Natural salt-reducing polypeptide combination and application thereof

Abstract

The invention discloses a natural salt-reduced polypeptide combination and application thereof, the natural salt-reduced polypeptide combination comprises at least two salt-reduced polypeptides, and the two salt-reduced polypeptides are both salt-reduced polypeptides capable of being combined with a TMC4 receptor and / or an ENaC receptor. The natural salt-reducing polypeptide composition disclosed by the invention has a sensory experience similar to that of table salt in the aspect of salinity and taste, and the salinity is not reduced while the concentration of the table salt is reduced; as a food additive in the future, the food additive can improve the health attribute of food, also meets the expectation of consumers on food flavor, shows obvious advantages in the aspects of salt reduction effect, taste, food health and the like, and really achieves the purpose of reducing salt without reducing salt.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and relates to a polypeptide combination and application thereof, and specifically to a natural salt-reducing polypeptide combination and application thereof. Background Art

[0002] Taste is the basis for humans and animals to identify and ingest nutrients. The human taste system contacts the taste receptors in the mouth and reacts with the flavoring substances in the food. The stimulation generated is transmitted to the taste center of the human brain through the taste nerves to produce taste induction. Among them, saltiness, as one of the indispensable basic tastes for humans, is an important basis for humans to perceive the flavor of food. Global mortality risk statistics show that a high-salt diet is the number one risk factor affecting health. A large number of studies have confirmed that excessive intake of salt can lead to high blood pressure. In addition, a long-term high-salt diet may also increase the incidence of diseases such as gastric cancer, asthma, obesity, and kidney disease. Therefore, it is necessary to reduce the sodium intake in the diet. According to the European Cardiology Research, the salt content in food needs to be reduced, and the daily salt intake per person should be less than 5.00g. In the "Dietary Guidelines for Chinese Residents (2022)", my country recommends that Chinese adults should not consume more than 5.00g of salt per day.

[0003] In order to implement the Outline of the Healthy China 2030 Plan, many salt substitutes have appeared in the public's field of vision, such as non-sodium salt, salty peptides, salty enhancement peptides and flavor modifiers, all of which have shown certain salt reduction effects in the laboratory. Non-sodium salt cation substitutes (potassium chloride, magnesium chloride, potassium lactate, etc.) are the most widely used solutions for reducing sodium intake. They are metal salts that can present a salty taste and have been commercialized. However, they can only reduce part of the sodium content in food, generally not exceeding 15%, and other alternative cations often have special tastes, which limit the application of such salt reduction solutions in food. Flavor modifiers can make up for the decrease in saltiness caused by salt reduction, but they need to be used in combination with other salt substitutes. Optimizing the shape and particle size of salt crystals, reducing the uneven distribution of salt in the food matrix, and even restructuring the food matrix to enhance the salty feeling are effective strategies to solve unpleasant tastes. In comparison, salt-reducing peptides are a more ideal salt substitute that can not only meet human needs for taste, but also supplement the amino acids needed by the human body, and can truly achieve "reducing salt without reducing saltiness".

[0004] Salt-reducing peptides refer to active peptides composed of amino acids that are extracted from protein-rich raw materials through processes such as enzymatic hydrolysis and have a salt-reducing effect. These peptides themselves can be salty or not, but when used with salt, they can reduce the amount of salt without reducing the saltiness and taste. According to the food source, they can be divided into animal-based, plant-based and yeast-based salt-reducing peptides, among which food-based salt-reducing peptides are peptides derived from fungi and plant proteins, which can be used in the field of food salt reduction. They have the advantages of high safety, wide application range, and can be better digested and utilized by the human body. They are a kind of food-based active peptides with great potential.

[0005] The molecular mechanism of salt-reducing peptides is not particularly clear. The perception of saltiness is still the least understood of all tastes. It depends on certain specific receptors or ion channels, which are the main thresholds for identifying salty substances. At present, the academic community focuses on two channels: epithelial sodium channel (ENaC), transient receptor potential vanilloid (TRPV1) and polycystic kidney disease-like ion channel (PKD2L1) are examples of first-class receptors and ion channels. Transmembrane channel 4 (TMC4), TRPML3 (MCOLN3) and Kv3.2 have been identified as potential second-class channels of salty taste receptors. They can also be used to screen salty enhancers. TMC4 is a new type of chloride ion channel that is sensitive to high NaCl concentrations. This protein contains a transmembrane domain and is expressed in taste buds at the back of the tongue. TMC4 is not a widely recognized receptor name directly related to taste. The activation of TMC4 protein by a substance indicates its ability to enhance saltiness, making it helpful for identifying and screening salt enhancers.

[0006] Metal salts are salty taste stimulants, with Na + , K + , Ca 2+ Mg 2+ These are mainly compounds composed of these types of cations. Among these salty ionic compounds, NaCl is the most common salty condiment. It is dissolved in cooking oil or certain solutions to cover the surface of food or penetrate the internal tissues, and then during the process of eating and chewing, saliva is fully in contact with food debris, promoting NaCl to + Released from food. Under the action of saliva, Na +The taste buds transmitted to the surface of the tongue stimulate the taste cells at the same time, causing nerve conduction to perceive salty taste. There are at least two pathways for salty taste, namely the amiloride-sensitive pathway and the amiloride-insensitive pathway, which have different characteristics. The amiloride-sensitive pathway is mainly mediated by the epithelial sodium ion channel (epithelial Na+channel, ENaC), which is cation-selective and is mainly activated by low concentrations of potassium and sodium ions. ENaC is a type of ion channel, mainly composed of three different subunits (c-subunit, B-subunit and y-subunit). ENaC plays an important role in the salty taste perception of rodents.

[0007] The mechanism of salt-reducing peptides can be explained to a certain extent through molecular docking. Molecular docking is usually used to obtain ligand-receptor complexes, which reflect a static binding mode. However, due to the perturbation of atoms, the binding of ligands and receptors is actually a constantly changing process. In addition, due to the limitations of the docking algorithm and scoring function of existing docking programs, the obtained ligand-receptor complex structure is generally not a stable structure and can only be used as an initial conformation. Molecular dynamics simulation is required to obtain more reliable results. Molecular dynamics simulation is an important method for analyzing the dynamic state of proteins, which can be used to verify and expand the molecular docking results and the mechanism explanation of molecular dynamics.

