4-(p-iodophenyl) butyl modified long-circulating itaconic acid derivative as well as preparation method and medical application thereof

Abstract

The invention provides a preparation method of a 4-(p-iodophenyl) butyl modified long-circulating itaconic acid derivative medicine, also discloses medical application of a long-circulating itaconic acid derivative in prevention and treatment of sepsis, and belongs to the technical field of medicines. The 4-(p-iodophenyl) butyl-modified long-circulating itaconic acid derivative (ITA-I) has good biological safety, compared with itaconic acid (Itaconate, ITA), the 4-(p-iodophenyl) butyl-modified long-circulating itaconic acid derivative (ITA-I) has obviously optimized sepsis prevention and treatment effects, solves the problem of low clinical treatment efficiency caused by rapid itaconic acid metabolism, has an application prospect in sepsis prevention and treatment, and can be widely applied to prevention and treatment of sepsis. And a brand new material is provided for treatment of sepsis.

Description

Technical Field

[0001] The invention provides a 4-(p-iodophenyl)butyl modified long-circulating itaconic acid derivative and a preparation method thereof, and also discloses the medical use of the long-circulating itaconic acid derivative in preventing and treating sepsis, belonging to the field of medical technology. Background Art

[0002] Sepsis is a systemic inflammatory response syndrome caused by pathogenic microorganisms invading the body. According to literature reports, the incidence of sepsis is 300-1031 cases per 100,000 people, and about 14,000 people die from its complications every day worldwide. It has become the main cause of death for non-heart patients in intensive care units. Although anti-infection treatment and organ function support technology have achieved certain results, the mortality rate is still as high as 14.7-29.9%. It not only seriously threatens human health, but also brings a huge economic burden to medical and health care.

[0003] Itaconate (ITA) is a small molecule metabolite with anti-inflammatory function that accumulates in macrophage mitochondria. It participates in the regulation of the body's immune metabolism and has great potential in the field of inflammatory treatment. Studies have shown that itaconate significantly reduces inflammatory factors and oxidative stress damage in septic mice, protecting tissue and organ function, but its short circulation time limits its clinical application. This study constructed a long-circulating itaconate derivative with good biosafety and low manufacturing cost, which is expected to improve the pharmacokinetics and pharmacodynamics of itaconate, and has considerable prospects in the treatment of sepsis. Summary of the invention

[0004] The purpose of the present invention is to provide a 4-(p-iodophenyl)butyl modified long-circulation itaconic acid derivative and a preparation method thereof, which is a new compound.

[0005] The present invention further provides a medical use of a 4-(p-iodophenyl)butyl-modified long-circulation itaconic acid derivative, which can be used for preventing and treating sepsis.

[0006] The present invention discloses a 4-(p-iodophenyl)butyl-modified long-circulation itaconic acid derivative having the following structural formula:

[0007] Molecular formula: C 22 H 29 IN2O6 molecular weight: 544.

[0008] The method for preparing a 4-(p-iodophenyl)butyl-modified long-circulation itaconic acid derivative of the present invention comprises the following steps: 1. Add 1.45 g 4-(p-iodophenyl)butyric acid (MW = 290.10 g / mol), 1.9 g 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (MW = 380.24 g / mol) and 5 ml dichloromethane to react at room temperature under nitrogen protection for 1 h; 2. Dissolve 1.2g Fmoc-Lys-OMe.HCl (MW = 418.91g / mol) and 1.29g N,N-diisopropylethylamine (MW = 129.24g / mol) in 5ml dichloromethane, and drip into the liquid obtained in step 1), and stir continuously overnight to react. The obtained yellow oily product is rotary evaporated to obtain the product.

