An antitumor molecular preparation targeting ceramide kinase and use thereof

Abstract

The application discloses an anti-tumor molecular preparation targeting ceramide kinase and application thereof, relates to the field of biotechnology, and belongs to the technical field of biology and medicine.The molecular preparation is a small molecule EBV-miR-BART17-5p derived from an Epstein-Barr virus (EBV) coded microRNA, is applied to targeted down-regulation of expression of a ceramide kinase gene, and inhibits activation of a PI3K / AKT / NF-kappa B signal path.The nucleotide sequence of an EBV-miR-BART17-5p mimic is UAAGAGGACGCAGGCAUACAAG, and the nucleotide sequence of an inhibitor is CUUGUAUGCCUGCGUCCUCUUA.The application is used for inhibiting proliferation, migration and invasion of gastric cancer cells, and is further applied to preparation of a drug for treating gastric cancer.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to an anti-tumor molecular preparation targeting ceramide kinase and application thereof. BACKGROUND

[0002] Epstein-Barr virus (EBV) is a linear double-stranded DNA virus, belonging to the lymphotropic virus genus of the herpes virus family. More than 90% of adults worldwide have been infected with EBV, and about 200,000 cancers are caused by EBV infection every year, resulting in about 140,000 deaths. EBV infection can establish long-term latent infection in host cells without any symptoms. However, the reactivation of EBV under certain circumstances can cause serious diseases and is closely related to various malignancies, such as Burkitt's lymphoma (BL), Hodgkin's lymphoma (HL), AIDs-related Non-Hodgkin lymphoma, post-transplant lymphoproliferative disorders (PTLD), diffuse large B cell lymphoma (DLBCL), NK / T cell lymphoma, nasopharyngeal carcinoma (NPC), and EBV-associated gastric cancer (EBVaGC), etc. Although some studies have shown that certain antiviral drugs and proton pump inhibitors can effectively inhibit the replication of EBV, there is no officially approved treatment method at present, and the therapeutic effect of these drugs on latent infection is limited.

[0003] EBV is the first virus discovered to encode viral microRNAs (miRNAs). MiRNAs are a group of small non-coding RNAs that play an important role in gene expression by transcriptional regulation and exert inhibitory effects on target mRNAs. Finding effective diagnostic and therapeutic targets is critical for precision medicine and better outcomes. MiRNAs can serve as measurable epigenomic biomarkers that indicate biological or pathogenic processes, or reflect the body's response to exposure or intervention (e.g., therapeutic treatment). EBV can encode 44 mature miRNAs that can inhibit viral lysis, modulate inflammatory responses, modulate immune evasion, modulate apoptosis, promote tumor metastasis, and modulate tumor cell metabolism. Therefore, studying the implications and potential significance of the different expression of EBV-encoded miRNAs in EBV-related diseases can not only serve as a sensitive indicator for biological detection, but also as a therapeutic target.

[0004] EBV-miR-BART17-5p encoded by EBV is the most common viral miRNA in BL and can be used as a useful factor for the diagnosis or prognosis of BL; it is also a promising therapeutic target that can be used to regulate oncogenes. In addition, the concentration of EBV-miR-BART17-5p in plasma samples of NPC patients remains high, and EBV-miR-BART17-5p is detected in 55% of NPC patients who relapse after treatment, suggesting that it can be used as a candidate biomarker for NPC and a potential biomarker for poor prognosis. During viral infection, EBV-miR-BART17-5p down-regulates the expression of EBV-encoded latent protein LMP1 by targeting it, thereby interfering with the immune recognition function of cytotoxic T cells and reducing cytotoxicity and inhibiting apoptosis. In NPC, EBV-miR-BART17-5p makes nasopharyngeal carcinoma sensitive to chemotherapeutic drugs by targeting the host gene BRCA1, which can help develop effective nasopharyngeal carcinoma therapies. Therefore, EBV-BART17-5p plays various key roles in EBV-related diseases by targeting different genes.

