system II (Roche) using 1 μM primers (Table 2) and LightCycler 480SYBR Green master 1 (Roche; 04887352001) by the following cycling program: pre-incubation at 95° C. for 5 minutes; denaturation at 95° C. for 10 seconds, annealing (temperature in Table 2) for 20 seconds, and elongation at 72° C. for 20 seconds for 40 cycles. Data were analyzed using LinRegPCR quantitative PCR analysis software (Ruijter, 2009), and the initial concentration of the transcript estimated by the software was corrected to the geometric mean of the estimated initial concentrations of the three reference genes GAPDH, HPRT and TBP.

[0202] Table 1. shRNA target sequences

[0203]

[0204]

[0205] Table 2. Primer sequences used for qRT-PCR

[0206]

[0207]

[0208] result

[0209] To test the hypothesis that mutant alleles are silenced by targeting common variants independent of causal mutations by allele-specific siRNA, we searched for common variants of LMNA in two human induced pluripotent stem cell (hiPSC) lines. Known common single nucleotide polymorphisms (SNPs) appear in LMNA3, i.e., rs538089, rs505058, and rs4641, which have 21.8%, 20.4%, and 32.8% heterozygosity, respectively. We sequenced 3 PCR amplicons containing these 3 SNPs using genomic DNA from our hiPSC cell lines, and then found that the two hiPSC cell lines were heterozygous carriers of SNP rs4641 (C / T) and did not carry other variants. For this reason, we selected SNP rs4641 as a targetable variant in LMNA.

[0210] SNP rs4641 is the last shared nucleotide of the two mRNA isoforms from LMNA (i.e., lamin A and lamin C). The two isoforms share the first 566 amino acids, but due to different alternative splicing after exon 10, lamin A continues to connect to exons 11 and 12, while lamin C continues to connect to exon 10B. Since SNPrs4641 is the last shared nucleotide of the two isoforms, we need to design isoform-specific siRNAs. In addition, LMNA mutations can be located in both alleles of the SNP (C or T alleles), meaning that we need siRNAs for both SNP alleles on both lamin A and lamin C isoforms. Based on the literature and the knowledge acquired about designing siRNAs, we designed siRNAs for each isoform (see Figure 1 ) were designed for each allele of the 24-well gene. Since we envisioned delivering our constructs via gene therapy using short hairpin RNA (shRNA), we used shRNA in our experiments to immediately test the effects of shRNA in human induced pluripotent stem cells derived from cardiomyocytes (hiPSC-CMs).

[0211] No allele-specific effects of shRNA downregulating lamin C were observed

[0212] First, we began testing our shRNA targeting the C allele of lamin C in LMNA H222P hiPSC-CMs. As expected, we did not observe downregulation of the C or T alleles of the lamin A isoform, indicating that our shRNA designed for the C allele of lamin C is isoform specific ( Figure 2 , sample data A). We observed downregulation of the C allele of lamin C by shRNA C11 ( Figure 2 , sample data B). However, we also observed downregulation of the T allele of lamin C by this shRNA, indicating that this shRNA is not allele-specific. All other shRNAs tested did not show any downregulation ( Figure 2 , sample data B).

[0213] We then proceeded to test our shRNA targeting the T allele of lamin C in LMNA H222P hiPSC-CMs. Since no downregulation of the lamin A isoform was observed ( Figure 2 , sample data C), these shRNAs are also isoform specific. We observed downregulation of the T allele of lamin C by shRNA T14 ( Figure 2 , Sample Data D). However, this effect was not allele-specific, as the same amount of downregulation was observed on the C allele of lamin C. All other shRNAs tested did not show any downregulation ( Figure 2 , sample data D).

[0214] In conclusion, our designed shRNAs targeting the C allele or the T allele did not show allele-specific downregulation of lamin C.

[0215] shRNAs C17 and T17 provide isoform- and allele-specific downregulation of lamin A

[0216] Next, we tested shRNAs targeting alleles of lamin A isoforms, starting with the C allele of lamin A. We observed downregulation by shRNA C17 targeting the C allele of lamin A in 40% of LMNA H222P hiPSC-CMs ( Figure 3 , sample data A). In addition, since we did not observe downregulation of the T allele of lamin A, the effect was allele-specific. Moreover, the allele-specific effect was also isoform-specific, since shRNA C17 did not show any downregulation of the lamin C allele ( Figure 3, sample data B). All other tested shRNAs did not show downregulation of lamin A or lamin C. Subsequently, we tested the same shRNAs in healthy hiPSC-CMs. We observed the same effect of shRNA C17, now the targeted C allele of lamin A was even more downregulated by 50% ( Figure 3 , sample data C and D). However, we now also observe a slight effect for the T allele of lamin A.