[0009] 3. Take 100 mg of the product from step 2), add 40 ul of piperidine and 1.5 ml of methanol, and heat at 40°C for 6-8 hours under nitrogen protection. The obtained yellow oily product is dried by rotation, extracted, and passed through a column. The product is confirmed by spotting on a plate; ether is added to dissolve, and the white solid is obtained by rotation; 4. Dissolve 6.5 mg of itaconic anhydride (MW = 112 g / mol) and 20 mg of the product obtained in step 3) in 1 mL of dichloromethane, heat at 45°C for about 6 h, filter and evaporating to obtain a brown oily liquid.

[0010] The long-circulating itaconic acid derivative (ITA-I) of the present invention is prepared using itaconic anhydride as a precursor, and a long-acting itaconic acid derivative is obtained by modifying itaconic anhydride.

[0011] The long-circulating itaconic acid derivative (ITA-I) described in the present invention has excellent inhibitory effect on macrophage inflammatory response through experiments on pro-inflammatory factors of macrophages. The sepsis mouse model confirms that the long-circulating itaconic acid derivative (ITA-I) has better therapeutic effect than ITA, solving the problem of low clinical efficiency of ITA.

[0012] The long-circulating itaconic acid derivative (ITA-I) of the present invention can be prepared into pharmaceutical preparations such as powders, oral liquids, granules, tablets, capsules, pills, etc.

[0013] The long-circulating itaconic acid derivative (ITA-I) of the present invention may also be added with conventional pharmaceutically acceptable excipients.

[0014] The positive effects of the present invention are:

[0015] Provided is a long-circulating itaconic acid derivative (ITA-I) and a preparation method, which is a new compound; compared with ITA, it has a longer circulation time and good biosafety, solves the problem of low clinical treatment efficiency caused by rapid itaconic acid metabolism, has application prospects in the prevention and treatment of sepsis, and provides a new material for the treatment of sepsis. The ITA-I of the present invention effectively inhibits the infiltration of inflammatory cells in the sepsis model, solves the problem of low clinical treatment efficiency of ITA, has application prospects in the treatment of sepsis, and provides a drug for the treatment of sepsis. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 , is the nuclear magnetic resonance hydrogen spectrum of the long-circulation itaconic acid derivative (ITA-I) of the present invention Figure 2 , is a carbon nuclear magnetic resonance spectrum diagram of the long-circulation itaconic acid derivative (ITA-I) of the present invention; Figure 3 , is the blood drug concentration-time curve of the drug injected into the tail vein of mice of the present invention; Figure 4 , is a schematic diagram of the effect of ITA-I of the present invention on the survival of RAW264.7 cells at different concentrations; Figure 5 , is a schematic diagram of the inhibitory effect of ITA and ITA-I of the present invention on activated macrophage inflammation in vitro; Figure 6 , are the effects of ITA and ITA-I of the present invention on the survival rate of sepsis model mice; Figure 7 , are the biochemical test results of the anti-inflammatory effects of ITA and ITA-I of the present invention in the mouse sepsis model; Figure 8 , are the histological section results of the anti-inflammatory effects of ITA and ITA-I of the present invention in the mouse sepsis model. DETAILED DESCRIPTION

[0017] The present invention is further described by way of examples through the following implementations, which do not limit the present invention in any way. Without departing from the technical solution of the present invention, any modification or change made to the present invention that is easily implemented by a person of ordinary skill in the art will fall within the scope of the claims of the present invention.

