Stroke vaccine as well as preparation method and application thereof

Abstract

The invention discloses a stroke vaccine as well as a preparation method and application thereof, and belongs to the technical field of biological medicines. The preparation method of the vaccine comprises the following steps: S1, dissolving the retinoic acid, the polylactic acid-glycolic acid copolymer and the vitamin E polyethylene glycol succinate in an organic solvent A to obtain a solution A; dropwise adding the solution A into the aqueous solvent B, and stirring to obtain retinoic acid PLGA nanoparticles; s2, lipid and escherichia coli outer membrane vesicles OMV are mixed, ice-bath ultrasonic mixing is conducted, then a liposome extruder is used for extrusion, and hybrid vesicles CMV are obtained; and S3, mixing the retinoic acid PLGA nanoparticles and CMV, carrying out ultrasonic mixing in an ice bath, and then extruding by a liposome extruder to obtain the stroke vaccine CPRA. The apoplexy vaccine prepared by the method is uniform and consistent in particle size and good in stability; after the vaccine is injected, the adventitia vesicles are used as antigens, the retinoic acid is used as a reverse adjuvant to induce the generation of tolerant dendritic cells and Treg cells, and meanwhile, the retinoic acid induces the Treg cells to homing intestinal tracts to serve as Treg cell reserve after stroke occurs.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, in particular to a stroke vaccine and a preparation method and application thereof. Background Art

[0002] Stroke, commonly known as stroke, includes ischemic stroke (cerebral infarction) and hemorrhagic stroke (cerebral hemorrhage), and is the leading cause of death and disability among adults worldwide. Currently, tissue plasminogen activator alteplase (tPA) is the only approved thrombolytic drug for clinical use to restore blood perfusion to the infarct site through intravenous thrombolysis.

[0003] Although the application of tPA has improved the prognosis of patients with ischemic stroke, its short treatment window (<4.5 hours), high risk of bleeding, and inability to intervene in post-stroke neuroinflammation and secondary injury have highlighted the urgent need for preventive strategies in the stroke prevention and treatment system. Against the backdrop of the continued rise in the incidence of stroke worldwide, exploring stroke vaccines that improve post-stroke inflammatory status and neural repair through immune regulation may provide a breakthrough direction for the treatment of stroke, thereby making up for the shortcomings of the current treatment model that focuses on acute phase intervention. However, there are few reports on stroke vaccine technology in existing technologies. Summary of the invention

[0004] In view of the current lack of stroke vaccines, the present invention provides a stroke vaccine for improving stroke prognosis and a preparation method thereof, which is expected to change the defects of the current stroke treatment model.

[0005] Since the regulatory T cells (Treg cells) in the intestine can chemotaxis to the stroke site, improve neuroinflammation and repair damaged nerves, and the function of Treg cells is independent of antigen specificity. Intestinal Treg cells are regulated by intestinal commensal flora, tolerant dendritic cells (tolDCs) and retinoic acid. Therefore, the present invention selects bacterial components as antigens, adds retinoic acid as a reverse adjuvant, and utilizes the ability of retinoic acid to induce Treg cells to home to the intestine, and designs a vaccine for subcutaneous or intramuscular injection, which can achieve an increase in intestinal Treg cells as a reserve of Treg cells after a stroke occurs.

[0006] The stroke vaccine provided by the present invention is prepared by the following method: S1. Preparation of retinoic acid PLGA nanoparticles: Retinoic acid, polylactic acid-co-glycolic acid (PLGA) and vitamin E polyethylene glycol succinate (TPGS) are dissolved in an organic solvent A to obtain a solution A; the solution A is added dropwise to an aqueous solvent B at a dropping speed of 1-50 drops / s, a stirring temperature of 15-50°C, and a magnetic stirring speed of 1-100 r / min for 1 h-24 h to evaporate and remove the organic solvent A to obtain retinoic acid PLGA nanoparticles.

[0007] The organic solvent A includes but is not limited to one of acetone, methanol, ethanol and acetonitrile.

[0008] The aqueous solvent B is selected from water, physiological saline, and phosphate buffer.

