A stroke vaccine and its preparation method and application
By designing a stroke vaccine that uses bacterial components and retinoic acid to induce intestinal homing of Treg cells, the problem of lack of effective stroke vaccines in the prior art is solved, and the intestinal Treg cell reserves after stroke are achieved, neuroinflammation and repair are improved, and stroke prognosis is improved.
Patent Information
- Application Number
- CN202510295864.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-13
- Publication Date
- 2025-06-20
- Estimated Expiration
- 2045-03-13
AI Technical Summary
There is a lack of effective stroke vaccines in the prior art, and it is impossible to effectively prevent or improve the inflammatory state and nerve repair after stroke.
A stroke vaccine was designed, using bacterial components as antigens, and retinoic acid as a reverse adjuvant, to induce intestinal homing of Treg cells through retinoic acid, increasing the number of intestinal Treg cells to reserve cells for improving neuroinflammatory after stroke.
By increasing intestinal Treg cells, the vaccine can respond quickly after stroke, improve neuroinflammation and repair damaged nerves, improve stroke prognosis, and avoid the risk of autoimmune disease caused by the use of stroke markers as antigens.
Smart Images

Figure CN119792507B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedical technologies, and in particular to a stroke vaccine and its preparation method and application. Background Art
[0002] Stroke, commonly known as apoplexy, includes two types: ischemic stroke (cerebral infarction) and hemorrhagic stroke (cerebral hemorrhage), and is the leading cause of death and disability among adults worldwide. Currently, tissue plasminogen activator alteplase (tPA), which restores blood perfusion in the infarcted area through intravenous thrombolysis in clinical practice, is the only approved thrombolytic drug.
[0003] Although the application of tPA has improved the prognosis of ischemic stroke patients, its limitations such as a short treatment window period (<4.5 hours), high bleeding risk, and inability to intervene in post-stroke neuroinflammation and secondary injury have highlighted the urgent need for preventive strategies in the stroke prevention and treatment system. Against the background of the continuous increase in the global stroke incidence, exploring a stroke vaccine that can improve the post-stroke inflammatory state and nerve repair through immune regulation may provide a breakthrough direction for the treatment of stroke, thereby making up for the defects of the current treatment model mainly based on acute-phase intervention. However, there are few reports on the technology of stroke vaccines in the prior art. Summary of the Invention
[0004] Aiming at the current lack of stroke vaccines, the present invention provides a stroke vaccine for improving the prognosis of stroke and its preparation method, which is expected to change the defects of the current stroke treatment model.
[0005] Since the regulatory T cells (Treg cells) in the intestine can chemotax to the stroke site, improve neuroinflammation and repair damaged nerves, and the function of Treg cells is independent of antigen specificity. Intestinal Treg cells are regulated by the intestinal commensal flora, tolerogenic dendritic cells (tolDCs), and retinoic acid. Therefore, the present invention selects bacterial components as antigens, and together with retinoic acid as an inverse adjuvant, and utilizes the ability of retinoic acid to induce the intestinal homing of Treg cells to design a vaccine for subcutaneous or intramuscular injection, so as to increase intestinal Treg cells and serve as a reserve of Treg cells after stroke occurs.
[0006] The stroke vaccine provided by the present invention is prepared as follows:
[0007] S1. Prepare retinoic acid PLGA nanoparticles:
[0008] Retinoic acid, poly(lactic-co-glycolic acid) (abbreviated as PLGA), and vitamin E polyethylene glycol succinate (abbreviated as TPGS) are dissolved in organic solvent A to obtain solution A; solution A is dropped into aqueous solvent B at a dropping rate of 1 - 50 drops / s, with a stirring temperature of 15 - 50 °C, and magnetically stirred at a rotation speed of 1 - 100 r / min for 1 h - 24 h to evaporate and remove organic solvent A, obtaining retinoic acid PLGA nanoparticles.
[0009] The organic solvent A includes but is not limited to one of acetone, methanol, ethanol, and acetonitrile.
[0010] The aqueous solvent B is selected from one of water, physiological saline, and phosphate buffer solution.