[0217] Finally, we tested shRNAs targeting the T allele of lamin A. We observed 53% downregulation ( Figure 4 , sample data A). More importantly, the observed effect is allele-specific and isoform-specific ( Figure 4 , Sample Data B). Other shRNAs tested did not show downregulation. As before, we tested the same shRNAs in healthy hiPSC-CMs. Similarly, shRNA T17 showed isoform and 55% allele-specific downregulation ( Figure 4 , sample data C and D).

[0218] In conclusion, we found 2 shRNAs that downregulated the C or T allele of SNP rs4641 of lamin A in 2 different hiPSC-CMs cell lines in an isoform- and allele-specific manner with approximately 50% efficiency.

[0219] Downregulation of the mutant H222P allele by shRNA T17 improved nuclear roundness

[0220] To evaluate the effect of downregulating the C allele or T allele by shRNA C17 and T17 on the nuclear phenotype, we treated H222P hiPSC-CMs with negative control shRNAs, shRNA C17 (downregulation of the C allele) and shRNA T17 (downregulation of the T allele). Plasmids cloning LMNA PCR products surround the SNP and Sanger sequencing of cDNA on the H222P-cell line and bacterial clones showed that the heterozygous H222P mutation is located on the same allele as the T allele of rs4641. Therefore, downregulation of the rs4641 C allele in H222PhiPSC-CMs results in downregulation of the wild-type allele, which is expected to worsen the phenotype, but downregulation of the rs4641 T allele downregulates the mutant allele and is expected to mitigate the phenotype.

[0221] Since LMNA encodes the nuclear lamin A protein, which supports the nuclear membrane, LMNA is important for nuclear architecture. Therefore, nuclear shape is a measure of how severely a cell is affected by certain mutations. We evaluated the effect of shRNA-based downregulation of the wild-type or mutant allele on the nuclear roundness of cells. We measured nuclear roundness after treatment with 2 different conditions compared to a negative control. After downregulation of the wild-type allele, we did not observe a decrease in nuclear roundness. However, more therapeutically interestingly, downregulation of the rs4641 T allele and thereby the mutant allele significantly improved nuclear roundness (p<0.001). See Figure 5 Thus, downregulation of the T allele and thus the H222P mutant allele by shRNA T17 resulted in an increase in nuclear roundness in LMNA H222P hiPSC-CMs, suggesting that these LMNA H222P hiPSC-CMs were less affected by the mutation after downregulation of the mutant allele by shRNA-targeted SNP rs4641.

[0222] Example 2

[0223] Materials and methods

[0224] See Example 1 and add the following:

[0225] Cardiac differentiation of hiPSCs was performed as described previously or following the CHIR dilution protocol, including the addition of 6 mM CHIR99021 in 3 ml CDM3 medium on day 0, 2 ml CDM3 medium on day 1, another 1 ml CDM3 medium on day 2, and 2 mM WNT-C59 in CDM3 on day 3. From days 4 to 5 (no dilution vs dilution protocol) until day 10, we changed the medium every other day to RPMI / B27 medium (RPMI-1640, 2% B27 supplement (minus insulin) (Gibco; A1895601), 1% penicillin / streptomycin).

[0226] Cardiomyocytes were dissociated by incubating them with TrypLE Express (Gibco; 12604) for 15 to 45 minutes before plating them on RPMI / B27 Matrigel-coated plates containing 2 μM Thiazolinone for further experiments.

[0227] For plasmid generation, we designed shRNA sequences according to Huang et al. (2014) and added mismatches based on known interaction regions between miRNAs and their targets and based on the results of the original shRNA selection. Additional shRNA targeting sequences and primer sequences for qRT-PCR are included in Tables 3 and 4, respectively.