[0008] Therefore, in response to the above technical problems, it is necessary to develop research on the mechanism of salt-reducing peptides, and screen and obtain a natural salt-reducing peptide combination based on the mechanism research, which will be more conducive to promoting related research on salt reduction effects and healthy foods. Summary of the invention

[0009] The purpose of the present invention is to provide a natural salt-reducing polypeptide combination and its application, which finds a combination principle and a combination method for significantly reducing the amount of salt used, thereby significantly reducing the amount of salt used while also showing obvious advantages in terms of taste and food health, thereby realizing an application method for significantly reducing the amount of salt used.

[0010] In order to achieve the above object, a technical solution provided by a specific embodiment of the present invention is as follows:

[0011] In one aspect, the present invention provides a natural salt-reducing polypeptide combination, comprising at least two salt-reducing polypeptides, wherein the two salt-reducing polypeptides are both salt-reducing polypeptides capable of binding to TMC4 receptors and / or ENaC receptors.

[0012] In one or more embodiments of the present invention, the salt-reducing polypeptide group includes salt-reducing polypeptides that strongly bind to the TMC4 receptor and salt-reducing polypeptides that strongly bind to the ENaC receptor.

[0013] In one or more embodiments of the present invention, the salt-reducing polypeptides are all salt-reducing polypeptides capable of binding to TMC4 receptors and ENaC receptors, and when combined with different salt-reducing polypeptides, the salt-reducing polypeptides have a binding preference for binding to TMC4 receptors and ENaC receptors.

[0014] In one or more embodiments of the present invention, the salt-reducing polypeptide is selected from EF 10、 At least two of PP9 and PQ5, the EF 10 The amino acid sequence of is shown in SEQ ID NO:1: EDEGEQPRPF, the amino acid sequence of PP9 is shown in SEQ ID NO:2: PKLLLLPKP, and the amino acid sequence of PQ5 is shown in SEQ ID NO:3: PHEMQ.

[0015] Preferably, the EF10, PP9 and PQ5 are all expressed by protease-deficient Pichia pastoris, and the correct folding and efficient secretion of the salt-reducing polypeptide in the protease-deficient yeast expression system enhance the expression of the salt-reducing polypeptide.

[0016] In one or more embodiments of the present invention, the EF 10 The gene sequence is shown in SEQ ID NO:4: GAGGACGAAG GCGAGCAACC TAGACCTTTT; or

[0017] The gene sequence of PP9 is shown in SEQ ID NO:5: CCTAAATTATTGTTGTTGCC TAAACCA; or

[0018] The gene sequence of PQ5 is shown in SEQ ID NO:6: CCCCATGAGATGCAA.

[0019] In one or more embodiments of the present invention, the natural salt-reducing polypeptide combination includes EF 10 and PP9, the EF 10 Strongly binds to the ENaC receptor, and the PP9 strongly binds to the TMC4 receptor;

[0020] Preferably, the natural salt-reducing polypeptide combination is EF 10 and PP9;

[0021] Further preferably, the EF 10 The weight ratio of PP9 is (1-3):(1-2), preferably 1:1.

[0022] In one or more embodiments of the present invention, the natural salt-reducing polypeptide combination is EF 10 and PQ5, the EF 10Strongly binds to the ENaC receptor, and the PQ5 assists in binding to the TMC4 receptor; in this salt-reducing peptide combination, EF 10 The peptide has the property of strong binding to ENaC (epithelial sodium channel) receptor. This strong binding ability makes EF 10 It can effectively simulate and enhance the salty taste of food while reducing the salt concentration, thus meeting consumers' expectations for food flavor. PQ5 peptides can assist in binding with TMC4, and this binding property of PQ5 may help regulate or enhance EF 10 The salt-reducing effect can be further improved by affecting related taste or metabolic pathways to further enhance the overall performance of the salt-reducing peptide combination.

[0023] Preferably, the EF 10 and PQ5 in a weight ratio of (1-3):(1-2), preferably 1:1; or

[0024] In one or more embodiments of the present invention, when the natural salt-reducing polypeptide combination is PP9 and PQ5, the PP9 strongly binds to the TMC4 receptor, and the PQ5 auxiliary binds to the TMC4 receptor; both polypeptides show the ability to bind to the TMC4 receptor. Among them, the PP9 polypeptide has the characteristic of strong binding to the TMC4 receptor. This strong binding may enable PP9 to effectively simulate or enhance the salty taste perception of food while reducing the amount of salt, thereby meeting consumers' demand for food flavor. The PQ5 polypeptide exhibits auxiliary binding characteristics with the TMC4 receptor. This auxiliary binding may help regulate or optimize the salt-reducing effect of PP9, and further enhance the overall performance of the salt-reducing polypeptide combination by affecting related taste or metabolic pathways. It should be noted that the auxiliary binding effect of PQ5 may not be limited to binding to the TMC4 receptor. It may also interact with other receptors or molecules to jointly promote the improvement of salt-reducing effects.

[0025] In addition, although the combination of PP9 and PQ5 polypeptides is mentioned in one or more embodiments of the present invention, it does not mean that the salt-reducing polypeptide combination of the present invention is limited to these two polypeptides. According to specific research and application requirements, it is also possible to consider adding other polypeptides with similar or complementary functions to further enrich and enhance the performance and application scope of the salt-reducing polypeptide combination.

[0026] Preferably, the weight ratio of PP9 to PQ5 is (1-3):(1-2), preferably 1:1.

[0027] On the other hand, the present invention also provides a salt-reducing composition, comprising the above-mentioned salt-reducing polypeptide combination and edible salt, wherein the weight ratio of the edible salt to the salt-reducing polypeptide combination is (3-10):1.

[0028] In another aspect, the present invention further provides a use of the above-mentioned natural salt-reducing polypeptide combination or composition in the preparation of low-salt food or food additives, wherein the food additive is preferably a salt reducer or a salty taste enhancer.

[0029] In yet another aspect, the present invention further provides a method for enhancing saltiness or reducing salt, comprising adding the above-mentioned natural salt-reducing polypeptide combination or composition to salt-containing food.