[0018] Example 1 1. Add 1.45 g 4-(p-iodophenyl)butyric acid (MW = 290.10 g / mol), 1.9 g 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (MW = 380.24 g / mol) and 5 ml dichloromethane to react at room temperature under nitrogen protection for 1 h; 2. Dissolve 1.2 g Fmoc-Lys-OMe.HCl (MW = 418.91 g / mol) and 1.29 g N,N-diisopropylethylamine (MW = 129.24 g / mol) in 5 ml dichloromethane, and drip into the liquid obtained in step 1), and stir continuously to react overnight; the obtained yellow oily product is rotary evaporated to obtain the product; 3. Take 100 mg of the product of step 2), add 40 ul of piperidine and 1.5 ml of methanol, and heat at 40°C for 6-8 h under nitrogen protection; the obtained yellow oily product is dried by rotation, extracted, and passed through a column, and the product is confirmed by spotting on a plate; ether is added to dissolve, and the white solid is obtained by rotation; 4. Dissolve 6.5 mg of itaconic anhydride (MW = 112 g / mol) and 20 mg of the product obtained in step 3) in 1 mL of dichloromethane, heat at 45°C for about 6 h, filter and evaporate to obtain a brown-yellow oily liquid, named: long-circulating itaconic acid derivative (ITA-I); its H NMR spectrum characterization is as follows Figure 1~Figure 2 As shown: 1 H NMR (400 MHz, CDCl3) δ 7.62 – 7.56 (m, 2H), 6.95 – 6.90 (m, 2H), 6.64 – 6.33 (m, 2H), 5.98 – 5.80 (m, 2H), 3.76 – 3.70(m, 3H), 3.39 – 3.11 (m, 4H), 2.64 – 2.57 (m, 2H), 2.24 – 2.18 (m, 2H), 1.97 – 1.93 (m, 2H), 1.87 – 1.65 (m, 2H), 1.53 – 1.39 (m, 2H), 1.36 – 1.20 (m,2H). 13 C NMR (100 MHz, CDCl3) δ 8.83, 28.99, 27.18, 22.36.

[0019] Reaction formula of the present invention is:

[0020]

[0021] ; The structural formula of the long-circulating itaconic acid derivative (ITA-I) of the present invention is: ; Molecular formula: C 22 H 29 IN2O6 molecular weight: 544.

[0022] The medical application of the present invention is demonstrated by the following experimental examples: Experimental Example 1 Blood concentration-time curve of the drug of the present invention

[0023] After the mice were injected with itaconic acid (ITA-I) by tail vein, blood samples were collected at 1h, 2h, 4h, 8h, 12h, 18h, 24h, and 36h, and the drug concentration in plasma was detected by HPLC. The blood drug concentration time curve was drawn (see Figure 3 ).

[0024] Experimental Example 2, Biosafety Evaluation of ITA-I of the Present Invention Raw264.7 macrophages were cultured in DMEM high glucose medium supplemented with 10% fetal bovine serum at 37°C in a humidified atmosphere containing 5% CO2 for in vitro cytotoxicity evaluation. Raw264.7 cells were seeded into 96-well cell culture plates at a density of 5000 cells per well for 24 hours. They were then exposed to different concentrations of ITA-I solution. After incubation for 24h and 48h, the cells were gently rinsed with phosphate-buffered saline (PBS), and then a 110 μL solution of fresh culture medium mixed with CCK-8 (NCMBiotech, China) solution at a ratio of 10:1 (v / v) was carefully injected into each well. After an additional 2-hour incubation time frame, the enzyme labeling instrument recorded the absorbance of each well at a wavelength value equal to 450 nm.

[0025] The results of CCK-8 assay showed that 5mM ITA-I did not affect the viability of RAW264.7 cells within 24h. As time went on, the biosafety concentration decreased to 3mM, which had better biocompatibility. The safe concentration range of ITA-I (0-3mM) was screened out, which was helpful for the subsequent biological performance testing (see Figure 4 ).

[0026] Experimental Example 3, Inhibitory Effect of ITA-I on Proinflammatory Factors in Macrophages

[0027] Test 1: Effects of ITA-I and ITA on the gene expression of proinflammatory factors IL-6, IL-1β, and TNF-α in RAW264.7 cells.

[0028] Raw264.7 cells were cultured at 2×10 5 / well were inoculated in a 6-well plate and cultured for 24 hours at 37°C in a humidified atmosphere containing 5% CO2. ITA-I medium with concentrations of 3mM, 2mM, and 1mM and ITA medium with concentrations of 2mM were prepared using a high-glucose medium with 10% FBS. The medium in the 6-well plate was replaced with the conditioned medium of each group and then cultured for 2 hours for pretreatment. RAW264.7 cells were stimulated with LPS (10 μg / mL) for 24 hours.