[0228] result

[0229] Allele-specific targeted SNP identification

[0230] To allow allele-specific downregulation of LMNA by targeting common SNPs, we searched for synonymous SNPs in the coding region of LMNA, as these SNPs are expected to have the highest minor allele frequency (MAF). As a result, the number of patients heterozygous for these SNPs is the largest, allowing for allele-specific targeted therapy. The study revealed that 3 synonymous SNPs in LMNA (rs538089, rs505058, and rs4641) had MAFs of 18%, 24%, and 21%, respectively, in the Genome Aggregation Database (gnomAD) cohort. These MAFs indicate that, according to the Hardy-Weinberg equilibrium, 29% of patients should be heterozygous for SNP rs538089, 36% should be heterozygous for rs505058, and 33% should be heterozygous for SNP rs4641. This means that targeting these corresponding SNPs will allow the treatment of a similar number of LMNA patients, regardless of the disease causing the mutation. We selected 8 LMNA mutation carriers from the AmsterdamUMC clinic and selected hiPSC cell lines with the H222P mutation of LMNA for heterozygosity of these SNPs, which revealed that 5 patients and hiPSC cell lines were heterozygous for rs4641 and not heterozygous for rs538089 or rs505058. Therefore, we focused our allele-specific shRNA approach on SNP rs4641.

[0231] Design of allele-specific shRNAs for both alleles of rs4641 in LMNA and LMNC The LMNA gene encodes two mRNA splice isoforms, LMNA and LMNC, which share a sequence encoding the first 566 amino acids. While the LMNC isoform is unspliced ​​and terminates at the end of exon 10, alternative splicing in exon 10 results in differences between the two isoforms at their C-termini, while the LMNA isoform uses a splice site in the middle of exon 10 to splice to exons 11 and 12 ( Figure 1 and 6). SNP rs4641 is located at the last nucleotide shared between the two isomers. This is combined with the data of Huang et al. (Huang et al., 2009. Nucleic Acids Res 37:7560-7569), who showed that the highest allele specificity was obtained when the nucleotide that distinguishes the two alleles was located in the middle of the siRNA, which indicates that we need to design allele-specific siRNAs targeting LMNA and LMNC respectively. In addition, since both the T allele and the C allele of the SNP can remain on the mutant allele in different patients, we do not need to design siRNAs targeting the two alleles of SNP rs4641. Based on the data of Huang et al., we selected 6 siRNAs that were predicted to target the C allele of LMNA and mismatched with the non-targeted T allele at positions 10, 11, 12, 13, 14, and 17; and 6 siRNAs that were predicted to target the T allele of LMNA and mismatched with the non-targeted C allele at positions 9, 10, 11, 12, 14, and 17 ( Figure 6 Using a similar approach, we selected five siRNAs predicted to target the C allele of LMNC, which were mismatched with the non-targeted T allele at positions 10, 11, 12, 13, and 17; and seven siRNAs predicted to target the T allele of LMNC, which were mismatched with the non-targeted C allele at positions 9, 10, 11, 12, 14, 16, and 17 ( Figure 6 Since we envisioned therapeutic delivery of these siRNAs via viral-mediated shRNA expression, we also Figure 7 The design of in vitro expression of these siRNAs as viral shRNA constructs is described.

[0232] Allele-specific targeting of rs4641 in the LMNA isoform

[0233] To test the shRNAs, we lentivirally transduced cardiomyocytes from the H222P hiPSC cell line. This cell line is derived from a male patient with an Emory-Des Moines muscular dystrophy phenotype, which affects both skeletal and cardiac muscle (Bonne et al., 2000. Ann Neurol 48:170-80). After lentiviral shRNA transduction, we compared allele-specific qRT-PCR expression levels of mutant and wild-type LMNA alleles with those in cells transduced with a scrambled negative control shRNA (Scr). Targeting the C allele of rs4641 in the LMNA splice isoform, which remains on the wild-type LMNA allele, revealed that one shRNA, shC17, downregulated the wild-type LMNA allele by almost 50%, and the non-targeted mutant allele by only 10% ( Figure 8 A) Because most mutations in LMNA, including the H222P mutation, have a dominant-negative behavior pattern, this means that the mutant allele interferes with the function of the wild-type allele and the allelic balance between the wild-type and this mutant allele determines disease severity. Therefore, we also investigated the extent to which the C allele targeting rs4641 affects the allelic balance between LMNA alleles ( Figure 8 B). This revealed that both alleles were almost equally expressed in this experiment in SCR negative control cells (52:48%), which shifted to relatively low expression of the targeted wild-type LMNA allele in shC17 transduced cells (40:60%). To our surprise, the other shRNAs did not downregulate any LMNA allele, but instead led to upregulation of both wild-type and mutant LMNA alleles. Although we targeted only LMNA splice isoforms by these shRNAs, we also performed allele-specific qRT-PCR on LMNC, which revealed no downregulation of any LMNC allele and therefore no strong effect on the balance between mutant and wild-type LMNC isoforms ( Figure 8 C / D).