[0030] Compared with the prior art, the natural salt-reducing polypeptide combination and its application of the present invention utilize bioengineering methods to synthesize the existing salt-reducing polypeptide EF extracted from fermented tofu (FSC), yeast extract, and Stropharia rugosoannulata. 10 , PP9 and PQ5 were synthesized in multiple copies, and codon optimization was performed based on the Pichia yeast host. 10 After codon optimization of PP9 and PQ5, EF with higher expression level was obtained. 10 , PP9 and PQ5 gene sequences, and construct the vector with the optimized gene sequence, and express it through Pichia pastoris receptor cells (protease-deficient strain MF001-143) to improve the secretion capacity of salt-reducing polypeptide;

[0031] By homology modeling, the optimal conformation obtained by molecular docking was used as the initial structure, and dynamic simulations were performed on the salt-reducing peptides to explore the salt-reducing peptide EF 10 , the interaction between PP9 and PQ5 and ENaC and TMC4, the binding and dissociation process of the peptides and the receptors, and the degree of stability of the system during the entire simulation process. Specifically, at least two of the three salt-reducing peptides were combined and molecularly docked on the ENaC sodium ion channel and TMC4 chloride ion channel protein, respectively, to study the interaction mechanism between the salt-reducing peptides and the sodium ion and chloride ion channel proteins.

[0032] The sensory evaluation of the combination of these salt-reducing peptides surprisingly revealed that these combinations of salt-reducing peptides had better salt-reducing effects than the individual salt-reducing peptides EF10, PP9 or PQ5, and while reducing salt, they also had a significant freshness-enhancing effect. 10 and PP9, PP9 and PQ5, and EF 10 Compared with the single peptides EF10, PP9 or PQ5, PP9 and PQ5 have significant differences in reducing salt and enhancing freshness, and have a synergistic effect; while the combination of salt-reducing peptides EF 10Compared with the standard, PP9 showed significant differences in salt reduction and freshness enhancement. 80% of the evaluators believed that the saltiness was greatly improved when the salt was reduced by 33.3%. Most importantly, we also found that when a combination of salt-reducing peptides was used, as long as there were both strong TMC4 receptor binding peptides and ENaC receptor binding peptides, it had the best salt reduction effect. 10 The combination of PP9 and PP1 can produce obvious synergistic effects. This shows that the salt-reducing polypeptide combination of the present invention can be used as a food additive in the future to significantly reduce the amount of salt in food and condiments, and has a good application prospect.

[0033] Therefore, the salt-reducing polypeptide combination of the present invention is not only highly similar to table salt in terms of saltiness and taste, providing consumers with an almost indistinguishable sensory experience, but also maintains the original saltiness of the food while significantly reducing the salt concentration, truly achieving the innovative goal of "reducing salt without reducing saltiness". This feature enables the polypeptide combination of the present invention to greatly improve the health attributes of food when used as a food additive in the future, in line with modern people's pursuit of a low-salt healthy diet, while also fully satisfying consumers' expectations for food flavor and taste.

[0034] Furthermore, the salt-reducing polypeptide combination of the present invention has shown significant advantages in terms of salt reduction effect, taste retention, and food health promotion. Through scientific proportioning and careful screening, we ensure that the polypeptide combination will not sacrifice the taste and flavor of the food while reducing sodium salt intake, thereby providing consumers with a healthier and more delicious food choice. In addition, the preparation method of the natural polypeptide combination of the present invention has many advantages. The raw materials are cheap, which reduces the production cost and makes this healthy food additive easier to promote and apply. At the same time, the yield of the salt-reducing polypeptide is high, ensuring the stability of production efficiency and product quality. More importantly, the polypeptide combination of the present invention has a high degree of specificity and can accurately act on the relevant taste receptors and metabolic pathways, thereby achieving a more accurate and efficient salt reduction effect.

[0035] In summary, the salt-reducing polypeptide combination of the present invention has demonstrated excellent performance and advantages in many aspects, which not only provides consumers with healthier and more delicious food choices, but also provides strong support for the healthy transformation and upgrading of the food industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0037] Figure 1 The PCR identification result of the recombinant transformation strain of the salt-reducing polypeptide gene sequence in Example 1 of the present invention is shown in FIG. A is the salt-reducing polypeptide EF 10 PCR identification results of the recombinant transformation strain of the gene sequence, M is the nucleic acid marker, 1 is the blank control (water), 2 is the negative control, and 3 is the salt-reducing peptide PIC9K-YT-EF 10 , 4-7 are four single colonies randomly selected from the plate; B is a PCR identification result diagram of the recombinant transformation strain of the salt-reducing polypeptide PP9 gene sequence, M is a nucleic acid marker, 1 is a blank control (water), 2 is a negative control, 3 is a plasmid of the salt-reducing polypeptide PIC9K-YT-PP9, 4-7 are four single colonies randomly selected from the plate; C is a PCR identification result diagram of the recombinant transformation strain of the salt-reducing polypeptide PQ5 gene sequence, M is a nucleic acid marker, 1 is a blank control (water), 2 is a negative control, 3 is a plasmid of the salt-reducing polypeptide PIC9K-YT-PQ5, 4-7 are four single colonies randomly selected from the plate;

[0038] Figure 2 This is a purity analysis chart of the purified recombinant salt-reducing polypeptide by HPLC in Example 2 of the present invention, wherein A is the salt-reducing polypeptide EF 10 A is a graph showing the HPLC purity test results of A, B is a graph showing the HPLC purity test results of a salt-reducing peptide PP9, and C is a graph showing the HPLC purity test results of a salt-reducing peptide PQ5;

[0039] Figure 3A is a total quality factor graph of TMC4 in Example 3 of the present invention;

[0040] Figure 3B is a pull-type diagram of TMC4 in Example 3 of the present invention;

[0041] Figure 3C is a three-dimensional graph of TMC4 in Example 3 of the present invention;

[0042] Figure 4A The salt-reducing polypeptide EF in Example 4 of the present invention 10 3D image of the docking mode with the active site of TMC4 and 2D image of the interaction details of the amino acid residues with the peptide;