[0029] RNA extraction and detection: The six-well plate cells were washed once with pre-cooled PBS, and then 1 mL Trizol (six-well plate) was added for every 1 mL. The cells were collected in a 1.5 mL enzyme-free centrifuge tube, and 200 μl of chloroform was added to each tube. The tube was mixed upside down for 15 seconds and centrifuged at 12000 g at 4°C for 15 min. The supernatant was carefully transferred to another enzyme-free centrifuge tube, 0.5 mL of isopropanol was added, shaken, and placed at room temperature for 10 min. The supernatant was centrifuged at 12000 g at 4°C for 10 min. A white precipitate was visible at the bottom of the EP tube. The supernatant was discarded, 1 mL of anhydrous ethanol was added, shaken, the precipitate was washed thoroughly, and centrifuged at 7500 g at 4°C for 5 min. The ethanol was aspirated, air-dried until the RNA became translucent, and 30 ul of enzyme-free water was added and mixed by pipetting. The extracted total RNA was measured for RNA content and purity using Nanodrop. The absorbance ratio of 260 / 280 nm for all samples should be 1.8-2.0. According to the instructions, reverse transcribe RNA with a total amount of 1000 ng.

[0030] Primer sequences: IL-1β F TGAATTGGTCATAGCCCGCA; IL-1β RTCCTCCTTCCTGTGCAAACTCT; IL-6 F TCCTACCCCAATTTCCAATGCT; IL-6 R AACGCACTAGGTTTGCCGAG; β-actin F CATCCGTAAGACCTCTAGCCAAC; β-actin R ATGGAGCCACCGATCCACA; TNF-α F ACTCCAGGCGGTGCCTATGT; TNF-α R GTGAGGGTCTGGGCCATAGAA.

[0031] Prepare primers: Prepare forward and reverse primers separately with TEbuffer to make 100 μM master solution for storage. Dilute with RNase-free water to 5 μM working solution when starting PCR. Detect changes in RNA content according to the instructions of Roche SYBR GREEN kit.

[0032] The results are as follows Figure 5 As shown in the figure, LPS (10 μg / mL) successfully activated RAW264.7 cells, and the expression of pro-inflammatory genes IL-6, IL-1β, and TNF-α was significantly upregulated (P<0.05). ITA-I within the safe concentration can significantly downregulate the gene expression of pro-inflammatory factors IL-6, IL-1β, and TNF-α in activated RAW264.7 cells at the gene level, and it is concentration-dependent.

[0033] Experimental Example 4 Effect of ITA-I in treating sepsis in vivo

[0034] C57 mice (8-11 weeks old) were randomly divided into 4 groups, 10 mice in each group: ① control group, ② sepsis + PBS group, ③ sepsis + ITA group, ④ sepsis + ITA-I group; LPS was injected intraperitoneally to establish the sepsis model, and the drugs in each group were injected into the tail vein. The survival rate was calculated at 12h, 48h, 36h, and 48h, and the clinical index was evaluated. After 48h, blood was collected from the eyeballs, and the mice were euthanized by overdose of anesthesia and samples were collected.

[0035] The whole blood was stored at room temperature for 2 hours and incubated at 4°C overnight to shrink the blood clots and increase serum precipitation. The supernatant was collected and centrifuged at 4°C, 3000 rpm for 15 minutes to obtain plasma samples. The activity of serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) was detected by biochemical methods to quantify the degree of liver damage, and the expression of inflammatory factors such as IL-6 and IL-1β in serum was detected by cell biological methods. The results are shown in Figure 2. Figure 6 , 7 As shown in the data, the release of proinflammatory cytokines IL-1β and IFN-α in the LPS group was significantly increased, and the levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were significantly higher than those in the blank control group, while the levels of IL-1β and IFN-α in the ITA-I treatment group were significantly lower than those in the LPS group, and even lower than those in the ITA group, and AST showed a similar change trend as AST.