[0234] Previous studies have shown that introducing additional mismatches in the seed region or Argonaute recognition region of the shRNA can increase the difference between the targeted and non-targeted alleles. Since our knockout rate of the non-targeted T allele of LMNA splice isoform rs4641 by shC17 was 10%, we added additional mismatches to the shC17 sequence to try to further reduce the targeting. We added mismatches at positions 5, 6, and 7 in the seed region and mismatches at positions 10 and 11 in the argonaute recognition region ( Fig. 9). We varied the nucleotides in the shRNA in a GC-content-stabilizing manner, however, we expect other changes to have similar effects. Allele-specific qRT-PCR after transduction of the original shC17 sequence and shRNA with additional mismatches revealed that shC17mm5 more strongly induced downregulation of the targeted C allele of rs4641 in the LMNA isoform, but also more strongly induced downregulation of the non-targeted T allele ( Fig.10 A). Compared with the original C17 sequence (36: 63% shC17mm5 and 39: 61% shC17; Fig.10 B), which resulted in a slightly stronger shift in allelic balance compared to shC17mm5. Interestingly, shC17mm7 resulted in a similar allelic imbalance of LMNA (40:60%), which was induced by a stronger upregulation of the non-targeted allele than the targeted allele. We again demonstrated that targeting the LMNA splice isoform with these shRNAs did not affect the levels of the LMNC splice isoform. To further investigate whether the absolute level of the mutant allele or the allelic imbalance is the most important factor determining the severity of the disease in patients and the phenotype of our hiPSC-CMs, we decided to further investigate shC17, shC17mm5 and shC17mm7 and compare their effects on the disease phenotype in hiPSC-CMs.

[0235] Since both alleles of the SNP can be present on the mutant LMNA allele in different patients, we also targeted the T allele of rs4641 in LMNA, which is located on the mutant allele in our H222PhiPSC-CMs. This revealed that one shRNA, shT17, downregulated the targeted T allele by 53% and the non-targeted allele by 8% ( Fig.11 A), while all other shRNAs again induced upregulation of both LMNA alleles. The 53% downregulation of the targeted allele also resulted in a shift in the allelic balance from 45:55% in SCR negative control transduced cells to a 61:39% ratio in shT17 transduced cells, meaning that in these cells the ratio shifted from a small relative overexpression of the mutant allele to a relative underexpression of the shT17 mutant allele ( Fig.11 B). shRNA targeting the T allele of the LMNA splice isoform also did not affect the allelic imbalance of the LMNC splice isoform. We also added additional mismatches to the shT17 sequence again at sites 5, 6, and 7 in the seed region and at sites 10 and 11 in the Argonaute recognition region. Interestingly, adding these mismatches to the shC17 sequence, we observed similar effects ( Fig. 9Similarly, mismatches at position 5 induced a stronger downregulation of the targeted T allele, even up to 83%, but also a stronger downregulation of the non-targeted C allele, to 44%. Mismatches at position 7 resulted in a similar downregulation to the original T17 sequence of this experiment (20%), but again resulted in a strong upregulation of the non-targeted C allele ( Fig.12 A). The results are similar to those of the original T17 sequence (70:30%; Fig.12 B), the two shRNAs with mismatches at positions 5 and 7 (76:24% and 74:26%) resulted in a stronger effect on allelic imbalance. Again, these shRNAs did not affect the allelic imbalance of LMNC ( Fig.12 C / D). Since the same question exists as to whether the knockout level of the mutant allele or allelic imbalance is the most important factor in determining the disease severity of patients and the phenotype of our hiPSC-CMs, we also further investigated shT17, shT17mm5, and shT17mm7 and compared their effects on the disease phenotype of hiPSC-CMs.