[0005] Therefore, the skilled person in the art is committed to developing a molecular preparation of EB virus microRNA EBV-miR-BART17-5p targeting ceramide kinase and applying it to the treatment of gastric cancer. SUMMARY

[0006] In view of the above defects of the prior art, the technical problem to be solved by the present application is to develop a molecular preparation of EB virus microRNA EBV-miR-BART17-5p targeting ceramide kinase (CERK) and apply it to the treatment of gastric cancer.

[0007] In order to achieve the above-mentioned purpose, the present application provides an anti-tumor molecular preparation targeting ceramide kinase (CERK), which is a microRNA small molecule EBV-miR-BART17-5p derived from an EB virus, and the nucleotide sequence of the small molecule is: UAAGAGGACGCAGGCAUACAAG. The nucleotide sequence of the EBV-miR-BART17-5p mimic is: UAAGAGGACGCAGGCAUACAAG.

[0008] The present application also provides an anti-tumor molecular preparation targeting ceramide kinase, i.e. the mimic of the above EB virus microRNA, which is applied to down-regulate the expression of the CERK gene.

[0009] The present application also provides an anti-tumor molecular preparation targeting ceramide kinase, which is applied to inhibit the activation of the PI3K / AKT / NF-κB signaling pathway.

[0010] The present application also provides an anti-tumor molecular preparation targeting ceramide kinase, which is applied to prepare a drug for treating gastric cancer.

[0011] Further, the drug for treating gastric cancer is a drug for inhibiting the proliferation, migration and invasion of gastric cancer cells.

[0012] The present application also provides an inhibitor for inhibiting the expression of EBV-miR-BART17-5p, and the nucleotide sequence of the inhibitor is: CUUGUAUGCCUGCGUCCUCUUA.

[0013] Further, the mimic and the inhibitor of EBV-miR-BART17-5p are designed and synthesized by using the sequence of EBV-miR-BART17-5p, and it is proved by CCK-8 experiments, subcutaneous tumor formation in NSG mice and intratumoral injection experiments that EBV-miR-BART17-5p can slow down the growth of gastric cancer cells and slow down the subcutaneous tumor formation rate in NSG mice.

[0014] Further, it is proved that EBV-miR-BART17-5p can inhibit the proliferation of gastric cancer cells, and it is proved that the EBV-miR-BART17-5p mimic can inhibit the growth rate of subcutaneous tumors in NSG mice.

[0015] Further, it is proved that EBV-miR-BART17-5p can inhibit the migration and invasion of gastric cancer cells. This suggests that EBV-miR-BART17-5p encoded by EBV may be one of the reasons why EBV-positive gastric cancer has a better prognosis than EBV-negative gastric cancer in clinic.

[0016] Further, the sequence of EBV-miR-BART17-5p is used to design and synthesize the mimic and inhibitor of EBV-miR-BART17-5p, and it is proved that EBV-miR-BART17-5p can weaken the migration and invasion ability of gastric cancer cells through scratch test and Transwell migration and invasion chamber.

[0017] Further, the potential host target gene CERK of EBV-miR-BART17-5p is predicted through bioinformatics analysis, and it is proved that EBV-miR-BART17-5p targets and regulates CERK gene through dual luciferase reporter experiment and Western blot experiment.

[0018] Further, it is proved that EBV-miR-BART17-5p can target host gene CERK and down-regulate the expression of CERK in gastric cancer cells, which provides a new strategy and direction for the precise treatment of gastric cancer.

[0019] Further, it is found that EBV-miR-BART17-5p targets and down-regulates the expression of CERK gene, and then inhibits the activation of PI3K / AKT / NF-κB signaling pathway, resulting in the weakening of the proliferation, migration and invasion ability of gastric cancer cells.

[0020] Further, the Western blot experiment proves that EBV-miR-BART17-5p targets and down-regulates the expression of CERK gene, and then inhibits the activation of PI3K / AKT / NF-κB signaling pathway, and further inhibits the proliferation, migration and invasion of gastric cancer cells by using CERK inhibitor and PI3K inhibitor.