[0036] Results: ITA-I has significant anti-inflammatory properties and has a significant therapeutic effect on sepsis in mice.

[0037] The tissues and organs were fixed with 4% paraformaldehyde, dehydrated step by step, and histologically stained to evaluate the pathological damage of the important organs of the rats. Figure 8As shown in the figure, the cell behavior of the control group was normal, and no inflammatory cell infiltration was observed. In contrast, the hepatocytes in the LPS group showed obvious vesicular and fatty degeneration, enlarged nuclei, darker staining, shrunken cytoplasm, nuclear and cytoplasmic separation, and infiltration by a large number of inflammatory cells; glomerular condensation, thickening of alveolar walls, and blurred borders of the spleen cortex and medulla, with a large number of apoptotic cells. In contrast, the ITA-I treatment group significantly improved the above pathological changes, which were similar to the blank control group. The pathological results of these major organs provide sufficient support for the structural and functional recovery of organs after ITA-I prevents and treats sepsis.

[0038] Please refer to the attached Figure 1-8 The present invention successfully synthesized a 4-(p-iodophenyl)butyl-modified long-circulating itaconic acid derivative ITA-I, which has a good biosafety range of in vitro cell biosafety (0-3mM). In the in vitro inflammatory cell model, the inhibitory effect of ITA-I on IL-1β, IL-6, and TNF-α was similar to that of ITA at the same concentration, proving that it has a good anti-inflammatory effect. In the sepsis mouse model constructed by intraperitoneal injection of LPS, ITA-I significantly reduced the infiltration of tissue inflammatory cells and significantly reduced the level of inflammatory factors in serum. Its therapeutic effect is better than that of ITA, which solves the problem of low clinical efficiency of ITA and provides a new drug for the prevention and treatment of sepsis.

Claims

1. A 4-(p-iodophenyl)butyl-modified long-circulation itaconic acid derivative, characterized in that Has the following structural formula: ； Molecular formula: C 22 H 29 IN2O6 molecular weight:

544.

2. A method for preparing a 4-(p-iodophenyl)butyl modified long-circulation itaconic acid derivative as claimed in claim 1, comprising the following steps: 1) 1.45 g 4-(p-iodophenyl)butyric acid (MW = 290.10 g / mol), 1.9 g 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (MW = 380.24 g / mol) and 5 ml dichloromethane were reacted at room temperature under nitrogen protection for 1 h; 2) Dissolve 1.2g Fmoc-Lys-OMe.HCl (MW = 418.91g / mol) and 1.29g N,N-diisopropylethylamine (MW = 129.24g / mol) in 5ml dichloromethane, and drip into the liquid obtained in step 1), and stir continuously overnight. The obtained yellow oily product is evaporated to obtain the product; 3) Take 100 mg of the product from step 2), add 40 ul of piperidine and 1.5 ml of methanol, and heat at 40°C for 6-8 hours under nitrogen protection. The obtained yellow oily product is dried by rotation, extracted, and passed through a column. The product is confirmed by spotting on a plate; ether is added to dissolve it, and the white solid is obtained by rotation; 4) 6.5 mg of itaconic anhydride (MW = 112 g / mol) and 20 mg of the product obtained in step 3) were dissolved in 1 mL of dichloromethane, heated at 45°C for 6 h, filtered and evaporated to obtain a brown oily liquid.

3. Medical use of a long-circulating itaconic acid derivative modified with 4-(p-iodophenyl)butyl as claimed in claim 1 in the preparation of drugs for preventing and treating infections.

4. The long-circulating itaconic acid derivative modified with 4-(p-iodophenyl)butyl as claimed in claim 1 can be prepared into any pharmaceutical preparation related to medicine.

Images