[0236] Allele-specific targeting of rs4641 in the LMNC isoform

[0237] To test shRNAs targeting LMNC, we lentivirally transduced cardiomyocytes from the H222P hiPSC line with these shRNAs and compared allele-specific qRT-PCR expression of mutant and wild-type LMNC alleles to that in cells transduced with a scrambled negative control shRNA (Scr). Targeting the C allele of rs4641 in the LMNC splice isoform, which is located above the wild-type LMNC allele in this H222P hiPSC cell line, revealed that the C allele of 3 shRNAs, shC11, shC13, and shC17, had 31%, 6%, and 16% knockdown, respectively ( Fig.13). However, shCl 1 also had a 30% knockout of the non-targeted T allele and shC17 also had a 6% knockout. This resulted in a small shift in allelic balance: flipping from 48:51% in transduced cells to 59:41% in shCl 1, to 57:43% in shC13, and to 36:64% in shC17. This resulted in a small shift in allelic balance from 48:51% in scrambled transduced cells to 59:41% in shCl 1, 57:43% in shC13, and 36:64% in shC17. We also determined the effect of these shRNAs on LMNA expression and noted that shC11 also non-allele-specifically suppressed LMNA isoforms by 25% and shC17 increased expression of both C and T alleles, but the T allele was increased to a greater extent, which therefore also resulted in a slight shift in the allelic balance of LMNA (from 48:52% for SCR to 43:57% for shC17). This suggests that shC17 may be a better candidate that can affect both splice isoforms. Considering the results of the mismatches added to shC17 targeting the LMNA isoforms above, we speculate that adding mismatches 5 and 7 to shC17 targeting the LMNC isoforms could also further improve allele-specific targeting of LMNC or induction of allelic imbalance, possibly by also affecting LMNA immediately, which reduces the need to target both splice isoforms separately.

[0238] To further improve allele-specific targeting by targeting the C allele of the LMNC isoform with shC11 and shC13, we added mismatches to these shRNA sequences ( Fig.14 ). Mismatch addition to shC11 did not result in additional downregulation of either the targeted or non-targeted LMNC alleles ( Fig.15 ), shC11mm5 resulted in a stronger small upregulation in the non-targeted allele, which resulted in a slightly stronger allelic imbalance (40:60% scr; 36:64% shC11; and 30:70% shC11mm5). Adding mismatches to the C13 shRNA sequence did result in a stronger downregulation of the targeted C allele in shC13mm17 ( Fig.16 ). However, downregulation of the non-targeted allele was almost as strong, resulting in comparable allelic balance between the original C13 shRNA and shC13mm17 (66:34% vs. 65:35%). However, based on the results of the phenotypic analysis performed on the LMNA-targeting shRNA, this shC13mm17 may be an interesting candidate for further phenotypic analysis if the loss of the absolute level of the mutant allele is more important than the effect on the allelic balance.

[0239] Similarly, since both alleles of rs4641 can be present on the mutant allele in different patients, we also tested shRNAs targeting the T allele of rs4641 in the LMNC isoform. This revealed that both shRNAs were able to downregulate the targeted T allele by 33% for shT14 and 22% for T17, while they also downregulated the non-targeted C allele by 20% and 15%, respectively. To our surprise, the allelic imbalance of shT17 shifted to a relative overexpression of the more strongly downregulated targeted T allele (40:60% vs. 43:57% in the scr). shT14 indeed shifted the allelic imbalance in the desired direction to a relative underexpression of the targeted T allele (51:49%; Fig.17 ). Both shRNAs did not affect the allelic imbalance of the LMNA splice isoforms. We have not added additional mismatches to shT17 targeting the LMNC isoform, however, based on the effects observed after adding mismatches to shT17 targeting the LMNA splice isoform, we can imagine that mismatches 5 and 7 could also improve targeting by shT17. We did add additional mismatches to shT14 ( Fig.18 ), which revealed that there were no shRNAs that could more strongly suppress the targeted T allele or further affect the allelic imbalance.

[0240] Table 3. Other shRNA target sequences

[0241]

[0242]

[0243] Table 4. Oligonucleotides used to clone individual shRNAs into the pLKO-puro plasmid. The forward primer contains the entire shRNA sequence with single-stranded overhangs added for cloning. The shRNA begins with a non-capitalized aa at position 5 / 6 and terminates with a non-capitalized t-segment. Ref: Reference number. Fw: Forward. Rv: Reverse.

[0244]

[0245]

[0246]

[0247]

[0248]

[0249]

[0250]

[0251]

[0252]

[0253]

[0254]

[0255]

[0256]

[0257]

[0258]

[0259]

[0260]

[0261]

[0262]

[0263]

[0264]

[0265]

[0266]

[0267]

[0268]

[0269]

[0270]

[0271]

[0272]

[0273]

[0274]

[0275]

[0276]

[0277]

[0278]

[0279]

[0280]

[0281]

Claims

1. An isolated antisense molecule capable of inhibiting or reducing the allele-specific expression of the LMNA gene in mammalian cells, wherein: The antisense molecule comprises an antisense nucleic acid strand that is substantially complementary to a target region of a transcript encoded by the LMNA gene, wherein the antisense nucleic acid strand is complementary to at least SNP rs538089, rs505058 or rs4641 in the target region.