[0009] S2, preparing hybrid vesicle CMV, the steps are as follows; S21. Extract the outer membrane vesicles (OMV) of Escherichia coli; the specific method is as follows: Take the frozen Escherichia coli culture lacking the LPS virulence gene and streak it on the LB solid plate for recovery. After culturing at 37°C overnight, pick the colony and inoculate it in LB liquid culture medium. After culturing for 10 hours, inoculate it in LB liquid culture medium at a volume ratio of 1:100, and culture it at 37°C. When the OD600 value is detected between 0.7-1, collect the culture liquid; centrifuge the culture liquid at 4°C 5000 g for 30 min, concentrate the supernatant using a 100 kDa ultrafiltration tube, centrifuge the concentrate at 4°C 200000 g for 2 hours, and collect the precipitate to obtain the outer membrane vesicle OMV. The LPS virulence gene includes one or more of LpxM (or msbB), LpxL, and pagP.

[0010] S22. The lipids and outer membrane vesicles OMV are mixed, ultrasonically mixed in an ice bath using an ultrasonic cell disruptor, and then extruded using a liposome extruder to obtain hybrid vesicles CMV.

[0011] S3. Retinoic acid PLGA nanoparticles and hybrid vesicles CMV were mixed, ultrasonically mixed in an ice bath using an ultrasonic cell disruptor, and then extruded using a liposome extruder to obtain the stroke vaccine CPRA.

[0012] Preferably, in step S22, the mass ratio of the lipid to the outer membrane vesicle OMV is (0.1-100): (1-100). The lipid includes but is not limited to any one of dendritic cell membrane, soybean lecithin, egg yolk lecithin, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (abbreviated as DOPE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (abbreviated as DSPE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-(methoxypolyethylene glycol) (abbreviated as DSPE-MPEG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-(polyethylene glycol)-2000 (abbreviated as DSPE-PEG2000), and 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-polyethylene glycol)-5000 (abbreviated as DSPE-PEG5000).

[0013] Further preferably, the lipid is a dendritic cell membrane, and the extraction method is to disperse the cells in 10 mM HEPES and 1 mM PMSF, use an ultrasonic cell disruptor No. 6 ultrasonic probe for ice bath ultrasound, select 4% power, ultrasound working time 2s, ultrasound interval time 2s, ultrasound duration 8min. The mass ratio of the lipid to OMV is 2:1.

[0014] Preferably, in step S22, the ultrasonic cell disruptor uses a No. 3 or No. 6 ultrasonic probe, the power is selected to be 1-20%, the ultrasonic working time is 0.1s-2s, the ultrasonic intermittent time is 0.1s-10s, and the ultrasonic duration is 1s-10min.

[0015] Preferably, in step S22, the liposome extruder uses one of 100 nm, 200 nm, 400 nm, and 800 nm extrusion membranes, and the number of extrusions is 1-10 times.

[0016] Preferably, in step S3, the mixing ratio of retinoic acid PLGA nanoparticles and hybrid vesicles CMV is: based on the mass of PLGA in the nanoparticles, the mass ratio of PLGA to hybrid vesicles CMV is (1-100):1.

[0017] Preferably, in step S3, the ultrasonic cell disruptor uses a No. 3 or No. 6 ultrasonic probe, the power is selected to be 1-20%, the ultrasonic working time is 0.1s-2s, the ultrasonic intermittent time is 0.1s-10s, and the ultrasonic duration is 1s-10min.

[0018] Preferably, in step 3, the liposome extruder uses one of 100 nm, 200 nm, 400 nm, and 800 nm extrusion membranes, and the number of extrusions is 1-10 times.

[0019] The stroke vaccine can be used in the following seven areas: (1) Prevent and / or improve ischemic stroke; (2) Prevent and / or improve hemorrhagic stroke; (3) Prevent and / or improve myocardial infarction; (4) Prevent and / or improve atherosclerosis; (5) Prevent and / or improve diabetes; (6) Prevent and / or improve allogeneic organ transplant rejection; (7) Prevent and / or improve xenotransplant rejection.

[0020] The stroke vaccine is used by subcutaneous or intramuscular injection. After injection, the outer membrane vesicles serve as antigens and retinoic acid serves as a reverse adjuvant to induce the generation of tolerant dendritic cells and Treg cells. At the same time, retinoic acid induces Treg cells to home to the intestine as a Treg cell reserve after a stroke occurs.

[0021] Compared with the prior art, the present invention is beneficial in that: (1) The stroke vaccine provided by the present invention has uniform particle size and good stability. It uses Escherichia coli outer membrane vesicles containing anti-inflammatory LPS as antigens and retinoic acid as a reverse adjuvant to induce the generation of tolerant dendritic cells and Treg cells. At the same time, the intestinal homing effect induced by retinoic acid causes tolerant dendritic cells and Treg cells to home to the intestine. Because intestinal Treg cells can respond to inflammatory signals of the body, through vaccination, Treg cells stored in the intestine in advance can actively improve neuroinflammation and prognosis after a stroke occurs.