[0043] Figure 4B A 3D diagram of the docking mode of the salt-reducing polypeptide PP9 and the active site of TMC4 in Example 4 of the present invention and a 2D diagram of the interaction details between the amino acid residues and the peptide;

[0044] Figure 4C A 3D diagram of the docking mode of the salt-reducing peptide PQ5 in Example 4 of the present invention and the active site of TMC4 and a 2D diagram of the interaction details between the amino acid residues and the peptide;

[0045] Figure 5A The salt-reducing polypeptide EF in Example 5 of the present invention 10 3D image of docking mode with the active site of ENaC and 2D image of interaction details of amino acid residues with the peptide;

[0046] Figure 5B The 3D diagram of the active site docking mode of the salt-reducing polypeptide PP9 and ENaC in Example 5 of the present invention and the 2D diagram of the interaction details between the amino acid residues and the peptide;

[0047] Figure 5C The 3D diagram of the active site docking mode of the salt-reducing peptide PQ5 and ENaC in Example 5 of the present invention and the 2D diagram of the interaction details between the amino acid residues and the peptide;

[0048] Figure 6 This is a sensory evaluation radar chart of the salt-reducing polypeptide in Example 6 of the present invention;

[0049] Figure 7 This is a result diagram of the saltiness of the salt-reducing polypeptide analyzed by electronic tongue in Example 7 of the present invention;

[0050] Figure 8 This is a statistical diagram of the significance of the results of analyzing the saltiness of the salt-reducing polypeptide by electronic tongue in Example 7 of the present invention, wherein * indicates a significant difference, and ** indicates a significant difference. DETAILED DESCRIPTION

[0051] In order to enable those skilled in the art to better understand the technical solutions in the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0053] The expression host of Brazilian sweet protein, Pichia pastoris, has been recognized by the FDA as a food safety grade GRAS strain, and is also a safe strain for health food production as stipulated by Chinese law; secondly, Pichia pastoris has the unique ability to grow under conditions where methanol is the only carbon source and energy source. In addition, Pichia pastoris also has the ability to use cheap culture media for high-density fermentation, strict regulation and very strong promoters, good post-translational modification and secretion capabilities, and easy genetic manipulation. This yeast has been used as a very successful heterologous protein expression system and is widely used in recombinant protein production, especially for vaccine production (currently more than 5,000 proteins have been successfully expressed).

[0054] Unless otherwise specified, the term “EF 10 " refers to "salt-reducing polypeptide EF 10 ", whose amino acid sequence is EDEGEQPRPF, is isolated from commercial ordinary fermented tofu (FSC) by Chen et al. (J Agric Food Chem. 2021Sep8; 69(35):10272-10280.doi:10.1021 / acs.jafc.1c03431.Epub 2021Aug 26.) through multiple chromatographic techniques. It is a flavor peptide with salt-enhancing function. The sensory evaluation results show that the saltiness of 0.4 mg / mL peptide E in 50 mmol / L NaCl solution is equivalent to that of 63 mmol / L NaCl solution.

[0055] Unless otherwise specified, "PP9" in the text refers to "salt-reducing polypeptide PP9", whose amino acid sequence is PKLLLLPKP, which was isolated by Shan et al. (J Agric Food Chem. 2022 Nov 30; 70(47): 14898-14906. doi: 10.1021 / acs.jafc.2c06237. Epub 2022 Nov 2.) using ultrafiltration to separate simple taste peptides from yeast extract. In the test of taste characteristics and salt-enhancing effect, it was found that (sour taste 0.18mM) had a strong salt-enhancing effect; and the S-curve analysis further confirmed that PKLLLLPKP had an additive effect on salty taste perception.

[0056] Unless otherwise specified, "PQ5" in the text refers to "salt-reducing polypeptide PQ5", whose amino acid sequence is PHEMQ, which was isolated from Stropharia rugosoannulata by Chen et al. (https: / / doi.org / 10.1016 / j.jfca.2022.104530). The results of sensory evaluation and electronic tongue analysis showed that the peptide fragment had good umami activity, and the umami threshold was between 0.167 and 0.390 mmol / L.

[0057] Unless otherwise specified, "TMC4" or "TMC4 protein" herein refers to "TMC4 receptor".

[0058] Unless otherwise specified, "ENaC" or "ENaC protein" herein refers to "ENaC receptor".

[0059] Unless otherwise specified, "GalaxyRefine" in this article refers to "a technology used for protein structure refinement, mainly to optimize the protein structure through side chain rearrangement", which can significantly improve the accuracy of protein structure and thus provide a more reliable starting model for molecular docking.

[0060] Currently, the commonly used molecular docking simulation software includes SYBYL, MOE, AutoDock, Discovery Studio, etc. We chose Discovery Studio. Compared with common simulation software, Discovery Studio integrates multiple modules such as molecular docking, pharmacophore identification, virtual screening, quantitative structure-activity relationship, combinatorial chemistry, protein homology modeling, etc. It has complete and powerful functions and is widely used in various stages of drug design by academia and pharmaceutical companies.

[0061] Unless otherwise specified, the reagents and materials in this article can be obtained from regular channels.

[0062] Example 1. Preparation of a Pichia pastoris strain deficient in salt-reducing polypeptide protease

[0063] We used salt-reducing peptide EF 10 (SEQ ID NO: 1, EDEGEQPRPF), PP9 (SEQ ID NO: 2, PKLLLLPKP), PQ5 (SEQ ID NO: 3, PHEMQ) were designed in multiple copies and codon optimized. The gene sequences of salt-reducing polypeptides after codon optimization were synthesized by Nanjing GenScript Gene Co., Ltd., wherein the gene sequences of different polypeptides after codon optimization are as follows:

[0064] EF 10 The gene sequence of is shown in SEQ ID NO:4: GAGGACGAAG GCGAGCAACC TAGACCTTTT; the gene sequence of PP9 is shown in SEQ ID NO:5: PKLLLLPKP; the gene sequence of PQ5 is shown in SEQ ID NO:6: PHEMQ.