[0011] S2. Prepare hybrid vesicle CMV, and the steps are as follows;
[0012] S21. Extract outer membrane vesicles OMV of Escherichia coli; the specific method is as follows:
[0013] Take the frozen Escherichia coli bacterial solution with the LPS virulence gene deleted and streak it for resuscitation on an LB solid plate. After overnight culture at 37 °C, pick colonies and inoculate them into an LB liquid medium. After culturing for 10 h, inoculate them into an LB liquid medium at a volume ratio of 1:100 and culture at 37 °C. When the detected OD600 value is between 0.7 - 1, collect the bacterial solution; centrifuge the bacterial solution at 5000 g for 30 min at 4 °C, concentrate the supernatant using a 100 kDa ultrafiltration tube, and centrifuge the concentrated solution at 200000 g for 2 h at 4 °C to collect the precipitate, which is the outer membrane vesicles OMV. The LPS virulence gene includes one or more of LpxM (or msbB), LpxL, and pagP.
[0014] S22. Mix the lipid and outer membrane vesicles OMV, ultrasonically mix them in an ice bath using an ultrasonic cell disruptor, and then extrude them using a liposome extruder to obtain hybrid vesicle CMV.
[0015] S3. Mix the retinoic acid PLGA nanoparticles and hybrid vesicle CMV, ultrasonically mix them in an ice bath using an ultrasonic cell disruptor, and then extrude them using a liposome extruder to obtain the stroke vaccine CPRA.
[0016] Preferably, in step S22, the mass ratio of the lipid to the outer membrane vesicle OMV is (0.1 - 100):(1 - 100). The lipid includes, but is not limited to, dendritic cell membrane, soy phospholipid, egg yolk lecithin, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (abbreviated as DOPE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (abbreviated as DSPE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-(methoxypolyethylene glycol) (abbreviated as DSPE-MPEG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-(polyethylene glycol)-2000 (abbreviated as DSPE-PEG2000), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-polyethylene glycol)-5000 (abbreviated as DSPE-PEG5000), any one of them.
[0017] More preferably, the lipid is dendritic cell membrane, and the extraction method is to disperse the cells in 10 mM HEPES and 1 mM PMSF, use the 6th ultrasonic probe of the ultrasonic cell disruptor for ice bath ultrasonic treatment, select the power of 4%, the ultrasonic working time of 2 s, the ultrasonic intermittent time of 2 s, and the ultrasonic duration of 8 min. The mass ratio of the lipid to the OMV is 2:1.
[0018] Preferably, in step S22, the ultrasonic cell disruptor uses the 3rd or 6th ultrasonic probe, the power is selected from 1 - 20%, the ultrasonic working time is 0.1 s - 2 s, the ultrasonic intermittent time is 0.1 s - 10 s, and the ultrasonic duration is 1 s - 10 min.
[0019] Preferably, in step S22, the liposome extruder uses one of the 100nm, 200nm, 400nm, 800nm extrusion membranes, and the extrusion times are 1 - 10 times.
[0020] Preferably, in step S3, the mixing ratio of retinoic acid PLGA nanoparticles and hybrid vesicle CMV is: based on the mass of PLGA in the nanoparticles, the mass ratio of PLGA to hybrid vesicle CMV is (1 - 100):1.
[0021] Preferably, in step S3, the ultrasonic cell disruptor uses the 3rd or 6th ultrasonic probe, the power is selected from 1 - 20%, the ultrasonic working time is 0.1 s - 2 s, the ultrasonic intermittent time is 0.1 s - 10 s, and the ultrasonic duration is 1 s - 10 min.
[0022] Preferably, in step 3, the liposome extruder uses one of the 100nm, 200nm, 400nm, 800nm extrusion membranes, and the extrusion times are 1 - 10 times.
[0023] The stroke vaccine can be used in the following seven fields:
[0024] (1) Preventing and / or improving ischemic stroke;
[0025] (2) Preventing and / or improving hemorrhagic stroke;
[0026] (3) Preventing and / or improving myocardial infarction;
[0027] (4) Preventing and / or improving atherosclerosis;
[0028] (5) Preventing and / or improving diabetes;
[0029] (6) Preventing and / or improving allogeneic organ transplantation rejection;
[0030] (7) Preventing and / or improving xenogeneic organ transplantation rejection.