[0022] (2) The anti-inflammatory and repair functions of Treg cells are not antigen-specific, so the selected Escherichia coli outer membrane vesicles can be used as universal antigens, avoiding the risk of using stroke markers as antigens to mistakenly induce autoimmune diseases.

[0023] (3) The stroke vaccine provided by the present invention has conventional raw materials, a simple preparation method, and good uniformity, which is conducive to actual production and application.

[0024] Other advantages, objectives and features of the present invention will be embodied in part through the following description, and in part will be understood by those skilled in the art through study and practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a diagram of the gene knockout results of Example 1 of the present invention.

[0026] Figure 2 The figure is a schematic diagram of the process of preparing the stroke vaccine of the present invention.

[0027] Figure 3 This is a particle size distribution diagram of the stroke vaccine obtained in Example 2 of the present invention.

[0028] Figure 4 This is a transmission electron micrograph of the stroke vaccine obtained in Example 2 of the present invention.

[0029] Figure 5 This is a diagram of the lymph node targeting results of the stroke vaccine obtained in Example 3 of the present invention.

[0030] Figure 6 This is a flow cytometry test result of the stroke vaccine regulating mouse BMDCs obtained in Example 4 of the present invention.

[0031] Figure 7 This is a flow cytometry test result of BMDCs regulating T lymphocytes obtained in Example 4 of the present invention.

[0032] Figure 8This is a flow cytometry test result showing that the stroke vaccine obtained in Example 5 of the present invention regulates Treg cells in the inguinal lymph nodes and mesenteric lymph nodes of mice.

[0033] Fig. 9 This is a flow cytometry test result of the stroke vaccine obtained in Example 5 of the present invention regulating BMDCs in the inguinal lymph nodes and mesenteric lymph nodes of mice. DETAILED DESCRIPTION

[0034] The preferred embodiments of the present invention are described below in conjunction with the accompanying drawings. It should be understood that the preferred embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0035] Example 1 The method for constructing Escherichia coli lacking the LPS virulence gene is as follows: In this example, the Escherichia coli Nissle1917 strain was selected. Due to the strong pro-inflammatory ability of wild-type Escherichia coli lipopolysaccharide, it will affect the generation of tolDCs and Treg cells. Therefore, LPS virulence genes, including LpxM, LpxL and pagP, were selected for knockout. The steps are roughly as follows: sgRNA sequences targeting LpxM, LpxL, and pagP are designed, and after Cas9 protein cutting, the homologous arm fragments on both sides of the LpxM, LpxL, and pagP genes are used to repair the DNA group.

[0036] The LpxM-sgRNA sequence is CAGCATGGCAGGAATATCGA, see SEQ ID No: 1 for details.

[0037] The sequence of LpxL-sgRNA is TCAGTGGATTATCGTTCGGG, see SEQ ID No: 2 for details.

[0038] The pagP-sgRNA sequence is TATAACGAGCGACCGTGGGG, see SEQ ID No: 3 for details.

[0039] The LpxM-sgRNA, LpxL-sgRNA, and pagP-sgRNA sequences were respectively connected to the pTargetF plasmid and transferred into Escherichia coli Nissle1917 that had been transfected with the pCas plasmid in advance to construct Escherichia coli Nissle1917 with LpxM, LpxL, and pagP gene deletions, which were frozen for later use.

[0040] The results of gene knockout are as follows Figure 1 As shown, the results showed that compared with the wild-type Escherichia coli, the LpxM, LpxL, and pagP genes were successfully knocked out.

[0041] Example 2 A method for preparing a stroke vaccine CPRA, such as Figure 2 As shown, the steps are as follows: Step 1: Dissolve 0.5 mg retinoic acid (RA), 10 mg PLGA and 100 mg TPGS in 3 mL acetone to obtain a mixed solution; under stirring conditions of 10 r / min, add the mixed solution to 10 mL of water at 37°C at a rate of 2 drops / s and stir for 6 h to obtain retinoic acid PLGA nanoparticles.

[0042] Step 2: The frozen LPS virulence gene LpxM, LpxL, and pagP gene-deficient Escherichia coli Nissle1917 bacterial solution constructed in Example 1 was streaked on an LB solid plate for recovery, and after overnight culture at 37°C, colonies were picked and inoculated into LB liquid culture medium. After culturing for 10 h, they were inoculated into LB liquid culture medium at a volume ratio of 1:100 and cultured at 37°C. When the OD600 value was detected to be between 0.7 and 1, the bacterial solution was collected, centrifuged at 4°C 5000 g for 30 min, the supernatant was concentrated using a 100 kDa ultrafiltration tube, and the concentrate was centrifuged at 4°C 200000 g for 2 h, and the precipitate was collected to obtain outer membrane vesicles OMVs.