[0065] Then use the seamless cloning connection method to connect the codon optimized EF 10 The gene sequences of PP9 and PQ5 were constructed into the EcoRI restriction site of plasmid pPIC9K (thermo fisher catalog number V17520). 10, pPIC9K-YT-PP9, pPIC9K-YT-PQ5 were linearized by SaLI digestion, and the linearized products were purified and transformed into protease-deficient Pichia yeast host strain MF001-143 (the detailed information of the strain has been recorded in patent 202411877517.9, and the deposit number of the strain is CCTCC M 20241743) yeast competent cells. The transformed strain was spread on a YPDS plate containing a final concentration of 4 mg / mL geneticin and cultured at 30°C for 2-4 days, and a single colony was picked for identification. The transformant was confirmed by colony PCR to amplify the target gene, and the results were as follows Figure 1 As shown in A, B, and C.

[0066] Finally, two transformants were identified for each salt-reducing peptide, and the two transformant colonies that were positive for PCR were sequenced by the Shanghai Branch of Beijing Qingke Biotechnology Co., Ltd. to obtain the initial recombinant bacteria MF001-143-YT-EF expressing three salt-reducing peptides. 10 , MF001-143-YT-PP9, MF001-143-YT-PQ5.

[0067] Example 2. Expression characterization and purity detection of different recombinant salt-reducing polypeptides in protease-deficient Pichia pastoris strains

[0068] (1) Preparation of fermentation seed solution

[0069] Pick a single yeast colony that was streaked, activated and growing well on the YPD plate, inoculate it into 50 mL of sterilized YPD, and place it in a 30°C shaker at 250 rpm for overnight culture to activate the strain. Transfer the YPD-activated yeast seed culture liquid at a ratio of 4% to a 500 mL Erlenmeyer flask containing 100 mL of YPD liquid culture medium, place it in a 30°C shaker at 250 rpm for overnight culture, and use it as the seed liquid for fermentation in a 5 L fermenter.

[0070] (2) High-density culture of recombinant yeast strains in 5L fermenters

[0071] The cultured yeast seed liquid was inoculated into a 5L fully automatic mechanical stirring and ventilated fermentation tank (sterilized) at an inoculation rate of 8%, and glycerol was added to start bacterial growth (the volume of the initial culture medium was 2L, sterilized at 121°C for 30 minutes). Bacterial growth stage: 25% concentrated ammonia water was used to control its pH at 5.5, the dissolved oxygen was maintained at (30-60)%, the temperature was controlled at 30°C, the upper limit of the stirring speed was 200r / min, the lower limit was 120r / min, and the ventilation volume was set to 2vvm. After the initial cell density OD600 reached 400, the addition of glycerol was stopped. When DO (dissolved oxygen) rebounded to above 80% again, methanol feeding induced fermentation was started. Methanol addition stage: the temperature is controlled at 30°C, the pH is controlled at 5.5 using 25% concentrated ammonia water, the speed is controlled at 800r / min, the ventilation volume is controlled at 4L / min, the pressure is controlled at 0.05Mpa, the ventilation volume is adjusted to 2vvm, and the methanol is added by variable speed addition, and the dissolved oxygen is maintained at 15-25%. The fermentation process is automatically controlled and related data are collected using the Bailun BLBIO B control system software.

[0072] (3) Recombinant salt-reducing peptide yeast strain purification process

[0073] Take the fermentation supernatant after centrifugal filtration and purify it using the ultrafiltration-nanofiltration membrane filtration system of Hangzhou Zhongqi Environmental Protection Technology Co., Ltd. The membrane core uses a ceramic membrane / 1000kDa for pre-filtration to remove bacteria, and then uses a Xingda ceramic membrane / 30kDa for ultrafiltration to remove impurities. Finally, oligofructose gel is used for nanofiltration under pressure (0.2-0.3MPa) to recover soluble salt-reducing polypeptides at a filtration temperature of 20°C. After adding 2 times the volume of pure water to wash the nanofiltration system, a recombinant salt-reducing polypeptide concentrate is obtained. The powder is dried and concentrated by freeze-drying, and the powder is weighed and sealed and stored at -20°C for subsequent saltiness detection of salt-reducing polypeptides.

[0074] Purity of the purified recombinant salt-reducing peptides was tested by HPLC as described using a ThermoScientific Vanquish HPLC system equipped with 5μm C4(2) 150×4.6mm chromatographic column. Use stationary phase buffer A (water + 0.1% TFA) and mobile phase buffer B (ACN + 0.1% TFA). The UV detector monitors the absorbance at 220nm. The column temperature is set to 50℃ and the injection volume is 5μL. The 10-minute gradient program is set as shown in Table 1 below:

[0075] Table 1

[0076]

[0077] The purified recombinant salt-reducing polypeptide was analyzed for purity by HPLC. Figure 2 As shown in AC.

[0078] from Figure 2 It can be seen from the AC that the EDEGEQPRPF (EF 10 ) The purity of salt-reducing peptide is 99.0%, the purity of PKLLLLPKP (PP9) salt-reducing peptide is 99.7%, and the purity of PHEMQ (PQ5) salt-reducing peptide is 98.2%. The purity of the above salt-reducing peptides can be used for downstream salinity testing experiments.

[0079] Example 3. Analysis of the flavor characteristics of salt-reducing polypeptides

[0080] Salty taste receptors interact with ligands (salty substances) to generate cell signal transmission, thereby exerting biological functions. The present invention uses conventional molecular docking models in the prior art to dock the molecular interaction mechanism of salt-reducing polypeptides with TMC4. By docking potential salt-reducing polypeptides to the active site of salty taste receptor proteins, salt-reducing polypeptides can be further screened and transmembrane channel-like protein 4 (TMC4) can be selected as the receptor for molecular docking. The amino acid sequence of TMC4 protein (NP_001138775.2) is obtained from the NCBI database using the NCBI BLAST tool to search the sequence. The structure of TMC4 is obtained from the PDB database, and the model is refined by GalaxyRefine (see Nucleic Acids Res. 2013 Jul; 41 (Web Server issue): W384-8. doi: 10.1093 / nar / gkt458. Epub 2013 Jun 3.). The optimized receptor model is evaluated for model quality through Ramachandran Plot and total quality factor (ERRAT). Ramachandran Plot is mainly used to illustrate the allowed and unallowed conformations of amino acids in proteins or peptides; the most favorable area in the Ramachandran Plot, the more amino acids it contains, the more reasonable the structure is, and the unallowed area (blank area marked with red residues) is (psi-phi) contains unreasonable amino acids in the structure; ERRAT distinguishes correct and incorrect protein structures by characteristic atoms. The larger the overall quality factor (98.935) of the result value, the closer it is to the high-resolution crystal structure, and the closer it is to the high-resolution crystal structure, indicating that the optimized model is more refined.