[0031] The stroke vaccine is used by subcutaneous or intramuscular injection. After injection, the outer membrane vesicles serve as antigens, and retinoic acid serves as an inverse adjuvant to induce the generation of tolerogenic dendritic cells and Treg cells. At the same time, retinoic acid induces the homing of Treg cells to the intestine, serving as a reserve of Treg cells after stroke occurs.
[0032] Compared with the prior art, the advantages of the present invention are as follows:
[0033] (1) The stroke vaccine provided by the present invention has uniform particle size and good stability. Escherichia coli outer membrane vesicles containing anti-inflammatory LPS are used as antigens, and retinoic acid is used as an inverse adjuvant to induce the generation of tolerogenic dendritic cells and Treg cells. At the same time, the intestinal homing effect induced by retinoic acid enables tolerogenic dendritic cells and Treg cells to home to the intestine. Because intestinal Treg cells can respond to the body's inflammatory signals, the Treg cells pre-reserved in the intestine through vaccination can actively improve neuroinflammation and prognosis after stroke occurs.
[0034] (2) The anti-inflammatory and repair functions of Treg cells have no antigen specificity. Therefore, the selected Escherichia coli outer membrane vesicles can serve as a universal antigen, avoiding the risk of mistakenly inducing autoimmune diseases by using stroke markers as antigens.
[0035] (3) The raw materials of the stroke vaccine provided by the present invention are conventional, the preparation method is simple, and the uniformity is beneficial, which is conducive to practical production and application.
[0036] Other advantages, objectives, and features of the present invention will be partially reflected by the following description and partially understood by those skilled in the art through the research and practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS
[0037] Figure 1 It is a diagram of the gene knockout result of Example 1 of the present invention.
[0038] Figure 2 It is a schematic flow chart of the preparation method of the stroke vaccine of the present invention.
[0039] Figure 3 It is the particle size distribution diagram of the stroke vaccine obtained in Example 2 of the present invention.
[0040] Figure 4 It is the transmission electron microscope image of the stroke vaccine obtained in Example 2 of the present invention.
[0041] Figure 5 It is the lymph node targeting result diagram of the stroke vaccine obtained in Example 3 of the present invention.
[0042] Figure 6 It is the flow cytometry detection result diagram of the stroke vaccine regulating mouse BMDCs obtained in Example 4 of the present invention.
[0043] Figure 7 It is the flow cytometry detection result diagram of BMDCs regulating T lymphocytes obtained in Example 4 of the present invention.
[0044] Figure 8 It is the flow cytometry detection result diagram of the stroke vaccine regulating Treg cells in the inguinal lymph nodes and mesenteric lymph nodes of mice obtained in Example 5 of the present invention.
[0045] Figure 9 It is the flow cytometry detection result diagram of the stroke vaccine regulating BMDCs in the inguinal lymph nodes and mesenteric lymph nodes of mice obtained in Example 5 of the present invention. Detailed implementation manners
[0046] The following is a description of the preferred embodiments of the present invention with reference to the accompanying drawings. It should be understood that the preferred embodiments described herein are only for explaining and illustrating the present invention, and are not used to limit the present invention.
[0047] Example 1
[0048] Construct Escherichia coli with the LPS virulence gene deleted, and the method is as follows:
[0049] In this example, Escherichia coli Nissle1917 strain is selected. Due to the strong pro-inflammatory ability of lipopolysaccharide of wild-type Escherichia coli, it will affect the generation of tolDCs and Treg cells. Therefore, it is selected to knock out the LPS virulence genes, including LpxM, LpxL, and pagP. The steps are roughly as follows: Design the sgRNA sequences targeting LpxM, LpxL, and pagP. After being cleaved by Cas9 protein, use the homologous arm fragments on both sides of the LpxM, LpxL, and pagP genes to repair the DNA group.
[0050] The LpxM-sgRNA sequence is CAGCATGGCAGGAATATCGA, see SEQ ID No: 1 for details.