[0021] In the preferred embodiment 1 of the present application, the process of screening and analyzing EBV-miR-BART17-5p and its target gene CERK, and preparing CERK plasmid and the mimic and inhibitor of EBV-miR-BART17-5p is described in detail.

[0022] In another preferred embodiment 2 of the present application, the experimental process that EBV-miR-BART17-5p can target and down-regulate the expression of CERK gene, and then inhibit the activation of PI3K / AKT / NF-κB signaling pathway, and further inhibit the proliferation, migration and invasion of gastric cancer cells is described in detail.

[0023] The present application has the following beneficial technical effects:

[0024] By using the sequence of EBV-miR-BART17-5p to design and synthesize the mimic and inhibitor of EBV-miR-BART17-5p, it is found that EBV-miR-BART17-5p can target the host gene ceramide kinase (CERK) and down-regulate the expression of CERK, thereby inhibiting the proliferation, migration and invasion of gastric cancer cells. At the same time, by using the sequence of EBV-miR-BART17-5p to design and synthesize the mimic and inhibitor of chemically modified EBV-miR-BART17-5p, after AGS cells or AGS-EBV cells are subcutaneously injected into NSG mice to form tumors, and the mimic or inhibitor is injected into the tumor respectively, it is found that EBV-miR-BART17-5p can inhibit the speed of subcutaneous tumor formation in NSG mice.

[0025] The present application provides a new treatment for gastric cancer, by developing a molecular preparation based on EBV-miR-BART17-5, and then injecting EBV-miR-BART17-5p molecular preparation into the tumor of EBV-negative gastric cancer patients, which is expected to inhibit tumor growth, thereby improving the treatment effect and reducing damage to normal cells. In addition, compared with traditional chemotherapy and radiotherapy, the miRNA-based treatment strategy may have lower toxicity and higher safety.

[0026] Through the treatment strategy for EBV-miR-BART17-5p, the metastasis of gastric cancer cells can be effectively inhibited, thereby improving the prognosis of patients; and it can be used as a new treatment and prognosis biomarker for EBV-related cancer.

[0027] The discovery of CERK gene provides a new molecular target for targeted therapy of gastric cancer, which helps to develop more effective therapeutic drugs. The present application discloses an unreported mechanism of EBV infection leading to the occurrence of EBV-related gastric cancer, and provides a potential target or strategy for gastric cancer and other EBV-related cancers, and also provides a new perspective for understanding the carcinogenic process related to EBV infection.

[0028] The concept, specific structure and generated technical effects of the present application will be further described below with reference to the accompanying drawings, so as to fully understand the purpose, features and effects of the present application. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1 is a schematic diagram of the potential targeting relationship between the predicted EBV-miR-BART17-5p encoded by EBV and the host gene CERK of a preferred embodiment 1 of the present application;

[0030] Figure 2is a schematic diagram of the binding site of EBV-miR-BART17-5p and the 3'UTR of CERK gene and the binding site mutation of a preferred embodiment 1 of the present application;

[0031] Figure 3 is a result diagram of the inhibition of cell proliferation, migration and invasion of EBV-miR-BART17-5p in AGS or AGS-EBV cells by using the mimics or inhibitors of EBV-miR-BART17-5p of a preferred embodiment 2 of the present application;

[0032] Figure 4 is a result diagram of the inhibition of tumor growth rate of EBV-miR-BART17-5p in the tumor formed by AGS or AGS-EBV cells by using the chemically modified mimics or inhibitors of EBV-miR-BART17-5p of a preferred embodiment 2 of the present application;

[0033] Figure 5 is a result diagram of the down-regulation of CERK gene expression targeted by EBV-miR-BART17-5p in AGS or AGS-EBV cells by using the mimics or inhibitors of EBV-miR-BART17-5p and pmirGLO-CERK-WT or pmirGLO-CERK-MUT of a preferred embodiment 2 of the present application;

[0034] Figure 6 is a result diagram of the down-regulation of CERK gene expression targeted by EBV-miR-BART17-5p in AGS or AGS-EBV cells by using the phouge-CERK recombinant vector, CERK inhibitor NVP231 and PI3K inhibitor LY294002 of a preferred embodiment 2 of the present application, and the inhibition of the activation of PI3K / AKT / NF-κB signaling pathway. DETAILED DESCRIPTION

[0035] The following reference drawings of the specification introduce the preferred embodiments of the present application, so that the technical content thereof is more clear and convenient to understand. The present application can be embodied in many different forms of embodiments, and the protection scope of the present application is not limited to the embodiments mentioned herein.