2. The isolated antisense molecule according to claim 1, wherein the antisense molecule is selected from: Double-stranded nucleic acid (dsNA) or a chemically modified version thereof; or Antisense Oligonucleotides (ASOs).

3. The isolated antisense molecule of claim 1 or 2, wherein the target region comprises a member selected from the group consisting of: GAUGACCUGCUCCAUCACCACCACGUGAGUGGUAGCCGCCGCUGA (SEQ ID NO: 1); GAUGACCUGCUCCAUCACCACCAUGUGAGUGGUAGCCGCCGCUGA (SEQ ID NO: 2); GAUGACCUGCUCCAUCACCACCACGGCUCCCACUGCAGCAGCUC (SEQ ID NO: 3); and GAUGACCUGCUCCAUCACCACCAUGGCUCCCACUGCAGCAGCUC (SEQ ID NO: 4); or A sequence that is at least 80% homologous to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO:

4.

4. The isolated antisense molecule according to any one of claims 1 to 3, wherein the antisense nucleic acid chain comprises a nucleic acid sequence having a continuous chain, wherein at least 12 nucleotides in the continuous chain are selected from the nucleic acid sequence shown in SEQ ID NO: 151, SEQ ID NO: 152, SEQ ID NO: 153 or SEQ ID NO:

154.

5. The isolated antisense molecule of any of the above claims, wherein the antisense nucleic acid comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73 and SEQ ID NO:

74.

6. The isolated antisense molecule according to any one of the above claims, wherein the antisense molecule comprises the antisense nucleic acid shown in SEQ ID NO:73 and SEQ ID NO:

74.

7. The isolated antisense molecule according to any one of claims 1-6, wherein the antisense molecule comprises a sense nucleic acid strand of 15-30 nucleotides in length; and wherein, The sense nucleic acid strand is complementary to the antisense region, and wherein the sense nucleic acid strand and the antisense nucleic acid strand form a duplex region.

8. The isolated antisense molecule according to any one of claims 1-7, wherein the antisense strand and the sense strand are operably linked via an RNA loop strand to form a hairpin structure, wherein the hairpin structure comprises a duplex structure and a loop structure.

9. A nucleic acid encoding the isolated antisense molecule according to any one of the preceding claims.

10. An expression cassette comprising a nucleic acid encoding the antisense molecule of any one of the above claims.

11. An expression vector comprising the expression cassette of claim 10.

12. A pharmaceutical composition comprising the isolated antisense molecule of any one of claims 1-8, the nucleic acid of claim 9, the expression cassette of claim 10 or the expression vector of claim 11; and a pharmaceutically acceptable carrier.

13. Use of the isolated antisense molecule of any one of claims 1 to 8, the nucleic acid of claim 9, the expression cassette of claim 10, the expression vector of claim 11 or the pharmaceutical composition of claim 12 in medical treatment.

14. Use of the isolated antisense molecule of any one of claims 1 to 8, the nucleic acid of claim 9, the expression cassette of claim 10, the expression vector of claim 11 or the pharmaceutical composition of claim 12 in treating heart failure.

15. A method for selecting antisense molecules for treatment of a disease caused by an autosomal dominant mutation occurring in a mutant allele of a gene, the method comprising: providing a nucleic acid sample from a subject having a disease caused by an autosomal dominant mutation occurring in a mutant allele of a gene; determining the heterozygosity of said mutant allele of said gene causing said disease; determining the presence of a heterozygous SNP in the gene; determining the nucleic acid sequence of a target region that contains the heterozygous SNP in a transcript of a mutant allele of the gene; Isolated antisense molecules are selected that are complementary to the target region.

16. A method for inhibiting or reducing the expression of a mutant LMNA allele in a cell in vitro, the method comprising the following steps: Introducing the antisense molecule of the present invention into the cell, wherein when the introduced antisense molecule contacts the cell expressing the LMNA mutant allele, the expression of the LMNA mutant allele is inhibited or reduced; and The cells produced in step (a) are maintained for a period of time sufficient to achieve degradation of the mRNA transcript of the LMNA mutant allele, thereby inhibiting or reducing the expression of the LMNA mutant allele in the cells.

Images