[0043] Step 3: Extract and culture mouse bone marrow-derived dendritic cells (DCs), disperse the cells in 10 mM HEPES and 1 mM PMSF, use an ultrasonic cell disruptor No. 6 ultrasonic probe for ice bath sonication, select 4% power, ultrasonic working time 2 s, ultrasonic interval time 2 s, ultrasonic duration 8 min, after sonication, centrifuge at 4°C 1000 g for 5 min, take the supernatant, and centrifuge at 4°C 20000 g for 30 min to obtain dendritic cell membrane (DCM).

[0044] Step 4: Mix dendritic cell membrane (DCM) and outer membrane vesicle OMV at a mass ratio of 2:1, use ultrasonic cell disruptor No. 6 ultrasonic probe for ice bath sonication, select 1% power, ultrasonic working time 0.5 s, ultrasonic interval time 2 s, and ultrasonic duration 3 s. After the sonication is completed, use a 400 nm liposome extruder to extrude, extrude 5 times, and obtain hybrid vesicle CMV.

[0045] Step 5: Mix retinoic acid PLGA nanoparticles and hybrid vesicle CMV, the mixing ratio is that the mass ratio of PLGA in retinoic acid PLGA nanoparticles to the mass ratio of hybrid vesicle CMV is 10:1. Use ultrasonic cell disruptor No. 6 ultrasonic probe for ice bath ultrasonication, the power is selected as 1%, the ultrasonic working time is 0.5 s, the ultrasonic interval time is 2 s, and the ultrasonic duration is 3 s. After the ultrasonication is completed, use a 400nm liposome extruder to extrude, extrude 5 times, and obtain the stroke vaccine CPRA.

[0046] The test results showed that the stroke vaccine CPRA had an encapsulation rate of 60.10% for retinoic acid and a drug loading of 1.19%. The particle size was 150.6±21.5 nm, the dispersion index PDI was 0.38±0.1, the Zeta potential was -25.08±4.28 mV, and the particle size distribution was as follows: Figure 3 shown.

[0047] Figure 4 This is a transmission electron micrograph of the stroke vaccine CPRA. It can be seen that the particle size of the stroke vaccine CPRA is about 50-100nm, and the surface is covered with a cell membrane of about 10 nm.

[0048] Example 3 Testing the lymph node targeting ability of stroke vaccines: Since retinoic acid does not have fluorescence, the retinoic acid in Example 2 was replaced with the fluorescent dye IR780 of the same mass and similarly poorly soluble in water for lymph node targeting.

[0049] The nanoparticles prepared by the present invention have a particle size of about 100 nanometers and have the ability to target lymph nodes. In Example 2, OMV hybridized the dendritic cell membrane, giving the nanoparticles the ability to target homologously, further promoting the uptake of the stroke vaccine by dendritic cells in the lymph nodes. The lymph node targeting ability of the stroke vaccine was investigated using in vivo imaging technology, and the results are as follows: Figure 5 As shown. It can be seen that the free drug without PLGA encapsulation shows a weak fluorescence intensity in the inguinal lymph nodes; after PLGA encapsulation, the fluorescence intensity of the inguinal lymph nodes is significantly improved; and the CPRA encapsulated with outer membrane vesicles and dendritic cell membranes has a further improved lymph node targeting ability. The above results show that only after small molecule drugs are nanosized can lymph node targeting be achieved and the proportion of drugs entering the blood circulation be reduced. The modification of dendritic cell membranes and bacterial outer membrane vesicles can further improve the lymph node targeting ability.

[0050] Example 4 In vitro experiments were used to verify the ability of stroke vaccine CPRA to induce immune tolerance: The present invention mainly targets dendritic cells, induces them to produce immune tolerance, and promotes the generation of Treg cells. First, mouse bone marrow-derived dendritic cells (BMDCs) were extracted in vitro and incubated with stroke vaccines for 7 days (1×10 6 BMDCs were incubated with CPRA carrying 25 nM retinoic acid and 5 ng outer membrane vesicles, and the levels of CD86, CD103, and MHC-II were detected by flow cytometry. In addition, BMDCs treated with stroke vaccine for 7 days were incubated with spleen lymphocytes to detect the ability of stroke vaccine to induce Treg cells through BMDCs.