[0036] Example 1 EBV-miR-BART17-5p and its target gene CERK, plasmid and mimics and inhibitors

[0037] Using the GSE51575 dataset and TCGA dataset containing EBV-positive gastric cancer samples and EBV-negative gastric cancer samples, the differentially expressed genes that were down-regulated in both datasets were screened by bioinformatics analysis. The relationship between these down-regulated differentially expressed genes and EBV-encoded miRNAs was analyzed using the ViRBase data website, as shown in Figure 1 EBV-miR-BART17-5p may have a potential targeting relationship with the host gene CERK. Then the sequence of EBV-miR-BART17-5p was obtained from the miRBase data website, and the mRNA sequence of the CERK gene was obtained from the NCBI data website, as shown in SEQ ID NO: 1, and the potential targeting binding sequence between EBV-miR-BART17-5p and CERK was predicted using the RNAhybrid data website. Subsequently, the sequence fragment containing the potential binding site in the CERK gene was constructed on the pmirGLO Dual-Luciferase miRNA Target Expression Vector (hereinafter referred to as pmirGLO) vector to form the pmirGLO-CERK-WT recombinant vector; at the same time, the potential binding site was mutated, and the mutated sequence fragment was also constructed on the pmirGLO vector to form the pmirGLO-CERK-MUT recombinant vector, and a schematic diagram was drawn, as shown in Figure 2 The sequence of CERK 3'UTR in the pmirGLO-CERK-WT recombinant vector is: GGAAAGTCTGAGTGAAAGGATGGCCTCATTCTCTTTCTAATCTTGCTGGTTTCAAGATTA; the mutated sequence of CERK 3'UTR in the pmirGLO-CERK-MUT recombinant vector is: GGAAAGTCTGAGTGAAAGGATGCGGAGAAAGAGAAACTAATCTTGCTGGTTTCAAGATTA. In addition, we designed a mimic that can overexpress EBV-miR-BART17-5p and an inhibitor that can inhibit the expression of EBV-miR-BART17-5p according to the sequence of EBV-miR-BART17-5p, and entrusted Suzhou Jimake Gene Co., Ltd. to synthesize. At the same time, we also designed a chemically modified mimic and an inhibitor of EBV-miR-BART17-5p according to the sequence of EBV-miR-BART17-5p, and entrusted Guangzhou Ribobio Biotech Co., Ltd. to synthesize.

[0038] Example 2 EBV-miR-BART17-5p can inhibit the proliferation, migration and invasion of gastric cancer cells

[0039] The expression of EBV-miR-BART17-5p was expressed using a mimic in EBV-negative AGS gastric cancer cells, or the expression of EBV-miR-BART17-5p was inhibited using an inhibitor in EBV-positive AGS-EBV gastric cancer cells, and the cell proliferation, migration and invasion were detected by CCK-8, cell scratch, Transwell migration chamber and Transwell invasion chamber experiments, and the results are shown in Figure 3 As shown in the figure, group A indicates that after overexpression of EBV-miR-BART17-5p in AGS gastric cancer cells, the growth rate of the cells is slower than the control group, the wound healing rate is weaker than the control group, and the cell migration and invasion rate is slower than the control group; group B indicates that after inhibiting the expression of EBV-miR-BART17-5p in AGS-EBV gastric cancer cells, the growth rate of the cells is faster than the control group, the wound healing rate is enhanced than the control group, and the cell migration and invasion rate is faster than the control group. These results together show that EBV-miR-BART17-5p promotes the growth, migration and invasion rate of gastric cancer cells to slow down.