[0051] The LpxL-sgRNA sequence is TCAGTGGATTATCGTTCGGG, see SEQ ID No: 2 for details.
[0052] The pagP-sgRNA sequence is TATAACGAGCGACCGTGGGG, see SEQ ID No: 3 for details.
[0053] The LpxM-sgRNA, LpxL-sgRNA, and pagP-sgRNA sequences were respectively ligated onto the pTargetF plasmid and then transferred into Escherichia coli Nissle 1917 that had been transfected with the pCas plasmid in advance to construct Escherichia coli Nissle 1917 with deletions of the LpxM, LpxL, and pagP genes, which was stored frozen for later use.
[0054] The gene knockout results are as Figure 1 shown, and the results indicate that the LpxM, LpxL, and pagP genes were successfully knocked out compared to wild-type Escherichia coli.
[0055] Example 2
[0056] A method for preparing the stroke vaccine CPRA is as Figure 2 shown, and the steps are as follows:
[0057] Step 1: Dissolve 0.5 mg of retinoic acid (RA), 10 mg of PLGA, and 100 mg of TPGS in 3 mL of acetone to obtain a mixed solution; under the stirring condition of 10 r / min, the mixed solution was dropped into 10 mL of water at 37°C at a rate of 2 drops / s and stirred for 6 h to obtain retinoic acid PLGA nanoparticles.
[0058] Step 2: Streak and resuscitate the frozen bacterial solution of Escherichia coli Nissle 1917 with deletions of the LPS virulence genes LpxM, LpxL, and pagP constructed in Example 1 on an LB solid plate. After overnight culture at 37°C, pick colonies and inoculate them into an LB liquid medium. After culturing for 10 h, inoculate them into an LB liquid medium at a volume ratio of 1:100 and culture at 37°C. When the OD600 value was detected to be between 0.7 and 1, collect the bacterial solution, centrifuge it at 5000 g at 4°C for 30 min, concentrate the supernatant using a 100 kDa ultrafiltration tube, and centrifuge the concentrated solution at 200000 g at 4°C for 2 h to collect the precipitate, which is the outer membrane vesicle OMV.
[0059] Step 3: Extract and culture mouse bone marrow-derived dendritic cells (DCs). Disperse the cells in a solution containing 10 mM HEPES and 1 mM PMSF. Use the 6th ultrasonic probe of an ultrasonic cell disruptor for ice-bath sonication. Select a power of 4%, a sonication working time of 2 s, a sonication interval time of 2 s, and a total sonication duration of 8 min. After sonication, centrifuge at 1000 g for 5 min at 4°C, take the supernatant, and then centrifuge at 20000 g for 30 min at 4°C to obtain dendritic cell membranes (DCM).
[0060] Step 4: Mix dendritic cell membranes (DCM) and outer membrane vesicles OMV at a mass ratio of 2:1. Use the 6th ultrasonic probe of an ultrasonic cell disruptor for ice-bath sonication. Select a power of 1%, a sonication working time of 0.5 s, a sonication interval time of 2 s, and a sonication duration of 3 s. After sonication, extrude using a 400 nm liposome extruder 5 times to obtain hybrid vesicles CMV.
[0061] Step 5: Mix retinoic acid PLGA nanoparticles and hybrid vesicles CMV. The mixing ratio is such that the mass ratio of PLGA in the retinoic acid PLGA nanoparticles to the mass of hybrid vesicles CMV is 10:1. Use the 6th ultrasonic probe of an ultrasonic cell disruptor for ice-bath sonication. Select a power of 1%, a sonication working time of 0.5 s, a sonication interval time of 2 s, and a sonication duration of 3 s. After sonication, extrude using a 400 nm liposome extruder 5 times to obtain the stroke vaccine CPRA.
[0062] The test results show that the encapsulation efficiency of the stroke vaccine CPRA for retinoic acid is 60.10%, the drug loading is 1.19%. The particle size is 150.6 ± 21.5 nm, the polydispersity index PDI is 0.38 ± 0.1, and the Zeta potential is -25.08 ± 4.28 mV. The particle size distribution is as Figure 3 shown.