[0051] Dendritic cell flow cytometry results Figure 6 As shown, from Figure 6 (A) It can be seen that the outer membrane vesicles (△mLp) lacking LpxM, LpxL, and pagP genes significantly reduced the level of CD86 compared with the wild-type Escherichia coli Nissle1917 (wt EcN), proving that the loss of LPS virulence genes contributes to the formation of tolerance; the stroke vaccine CPRA group also significantly reduced the level of CD86 compared with the wild-type Escherichia coli Nissle1917. Figure 6 (B) showed that compared with wt EcN, △mLp significantly reduced the MHC-II level, while the stroke vaccine CPRA group further reduced the MHC-II level compared with the △mLp and RA groups. Figure 6 (C) shows that there is no significant difference between wt EcN, △mLp, and RA compared with the blank group, indicating that the presence of simple vesicles or retinoic acid cannot induce the generation of CD103 dendritic cells. Only the stroke vaccine CPRA significantly increased the level of CD103 dendritic cells used to induce Treg cells. The presence of simple free retinoic acid alone cannot induce the generation of CD103 dendritic cells. Only the stroke vaccine CPRA that completely carries retinoic acid and is coated with outer membrane vesicles can induce the generation of CD103 dendritic cells. The above results show that outer membrane vesicles and retinoic acid that lack the LPS toxicity gene are indispensable for inducing tolerance as components of stroke vaccines.

[0052] The BMDCs cells after tolerance were co-cultured with Treg cells. The levels of Treg cells were Figure 7 As shown, from Figure 7 (A) It can be seen that the stroke vaccine group has the highest level of Treg cell ratio; Figure 7 (B) It can be seen that compared with the blank group, the stroke vaccine group significantly increased the proportion of CCR9 intestinal homing receptors. Importantly, Figure 7 (A) It was also demonstrated that wild-type outer membrane vesicles alone, outer membrane vesicles lacking LPS toxicity, and retinoic acid alone could not induce the generation of Treg cells. The above results indicate that the stroke vaccine of the present invention can successfully induce immune tolerance in vitro.

[0053] Example 5 In vivo immunogenicity and gut homing performance testing of stroke vaccines: C57B / 6J mice were subcutaneously inoculated with retinoic acid (0.375 μg / kg) on ​​the tail on day 0 and subcutaneously inoculated with retinoic acid (0.375 μg / kg) on ​​the tail on day 7. Inguinal lymph nodes were collected on day 14, and the levels of CD103 on dendritic cells and Treg cells were detected by flow cytometry. The results are shown in Figure 8 and Fig. 9 As shown. Fig. 9 As can be seen from (A) and (B), on the 7th day after vaccination, the level of CD103 dendritic cells in the inguinal lymph nodes of the stroke vaccine group was significantly higher than that of the blank control group, wild-type E. coli Nissle1917 (wt), and dexamethasone PLGA nanoparticles as a tolerance adjuvant control; 14 days after vaccination, the level of CD103 dendritic cells in the stroke vaccine group was further increased. Fig. 9 (C) and (D) show that at 14 days, an increase in the level of CD103 dendritic cells in the stroke vaccine CPRA group was also detected in the mesenteric lymph nodes, which was significantly different from the blank group, wt group and Dex-PLGA nanoparticles.

[0054] Treg cell levels Figure 8 As shown, from Figure 8 (A) and (B) show that, on the 7th day after vaccination, the stroke vaccine significantly increased the level of inguinal Treg cells compared with the blank group, wt group, and Dex-PLGA; on the 14th day after vaccination, the Treg cells in the inguinal stroke vaccine CPRA group decreased, while Figure 8 As can be seen from (C) and (D), the level of Treg cells in the mesenteric lymph nodes increased. The above results indicate that the stroke vaccine successfully induced the generation of tolDCs and Treg cells in vivo, and that Treg cells successfully homed to the intestine for storage. Importantly, the intestinal homing ability is a unique and synergistic construction of retinoic acid and outer membrane vesicle antigens, and even Dex-PLGA, which has strong anti-inflammatory ability, does not have this property. Existing literature Kang SG, Wang C, MatsumotoS, Kim CH. High and low vitamin A therapies induce distinct FoxP3+ T-cell subsets and effectively control intestinal inflammation. Gastroenterology. 2009; 137(4): 1391-402.e4026. doi: 10.1053 / j.gastro.2009.06.063 reported that mice taking 25000UI / kg of vitamin A (retinoic acid prodrug) daily can effectively increase the level of intestinal Treg cells. The dose of retinoic acid used in this example is only 0.375 μg / kg, and the single dose is about 20,000 times lower than that in the literature. In addition, only two injections are required in two weeks, which can greatly reduce the intake of retinoic acid and avoid the toxic side effects of retinoic acid.