[0081] The overall quality factor of TMC4 is shown in the figure Figure 3AAs shown, it analyzes the statistics of non-bonded interactions between different atom types and plots the relationship between the error function value and the position of a 9-residue sliding window, which is calculated by comparison with the statistics of highly refined structures; where * indicates that on the error axis, two lines are drawn to indicate the confidence with which regions exceeding this error value can be rejected; ** indicates the percentage of proteins with calculated error values ​​below the 95% rejection limit. Good high-resolution structures typically produce values ​​of 95% or higher. For lower resolutions (2.5 to 3A), the average overall quality factor is about 91%. From Figure 3A The evaluation results show that the total quality factor obtained is 98.9%

[0082] Ramachandran Turu Figure 3B As shown, according to Figure 3B The specific results are as follows:

[0083]

[0084] Based on the analysis of 118 structures, the resolution is at least 2.0 Angstroms, the R factor is no greater than 20%, and the proportion of a good quality model is expected to be above 90% in the maximum allowed region.

[0085] from Figure 3B The evaluation results show that 98.2% of the residues are located in the most favorable region, 1.6% are in the allowed region, 0.2% are in the loosely allowed region, and 0.0% are in the disallowed region. Taken together, these data confirm that the model can be used.

[0086] Example 4. Molecular dynamics based study of the molecular interaction mechanism between salt-reducing peptide and TMC4

[0087] The structure of the peptide was constructed using Chem3D 20.0, and pre-processed using Discovery Studio 2019 (DS), specifically: select the Small Molecules module, perform hydrogenation, add the CHARMm force field, set the charge mode to the Momany-Rone mode, and finally save it in the mol2 format for backup. At the same time, the optimized receptor was also pre-processed, first removing water molecules and the original ligands, then selecting CleanProtein in Prepare Protein in the Macromolecules module, perfecting the receptor amino acid residues, and also adding the CHARMm force field for energy minimization, setting the Momany-Rone mode, and saving it in the PDB format for backup.

[0088] Molecular docking was performed using the CDOCKER tool of DS for semi-flexible molecular docking. The coordinates of the active site sphere were x=17.7065, y=11.7845, z=-14.9743, and the docking radius was 19.7. The docking force field selected was the CHARMm force field, and the PoseClusterRadius was set to 0.5 to ensure that the docking conformations were as diverse as possible. Other parameters were set to default. After the calculation, multiple conformations of a ligand were obtained. The results were analyzed based on the binding energy. The most stable conformation was selected for subsequent molecular dynamics analysis. The types and quantity of protein binding interactions of the three salt-reducing peptides during the simulation were analyzed. The molecular docking results are shown in Figure 2. Figure 4A -C.

[0089] Therefore, from Figure 4A -C It can be seen that the closest binding prediction from theoretical calculations is EF 10 -7.0 kcal / mol, PQ5-6.1 kcal / mol, PP9-6.7 kcal / mol. These data show that EF 10 It binds most tightly to TMC4 and is the most likely polypeptide among the three polypeptides to first occupy the TMC4 binding site and cause conformational changes in the receptor.

[0090] And from Figure 4A -C As can be seen, the data show that the strongest binding EF 10 The salt-reducing peptide ligand and protein mainly interact with hydrogen bonds, π (Pi) bonds and salt bridges. When it interacts with the TMC4 receptor protein, the ligand and protein form 6 hydrogen bonds, 2 π (Pi) bonds and 4 salt bridges. The main binding sites are: Arg91, Arg104, Asn107, Asp111, Glu133, Glu137 are 6 hydrogen bond sites; two π (Pi) bonds are formed at His103 and Arg130; and Arg126 and EF 10 Glu5, Arg129 and EF 10 Glu1 and EF 10 Gln6, and Lys134 with EF 10 Glu3 forms four salt bridges.

[0091] Example 5. Molecular dynamics based study of the molecular interaction mechanism between salt-reducing peptide and ENaC

[0092] ENaC plays an important role in the salty taste perception of rodents. The present invention uses a molecular docking model to verify the molecular interaction mechanism between salt-reducing peptides and ENaC. By docking potential salt-reducing peptides to the active site of salty taste receptor proteins, salt-reducing peptides can be further screened. ENaC (amiloride-sensitive sodium channel subunit alpha isoform 3 [Homo sapiens]) is selected as the receptor for molecular docking. The amino acid sequence of ENaC protein (NP_001153047.1) is obtained from the NCBI database using the NCBI BLAST tool to search the sequence. The structure of ENaC is obtained from the PDB database, and molecular docking is performed according to the same steps and methods as in Example 4. The results are as follows: Figure 5A -C.

[0093] from Figure 5A -C shows that the binding strengths of the three salt-reducing peptides to ENaC are also different, namely EF 10 -6.1kcal / mol, PQ5-6.9kcal / mol, PP9-8.7kcal / mol. The change trend of the type and quantity of protein binding of the three salt-reducing peptides during the simulation process was analyzed. The data showed that the PP9 salt-reducing peptide ligand with the strongest binding and protein mainly had hydrogen bond and salt bridge interactions. When it interacted with the ENaC receptor protein, the ligand and protein formed 6 hydrogen bonds and 1 σ-π (sigma-π) bond. The main binding sites are: Tyr140, Ser269, His296, His298, Arg438, Tyr444; and a σ-π bond is formed at Pro300.

[0094] Therefore, combined with the results of Example 4, from the energy analysis and binding strength analysis, PP9 has the strongest binding to ENaC, EF 10 The binding to TMC4 is the strongest. In order to verify that the combination of the three salt-reducing peptides can bring about a better salt-reducing effect and explore whether there is a synergistic effect, we conducted sensory evaluation tests of different combinations. This initiative aims to confirm our hypothesis through actual evaluation and determine the combination ratio that can achieve the optimal salt-reducing effect.