[0063] Figure 4 This is the transmission electron micrograph of the stroke vaccine CPRA. It can be seen that the particle size of the stroke vaccine CPRA is about 50 - 100 nm, and the surface is coated with a cell membrane of about 10 nm.
[0064] Example 3
[0065] Test on the lymph node targeting ability of the stroke vaccine:
[0066] Since retinoic acid does not have fluorescence, replace retinoic acid in Example 2 with the same mass and equally water-insoluble fluorescent dye IR780 for lymph node targeting.
[0067] The nanoparticles prepared by the present invention have a particle size of about 100 nanometers and have the ability of lymph node targeting. In Example 2, OMV hybridized dendritic cell membranes, endowing the nanoparticles with the ability of homologous targeting, and further promoting the uptake of the stroke vaccine by dendritic cells in the lymph nodes. The lymph node targeting ability of the stroke vaccine was investigated using in vivo imaging technology, and the results are as Figure 5 shown. It can be seen that the free drug without PLGA encapsulation shows weak fluorescence intensity at the inguinal lymph nodes; after PLGA encapsulation, the fluorescence intensity of the inguinal lymph nodes is significantly increased; while for CPRA encapsulated with outer membrane vesicles and dendritic cell membranes, the lymph node targeting ability is further improved. The above results indicate that only after the nanonization of small molecule drugs can lymph node targeting be achieved, reducing the proportion of drugs entering the blood circulation, and the modification of dendritic cell membranes and bacterial outer membrane vesicles can further improve the lymph node targeting ability.
[0068] Example 4
[0069] In vitro experiments were used to verify the ability of the stroke vaccine CPRA to induce immune tolerance:
[0070] The present invention mainly targets dendritic cells, induces immune tolerance in them, and promotes the generation of Treg cells. First, mouse bone marrow-derived dendritic cells (BMDCs) were extracted in vitro and incubated with the stroke vaccine for 7 days (each 1×10 6 BMDCs were incubated with CPRA carrying 25 nM retinoic acid and 5 ng outer membrane vesicles), and the levels of CD86, CD103, and MHC-II were detected by flow cytometry. In addition, BMDCs treated with the stroke vaccine for 7 days were incubated with spleen lymphocytes to detect the ability of the stroke vaccine to induce Treg cells through BMDCs.
[0071] The flow cytometry results of dendritic cells are as Figure 6 shown. From Figure 6 Figure (A), it can be seen that compared with wild-type Escherichia coli Nissle1917 (wt EcN), outer membrane vesicles lacking LpxM, LpxL, and pagP genes (△mLp) significantly reduced the level of CD86, proving that the deletion of LPS virulence genes contributes to the formation of tolerance; compared with wild-type Escherichia coli Nissle1917, the stroke vaccine CPRA group also significantly reduced the level of CD86. Figure 6 Figure (B) shows that compared with wt EcN, △mLp significantly reduced the level of MHC-II, while compared with the △mLp and RA groups, the stroke vaccine CPRA group further reduced the level of MHC-II. Figure 6(C)showed that there were no significant differences among wt EcN, △mLp, RA and the blank group, indicating that the mere presence of vesicles or retinoic acid could not induce the generation of CD103 dendritic cells. Only the stroke vaccine CPRA significantly increased the level of CD103 dendritic cells used to induce Treg cells. The mere presence of free retinoic acid alone could not induce the generation of CD103 dendritic cells. Only PLGA carrying retinoic acid intact and the stroke vaccine CPRA coated with outer membrane vesicles could induce the generation of CD103 dendritic cells. The above results indicated that outer membrane vesicles lacking the LPS virulence gene and retinoic acid, as components of the stroke vaccine, were both indispensable for inducing tolerance.
[0072] The BMDCs cells after inducing tolerance were co-incubated with Treg cells, and the level of Treg cells was as Figure 7 shown. As can be seen from Figure 7 (A), the stroke vaccine group had the highest proportion of Treg cells; as can be seen from Figure 7 (B), compared with the blank group, the stroke vaccine group significantly increased the proportion of CCR9 gut homing receptor. Importantly, Figure 7 (A)also demonstrated that neither the wild-type outer membrane vesicles alone, the outer membrane vesicles lacking LPS virulence, nor the retinoic acid component alone could induce the generation of Treg cells. The above results indicated that the stroke vaccine of the present invention could successfully induce immune tolerance in vitro.