[0055] In summary, the stroke vaccine of the present invention utilizes the outer membrane vesicles of Escherichia coli Nissle1917 lacking the LPS virulence gene as antigens and retinoic acid as a reverse adjuvant, both of which simultaneously induce the production of tolerant dendritic cells and Treg cells. At the same time, retinoic acid induces the expression of the intestinal homing CCR9 receptor, prompting the generated Treg cells to home to the intestine as a Treg cell reserve after a stroke occurs.

[0056] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any form. Although the present invention has been disclosed as a preferred embodiment as above, it is not used to limit the present invention. Any technician familiar with this profession can make some changes or modifications to equivalent embodiments of equivalent changes using the technical contents disclosed above without departing from the scope of the technical solution of the present invention. However, any simple modification, equivalent change and modification made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. A method for preparing a stroke vaccine, characterized in that: The following steps are involved: S1. Preparation of retinoic acid PLGA nanoparticles: Dissolving retinoic acid, polylactic acid-co-glycolic acid PLGA and vitamin E polyethylene glycol succinate TPGS in an organic solvent A to obtain a solution A; dropping the solution A into an aqueous solvent B at a dropping speed of 1-50 drops / s, and magnetically stirring at a speed of 1-100 r / min for several hours to evaporate and remove the organic solvent A to obtain retinoic acid PLGA nanoparticles; the organic solvent A includes but is not limited to one of acetone, methanol, ethanol and acetonitrile; the aqueous solvent B is selected from one of water, physiological saline and phosphate buffer; S2, preparing hybrid vesicle CMV, the steps are as follows; S21, extracting Escherichia coli outer membrane vesicles (OMV); S22, mixing the lipid and outer membrane vesicles OMV, using an ultrasonic cell disruptor to mix them in an ice bath, and then extruding them using a liposome extruder to obtain hybrid vesicles CMV; S3. Retinoic acid PLGA nanoparticles and hybrid vesicles CMV were mixed, ultrasonically mixed in an ice bath using an ultrasonic cell disruptor, and then extruded using a liposome extruder to obtain the stroke vaccine CPRA.

2. The method for preparing a stroke vaccine according to claim 1, characterized in that: The specific method of step S21 is as follows: Take the frozen LPS virulence gene-deficient Escherichia coli culture medium and streak it on an LB solid plate to revive it. After culturing overnight at 37°C, pick the colonies and inoculate them into LB liquid culture medium. After culturing for 10 h, inoculate them into LB liquid culture medium at a volume ratio of 1:100 and culture them at 37°C. When the OD600 value is detected between 0.7 and 1, collect the culture medium; centrifuge the culture medium at 5000 g at 4°C for 30 min, concentrate the supernatant using a 100 kDa ultrafiltration tube, centrifuge the concentrate at 200000 g at 4°C for 2 h, and collect the precipitate to obtain outer membrane vesicles (OMVs).

3. The method for preparing a stroke vaccine according to claim 2, characterized in that: The LPS virulence genes include one or more of LpxM, LpxL, and pagP.

4. The method for preparing a stroke vaccine according to claim 3, characterized in that: The lipid includes, but is not limited to, any one of dendritic cell membrane, soybean lecithin, egg yolk lecithin, DOPE, DSPE, DSPE-MPEG, DSPE-PEG2000, and DSPE-PEG5000.

5. The method for preparing a stroke vaccine according to claim 1, characterized in that: In step S3, the mixing ratio of retinoic acid PLGA nanoparticles and hybrid vesicle CMV is: based on the mass of PLGA in the retinoic acid PLGA nanoparticles, the mass ratio of PLGA to hybrid vesicle CMV is (1-100):

1.

6. A stroke vaccine, characterized in that: The stroke vaccine is prepared by the preparation method of any one of claims 1 to 5.

7. A use of the stroke vaccine as claimed in claim 6, characterized in that: The vaccine is used by injection. After injection, the outer membrane vesicles serve as antigens and retinoic acid serves as a reverse adjuvant to induce the generation of tolerant dendritic cells and Treg cells. At the same time, retinoic acid induces Treg cells to home to the intestine as a Treg cell reserve after a stroke occurs.

Images