[0095] Example 6. Sensory evaluation of salt-reducing polypeptides

[0096] 1. Sample preparation: Prepare 100 mL of mixed solution of salt-reducing peptide and NaCl at different concentrations. First, prepare a 3 mg / mL NaCl solution without any addition as a negative control. Then, prepare the standard and the sample to be tested according to the following ratio:

[0097] ① According to 3mg / mL NaCl + 0.1mg / mL salt-reducing peptide EDEGEQPRPF (EF 10 ) was prepared into a 100 mL mixed solution as standard 1 (J Agric Food Chem. 2021 Sep 8; 69(35): 10272-10280. doi: 10.1021 / acs.jafc.1c03431. Epub 2021 Aug 26.).

[0098] ② Prepare 100 mL of a mixed solution of 3 mg / mL NaCl + 0.1 mg / mL salt-reducing polypeptide PKLLLLPKP (PP9) as standard 2.

[0099] ③ Prepare 100 mL of a mixed solution of 3 mg / mL NaCl + 0.1 mg / mL salt-reducing polypeptide PHEMQ (PQ5) as standard 3.

[0100] ④ According to 2mg / mL NaCl + 0.1mg / mL salt-reducing peptide EDEGEQPRPF (EF 10 )+0.1 mg / mL salt-reducing polypeptide PHEMQ (PQ5) was prepared into a mixed solution as sample 1.

[0101] ⑤2mg / mL NaCl+0.1mg / mL salt-reducing peptide EDEGEQPRPF(EF 10 )+0.1 mg / mL salt-reducing polypeptide PKLLLLPKP (PP9) was prepared into a mixed solution as sample 2.

[0102] ⑥ A mixed solution of 2 mg / mL NaCl + 0.1 mg / mL salt-reducing polypeptide PHEMQ (PQ5) + 0.1 mg / mL salt-reducing polypeptide PKLLLLPKP (PP9) was prepared as sample 3.

[0103] ⑦2mg / mL NaCl+0.1mg / mL salt-reducing peptide EDEGEQPRPF(EF 10 )+0.1 mg / mL salt-reducing polypeptide PHEMQ (PQ5)+0.1 mg / mL salt-reducing polypeptide PKLLLLPKP (PP9) was prepared into a mixed solution as sample 4.

[0104] 2. Sample testing: 10 experienced evaluators (5 males, 5 females, aged 22-35 years old) who were trained in appearance, flavor and texture evaluation were selected for comparative evaluation. The manual sensory evaluation was carried out in a sensory analysis room with a temperature of 22.5±2.5℃ and normal lighting. Each evaluator was required not to have the habit of alcoholism and smoking. Each evaluator was in an independent space to ensure that the evaluation results did not interfere with each other. To ensure the fairness of the tasting, each group of samples was assigned three random numbers as numbers, and all samples were presented to the tasters in a random order. During the evaluation process, pure water was used to rinse the mouth, and then the sample was kept in the mouth for 2 minutes before spitting it out. According to the preset reference standard, the tasters will score the samples. The scoring system adopts a 10-point system, among which 0-2 points indicate that the salty / umami taste is very weak, 4-6 points indicate that the salty / umami taste is moderate, 6-8 points indicate that the salty / umami taste is strong, and 8-10 points indicate that the salty / umami taste is very strong.

[0105] The test results are shown in Tables 2-3 and Figure 6 shown.

[0106] Table 2 Sensory tasting results of salt reduction peptide combination

[0107]

[0108] Table 3 Sensory tasting results of salt-reducing peptide combination

[0109]

[0110]

[0111] From the above Table 2-3, and Figure 6 It can be seen that the four salt-reducing polypeptide combinations of the present invention show obvious freshness enhancement properties when increasing saltiness compared to standard samples 1, 2 and 3. The salty and fresh taste ranking is sample 2> sample 4> sample 3> sample 1> standard sample 2> standard sample 3> standard sample 1> NaCl solution.

[0112] Among them, when comparing Sample 2 with the standard, 80% of the evaluators believed that the saltiness was greatly improved when the salt content was reduced by 33.3%, indicating that the salt-reducing polypeptide combination of the present invention can be used as a food additive in the future to significantly reduce the amount of salt in food and condiments, and has a good application prospect.

[0113] Example 7. Electronic tongue analysis of salt-reducing polypeptides

[0114] Electronic tongue is a fast, accurate and unbiased way to evaluate flavor. The salt-reducing effect of the combined salt-reducing peptides was tested using ThinkSenso & Senso electronic tongue. 10 ) was used as the salinity standard to measure the salinity score, and the salinity scores of standard products 2, 3 and samples 1, 2, 3, and 4 were measured. Each sample was measured 10 times in parallel and the average value was taken. The results are shown in Figure 7-8 shown.

[0115] from Figure 7-8 It can be seen that the salty and fresh taste ranking of the four groups of samples is: sample 2 > sample 4 > sample 3 > sample 1 > standard product 2 > standard product 3 > standard product 1. The results of the electronic tongue are consistent with the results of the sensory evaluation.

[0116] We found that the four combinations of salt-reducing peptides have better salt-enhancing effects and freshness-enhancing properties than standard samples 1, 2, and 3; and the effects of sample 1 are better than those of salt-reducing peptide EF. 10 and PQ5 in terms of salt reduction and freshness enhancement properties; the effects of sample 2 were better than those of the salt-reducing peptide EF 10 The salt-reducing effect and freshness-enhancing properties of EF and PP9 were significantly different, indicating that the salt-reducing peptide EF 10 The combination of sample 4 and PP9 not only has the effect of reducing salt and enhancing freshness, but also has obvious synergistic effect; the effect of sample 3 is better than the salt-reducing effect and freshness-enhancing characteristics of salt-reducing peptides PQ5 and PP9, with significant differences, indicating that the combination of salt-reducing peptides PQ5 and PP9 not only has the effect of reducing salt and enhancing freshness, but also has synergistic effect; the effect of sample 4 is not only better than standard products 1, 2 and 3 respectively, but also has significant effect, and the effect of sample 4 is also better than sample 1 and sample 3.