[0073] Example 5
[0074] In vivo immunity and gut homing performance test of the stroke vaccine:
[0075] On day 0, C57B / 6J mice were inoculated subcutaneously at the tail (0.375 μg / kg calculated as retinoic acid), on day 7, they were inoculated subcutaneously at the tail again (0.375 μg / kg calculated as retinoic acid), and on day 14, inguinal lymph nodes were collected. The level of dendritic cell CD103 and the level of Treg cells were detected by flow cytometry, and the results were as Figure 8 and Figure 9 shown. As can be seen from Figure 9 (A)and (B), on day 7 after vaccination, the level of CD103 dendritic cells in the inguinal lymph nodes of the stroke vaccine group was significantly higher than that of the blank control group, wild-type Escherichia coli Nissle1917 (wt), and dexamethasone PLGA nanoparticles used as an adjuvant control for tolerance. After 14 days of vaccination, the level of CD103 dendritic cells in the stroke vaccine group was further increased. And as can be seen from Figure 9As can be seen from (C) and (D), on day 14, an increase in the level of CD103 dendritic cells in the mesenteric lymph nodes was also detected in the CPRA group of the stroke vaccine, showing significant differences from the blank group, the wt group, and the Dex-PLGA nanoparticles.
[0076] The level of Treg cells, as Figure 8 shown, from Figure 8 (A) and (B), it can be seen that on day 7 after vaccination, compared with the blank group, the wt group, and Dex-PLGA, the stroke vaccine significantly increased the level of inguinal Treg cells; on day 14 after vaccination, the level of Treg cells in the CPRA group of the stroke vaccine in the inguinal region decreased, while from Figure 8 (C) and (D), it can be seen that the level of Treg cells in the mesenteric lymph nodes increased. The above results indicate that the stroke vaccine successfully induced the generation of tolDCs and Treg cells in vivo, and the Treg cells successfully homed to the intestine for storage. Importantly, the intestinal homing ability is synergistically constructed by retinoic acid and outer membrane vesicle antigen and is unique, and even Dex-PLGA with strong anti-inflammatory ability does not have this property. The existing literature Kang SG, Wang C, Matsumoto S, Kim CH. High and low vitamin A therapies induce distinct FoxP3+ T-cell subsets and effectively control intestinal inflammation. Gastroenterology. 2009;137(4):1391-402.e4026. doi:10.1053 / j.gastro.2009.06.063 reported that mice receiving 25,000 UI / kg of vitamin A (a prodrug of retinoic acid) daily could effectively increase the level of intestinal Treg cells. However, the dose of retinoic acid used in this example was only 0.375 μg / kg, and the single-dose was reduced by about 20,000 times compared with the literature, and only 2 injections were needed to be administered within 2 weeks, which could greatly reduce the intake of retinoic acid and avoid the toxic and side effects of retinoic acid.
[0077] In summary, the stroke vaccine of the present invention uses the outer membrane vesicles of Escherichia coli Nissle 1917 with a deleted LPS virulence gene as an antigen and retinoic acid as an inverse adjuvant, which simultaneously induce the generation of tolerogenic dendritic cells and Treg cells. At the same time, retinoic acid induces the expression of the intestinal homing CCR9 receptor, promoting the homing of the generated Treg cells to the intestine as a reserve of Treg cells after stroke.
[0078] The above are only the preferred embodiments of the present invention, and do not impose any form of limitation on the present invention. Although the present invention has been disclosed above with the preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art, within the scope of the technical solution of the present invention, can make some changes or modifications to the above-disclosed technical content to obtain equivalent embodiments with equivalent changes. However, as long as it does not depart from the technical solution of the present invention, any simple modification, equivalent change, and modification made to the above embodiments based on the technical essence of the present invention still fall within the scope of the technical solution of the present invention.