[0040] AGS cells or AGS-EBV cells were injected subcutaneously at 1 cm below the left axillary of NSG mice, and after the tumor was formed, when the tumor reached 5 mm x 5 mm in size, the chemically modified mimic was injected into the tumor formed by AGS cells, and the chemically modified inhibitor was injected into the tumor formed by AGS-EBV cells, and the growth rate of the tumor was observed. The results are shown in Figure 4 As shown in the figure, in group A, the volume and weight of the tumor injected with the mimic in the tumor formed by AGS cells were smaller than those of the control group; in group B, the volume and weight of the tumor injected with the inhibitor to inhibit EBV-miR-BART17-5p in the tumor formed by AGS-EBV cells were larger than those of the control group. These results together show that EBV-miR-BART17-5p mimic can inhibit the growth rate of the tumor.

[0041] EBV-miR-BART17-5p mimic and pmirGLO-CERK-WT or pmirGLO-CERK-MUT were simultaneously expressed in AGS cells, or EBV-miR-BART17-5p inhibitor and pmirGLO-CERK-WT or pmirGLO-CERK-MUT were used in AGS-EBV cells, and the targeting regulation between EBV-miR-BART17-5p and CERK was detected by dual luciferase reporter gene detection experiment, real-time fluorescent quantitative PCR and Western blot, and the results are shown in Figure 5As shown, group A indicates that the activity and expression of CERK gene are inhibited after overexpression of EBV-miR-BART17-5p in AGS gastric cancer cells; group B indicates that the activity and expression of CERK gene are up-regulated after inhibition of EBV-miR-BART17-5p expression in AGS-EBV gastric cancer cells. These results collectively show that EBV-miR-BART17-5p targets and regulates CERK gene and down-regulates its expression.

[0042] The CERK inhibitor NVP 231, the PI3K inhibitor LY294002 purchased from MCE Company and the pCDH-EF1-MCS-T2A-Puro-CERK (hereinafter referred to as phouge-CERK) recombinant vector synthesized by Anhui General Bio Company were used to detect the expression of each protein index by Western blot. The results are shown in Figure 6 As shown, down-regulation of CERK and PI3K, pAKT and NF-κB p65 expression in AGS cells can be observed by EBV-miR-BART17-5p; and up-regulation of PI3K, pAKT and NF-κB p65 expression can also be observed after down-regulation of CERK expression by EBV-miR-BART17-5p and then complementation of CERK gene expression. Up-regulation of CERK and PI3K, pAKT and NF-κB p65 expression in AGS-EBV cells can be observed after inhibition of EBV-miR-BART17-5p expression; and the expression of downstream indicators is inhibited after inhibition of CERK or PI3K expression. It is indicated that EBV-miR-BART17-5p inhibits the activation of PI3K / AKT / NF-κB signaling pathway by targeting and down-regulating CERK expression, and then inhibits gastric cancer cell proliferation, migration and invasion.

[0043] The above describes in detail the preferred embodiments of the present application. It should be understood that those skilled in the art can make many modifications and changes without creative labor based on the concept of the present application. Therefore, any technical solution obtained by logical analysis, reasoning or limited experiment based on the prior art according to the concept of the present application shall be within the protection scope defined by the claims.

Claims

1. Use of an anti-tumor molecular preparation targeting ceramide kinase in the preparation of a drug for treating EBV-negative gastric cancer, characterized in that: The molecular preparation is a small microRNA molecule EBV-miR-BART17-5p encoded by Epstein-Barr virus, and its nucleotide sequence is: UAAGAGGACGCAGGCAUACAAG.

2. The use according to claim 1, characterized in that The drug for treating EBV-negative gastric cancer is a drug that inhibits the proliferation, migration and invasion of gastric cancer cells.

3. A use according to claim 1 or 2, characterized in that: Including targeted downregulation of CERK gene expression.

4. A use according to claim 1 or 2, characterized in that: Including inhibiting the activation of the PI3K / AKT / NF-κB signaling pathway.

Images