[0117] In addition, and most importantly, we also found that when using a combination of salt-reducing peptides, as long as there are both strong TMC4 receptor binding peptides and ENaC receptor binding peptides, its salt-reducing effect is the best. For example, the effects of samples 2 and 4 are better than those of samples 1 and 3. However, we found that in sample 2, when only the strongest TMC4 receptor peptide (EF 10 ), and the strongest ENaC receptor peptide (PP9), its effect is significantly better than other combinations. It is possible that when these two salt-reducing peptides are present, there is a strong binding tendency, resulting in a good synergistic effect.

[0118] After comparing samples with different combinations of salt-reducing peptides, we found that when three salt-reducing peptides were present at the same time (i.e., sample 4), the effect was slightly inferior to sample 2 containing only two of the peptides, but still better than samples containing only other combinations (samples 1 and 3) or a single peptide (such as EF 10We speculate that this may be because PQ5 does not bind tightly enough to the two related receptors, thus interfering with the expected effects of the other two peptides (which may be the peptides used in combination with PQ5) to a certain extent. Therefore, the overall performance of sample 4 failed to surpass sample 2. On the other hand, for the 10 The single polypeptide sample of , due to its binding to the ENaC receptor, initiates a single signal and may not effectively affect the two related metabolic pathways, resulting in its salt reduction effect being inferior to the carefully proportioned combination formula in Sample 2.

[0119] In summary, our analysis shows that the interaction between peptides and their ability to bind to specific receptors are crucial to achieve the best salt reduction effect. The peptide combination in sample 2 may have just achieved the best synergistic effect, thus showing the best salt reduction effect. Although sample 4 was affected by PQ5 on receptor binding, it still achieved the best salt reduction effect by virtue of EF 10 The synergistic effect of PP9 has achieved good results in salt reduction. We need to deeply understand the interaction mechanism between various peptides and find the best combination. It provides ideas for the future development of efficient and precise salt reduction peptide combinations.

[0120] It will be apparent to those skilled in the art that the invention is not limited to the details of the exemplary embodiments described above and that the invention can be implemented in other specific forms without departing from the spirit or essential features of the invention. Therefore, the embodiments should be considered exemplary and non-limiting in all respects, and the scope of the invention is defined by the appended claims rather than the foregoing description, and it is intended that all variations falling within the meaning and scope of the equivalent elements of the claims be included in the invention. Any reference numeral in a claim should not be considered as limiting the claim to which it relates.

[0121] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. A natural salt-reducing polypeptide combination, comprising at least two salt-reducing polypeptides, wherein both of the two salt-reducing polypeptides are salt-reducing polypeptides capable of binding to TMC4 receptors and / or ENaC receptors.

2. The natural salt-reducing polypeptide combination according to claim 1, characterized in that: The salt-reducing polypeptide group includes salt-reducing polypeptides that strongly bind to the TMC4 receptor and salt-reducing polypeptides that strongly bind to the ENaC receptor.

3. The natural salt-reducing polypeptide combination according to claim 1 or 2, characterized in that: The salt-reducing polypeptides are all salt-reducing polypeptides that can bind to the TMC4 receptor and the ENaC receptor, and when combined with different salt-reducing polypeptides, the salt-reducing polypeptides have a binding tendency to the TMC4 receptor and the ENaC receptor.

4. The natural salt-reducing polypeptide combination according to claim 3, characterized in that: The salt-reducing polypeptide is selected from EF 10 , PP9 and PQ5, wherein the EF 10 The amino acid sequence of is shown in SEQ ID NO: 1: EDEGEQPRPF, the amino acid sequence of PP9 is shown in SEQ ID NO: 2: PKLLLLPKP, and the amino acid sequence of PQ5 is shown in SEQ ID NO: 3: PHEMQ; Preferably, the EF10, PP9 and PQ5 are all expressed by protease-deficient Pichia pastoris.

5. The natural salt-reducing polypeptide combination according to claim 4, characterized in that: The EF 10 The gene sequence is shown in SEQ ID NO:4: GAGGACGAAG GCGAGCAACC TAGACCTTTT; or The gene sequence of the PP9 is shown in SEQ ID NO:5: CCTAAATTATTGTTGTTGCC TAAACCA; or The gene sequence of PQ5 is shown in SEQ ID NO:6: CCCCATGAGATGCAA.

6. The natural salt-reducing polypeptide combination according to claim 4 or 5, characterized in that: The natural salt-reducing polypeptide combination includes EF 10 and PP9, the EF 10 Strongly binds to the ENaC receptor, and the PP9 strongly binds to the TMC4 receptor; Preferably, the natural salt-reducing polypeptide combination is EF 10 and PP9; Further preferably, the EF 10 The weight ratio of PP9 is (1-3):(1-2), preferably 1:

1.

7. The natural salt-reducing polypeptide combination according to claim 4 or 5, characterized in that: The natural salt-reducing polypeptide combination is EF 10 and PQ5, the EF 10 It binds strongly to the ENaC receptor, and the PQ5 auxiliary binds to the TMC4 receptor. Preferably, the EF 10 The weight ratio of PQ5 is (1-3):(1-2), preferably 1:

1.

8. The natural salt-reducing polypeptide combination according to claim 4 or 5, characterized in that: When the natural salt-reducing polypeptide combination is PP9 and PQ5, the PP9 strongly binds to the TMC4 receptor, and the PQ5 assists in binding to the TMC4 receptor. Preferably, the weight ratio of PP9 to PQ5 is (1-3):(1-2), preferably 1:

1.

9. A salt-reducing composition, comprising the natural salt-reducing polypeptide combination according to any one of claims 1 to 8, and edible salt, wherein the weight ratio of the edible salt to the salt-reducing polypeptide combination is (3-10):

1.

10. Use of the natural salt-reducing polypeptide combination according to any one of claims 1 to 8 or the composition according to claim 9 in the preparation of low-salt food or food additives, wherein the food additive is preferably a salt reducer or a salty taste enhancer.

11. A method for enhancing salty taste or reducing salt, comprising adding the natural salt-reducing polypeptide combination according to any one of claims 1 to 8 or the composition according to claim 9 to salt-containing food.

Images