Claims
1. A method for preparing a stroke vaccine, characterized in that: The following steps are involved: S1. Preparation of retinoic acid PLGA nanoparticles: Retinoic acid, polylactic acid-co-glycolic acid copolymer PLGA and vitamin E polyethylene glycol succinate TPGS are dissolved in an organic solvent A to obtain a solution A; the solution A is added dropwise to an aqueous solvent B at a dropping speed of 1-50 drops / s, and the organic solvent A is evaporated and removed by magnetic stirring at a speed of 1-100 r / min for several hours to obtain retinoic acid PLGA nanoparticles; the organic solvent A comprises one of acetone, methanol, ethanol and acetonitrile; the aqueous solvent B is selected from one of water, physiological saline and phosphate buffer; S2, preparing hybrid vesicle CMV, the steps are as follows; S21. Extract E. coli outer membrane vesicles (OMVs) as follows: (1) Constructing Escherichia coli lacking the LPS virulence gene as follows: The Escherichia coli Nissle1917 strain was selected to knock out LPS virulence genes, including LpxM, LpxL, and pagP; the steps were as follows: sgRNA sequences targeting LpxM, LpxL, and pagP were designed, and after Cas9 protein cutting, the homology arm fragments on both sides of the LpxM, LpxL, and pagP genes were used to repair the DNA group; The sequence of LpxM-sgRNA is CAGCATGGCAGGAATATCGA, see SEQ ID No: 1 for details; The sequence of LpxL-sgRNA is TCAGTGGATTATCGTTCGGG, see SEQ ID No: 2 for details; The pagP-sgRNA sequence is TATAACGAGCGACCGTGGGG, see SEQ ID No: 3 for details; The LpxM-sgRNA, LpxL-sgRNA, and pagP-sgRNA sequences were connected to the pTargetF plasmid, respectively, and transferred into the E. coli Nissle1917 transfected with the pCas plasmid in advance to construct the E. coli Nissle1917 with LpxM, LpxL, and pagP gene deletions, and frozen for later use; (2) Take the frozen LPS virulence gene-deficient Escherichia coli Nissle1917 bacterial liquid and streak it on an LB solid plate to revive it. After culturing overnight at 37°C, pick the colonies and inoculate them into LB liquid culture medium. After culturing for 10 h, inoculate them into LB liquid culture medium at a volume ratio of 1:100 and culture them at 37°C. When the OD600 value is detected between 0.7 and 1, collect the bacterial liquid; centrifuge the bacterial liquid at 5000 g at 4°C for 30 min, concentrate the supernatant using a 100 kDa ultrafiltration tube, centrifuge the concentrate at 200,000 g at 4°C for 2 h, and collect the precipitate to obtain the outer membrane vesicles (OMVs); S22, mixing the lipid and outer membrane vesicles OMV, using an ultrasonic cell disruptor to mix them in an ice bath, and then extruding them using a liposome extruder to obtain hybrid vesicles CMV; S3. Retinoic acid PLGA nanoparticles and hybrid vesicles CMV were mixed, ultrasonically mixed in an ice bath using an ultrasonic cell disruptor, and then extruded using a liposome extruder to obtain the stroke vaccine CPRA.
2. The method for preparing a stroke vaccine according to claim 1, characterized in that: The lipid includes any one of dendritic cell membrane, soybean lecithin, egg yolk lecithin, DOPE, DSPE, DSPE-MPEG, DSPE-PEG2000, and DSPE-PEG5000.
3. The method for preparing a stroke vaccine according to claim 1, characterized in that: In step S3, the mixing ratio of retinoic acid PLGA nanoparticles and hybrid vesicle CMV is: based on the mass of PLGA in the retinoic acid PLGA nanoparticles, the mass ratio of PLGA to hybrid vesicle CMV is (1-100):
1.
4. A stroke vaccine, characterized in that: The stroke vaccine is prepared by the preparation method of any one of claims 1 to 3.
Citation Information
Patent Citations
Methods for production of regulatory T cells and uses thereof
AU2005228442A2
Composite vaccine for Alzheimer's disease prevention and treatment, and preparation method thereof
CN102895659A