Recombinant human collagen type xvii, method for preparing the same, and use thereof

By expressing recombinant human type XVII collagen using the PpicZaA vector in Pichia pastoris X-33 and purifying it with a hydrophobic cation exchange chromatography column, the problems of high-efficiency preparation and insufficient cell adhesion activity of recombinant human type XVII collagen in commercial expression systems were solved, achieving high yield and excellent cell adhesion effect, which is suitable for cosmetics, pharmaceuticals, health products and medical devices.

CN119798413BActive Publication Date: 2026-04-21XIAN GIANT BIOGENE TECH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
XIAN GIANT BIOGENE TECH CO LTD
Filing Date
2024-12-31
Publication Date
2026-04-21

AI Technical Summary

Technical Problem

Existing technologies struggle to efficiently express bioactive recombinant human type XVII collagen in commercial Pichia pastoris expression systems, and its cell adhesion activity is insufficient.

Method used

Recombinant human type XVII collagen was expressed in Pichia pastoris X-33 using the PpicZaA vector. The peptide was constructed by repeating the amino acid sequence multiple times, and the expression was optimized during fermentation. The recombinant protein with high yield and good cell adhesion-promoting activity was obtained by purification using hydrophobic cation exchange chromatography.

Benefits of technology

The preparation of recombinant human type XVII collagen at low cost and high yield was achieved, with an expression level greater than 10 g/L. Moreover, its cell adhesion-promoting activity was significantly better than that of natural collagen, making it suitable for cosmetics, pharmaceuticals, health products and medical devices.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005226833880000071
    Figure BDA0005226833880000071
  • Figure BDA0005226833880000081
    Figure BDA0005226833880000081
  • Figure BDA0005226833880000082
    Figure BDA0005226833880000082
Patent Text Reader

Abstract

This patent application discloses recombinant human type XVII collagen, its preparation method, and its applications. The recombinant human type XVII collagen is obtained by repeating the amino acid sequence derived from natural human type XVII collagen. Since the amino acid sequence of the recombinant human type XVII collagen is derived from natural human type XVII collagen, it will not produce adverse immune responses in humans. The recombinant human type XVII collagen can be secreted and expressed in a commercial yeast expression system at a level greater than 10 g / L. Its preparation method is simple, and high-yield recombinant human type XVII collagen can be obtained at low cost. Furthermore, the cell adhesion-promoting activity of the recombinant human type XVII collagen is significantly superior to that of human collagen.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of synthetic biology technology and relates to a high-yield recombinant human type XVII collagen with good cell adhesion-promoting activity, its preparation method and application. Background Technology

[0002] Collagen XVII (COL17) is a transmembrane protein that mediates homeostasis in the skin. COL17 assembles into a triple helix structure relying on a conserved GXY repeat sequence, where X and Y are primarily proline and hydroxyproline residues. The biological activity of COL17 is supported by functional domains, such as the collagen domain, which are associated with hemichromosomal and extracellular matrix proteins to maintain skin health. Biosynthesizing full-length collagen using microorganisms is challenging because the full-length molecule is insoluble. Therefore, obtaining recombinant human type XVII collagen with good biological activity and easy expression has been a focus of research. Summary of the Invention

[0003] In view of the technical problems existing in the prior art, the purpose of the present invention is to provide a recombinant human type XVII collagen that can be expressed at high yield in a commercial Pichia pastoris expression system and has good cell adhesion-promoting activity.

[0004] The technical solution of the present invention includes:

[0005] 1. A polypeptide or recombinant human type XVII collagen, obtained by repeating any of the amino acid sequences described in SEQ ID No. 1 to 6 n times, wherein n is an integer greater than or equal to 1.

[0006] 2. The polypeptide or recombinant human type XVII collagen according to item 1, wherein n is an integer greater than or equal to 6.

[0007] 3. The polypeptide or recombinant human type XVII collagen according to claim 1, wherein n is an integer less than or equal to 20.

[0008] 4. The polypeptide or recombinant human type XVII collagen according to claim 1, wherein n is an integer less than or equal to 15. For example, n can be 13.

[0009] 5. The polypeptide or polynucleotide of recombinant collagen described in item 1.

[0010] 6. An expression vector comprising the polynucleotide described in item 5. The expression vector may be a Ppic9k vector, a Ppic3.5k vector, a pGAPZaA vector, a PpicZaA vector, a shuttle vector, etc.; preferably, the expression vector is a PpicZaA vector.

[0011] 7. A host cell in which the expression vector described in item 6 has been introduced. The host cell may be, for example, a prokaryotic cell, yeast, or eukaryotic cell. Preferably, the host cell is Pichia pastoris X-33.

[0012] 8. A method for producing the recombinant human type XVII collagen of item 1, comprising the steps of: culturing the host cells of item 4 to express the recombinant human type XVII collagen, and collecting the cell culture.

[0013] 9. A product comprising the recombinant human type XVII collagen as described in claim 1. The product may be, for example, a cosmetic, pharmaceutical, health product, or medical device.

[0014] 10. The use of the recombinant human type XVII collagen described in item 1 in the preparation of cosmetics, pharmaceuticals, health products or medical devices.

[0015] The effects of the invention

[0016] This invention provides recombinant human type XVII collagen obtained by repeating the amino acid sequence from natural human type XVII collagen and its preparation method. The amino acid sequence of the recombinant human type XVII collagen is derived from natural human type XVII collagen and will not produce adverse immune responses in humans. The recombinant human type XVII collagen can be secreted and expressed in a commercial yeast expression system at a level greater than 10 g / L. Its preparation method is simple and can yield high-yield recombinant human type XVII collagen at low cost. Furthermore, the cell adhesion-promoting activity of the recombinant human type XVII collagen is significantly superior to that of human collagen. Attached Figure Description

[0017] Figure 1 This is an electrophoresis result of recombinant human type XVII collagen. Detailed Implementation

[0018] The present invention will now be described in detail with reference to specific embodiments. Unless otherwise specified, the scientific terms used in this specification have the meanings commonly understood by those skilled in the art; in case of conflict, the definitions in this specification shall prevail.

[0019] Example 1: Construction and expression of recombinant human type XVII collagen

[0020] 1. Construction of recombinant human type XVII collagen-producing bacteria

[0021] (1) Construction of recombinant plasmids

[0022] According to the amino acid sequence of recombinant human type XVII collagen C1R6, the codons of the yeast expression system were optimized to obtain the target gene sequence. The target gene sequence was then entrusted to Qingke Biotechnology Co., Ltd. for gene synthesis. The synthesized gene was ligated into the pPicZαA plasmid to obtain the pPicZαA-XVII plasmid.

[0023] The amino acid sequence of recombinant human type XVII collagen C1R6 is obtained by repeating the amino acid sequence of the C1 polypeptide (GPPGQKGEMGTPGPKGDRGPAGPPGHPGPPGPRGHKGEKGDKGDQ, SEQ ID No. 6) six times, and its encoding nucleotide sequence is shown in SEQ ID No. 7.

[0024] SEQ ID No.7

[0025] GGACCACCAGGACAGAAAGGAGAGATGGGTACCCCTGGACCAAAAG

[0026] GAGACCGTGGTCCAGCAGGTCCTCCAGGTCACCCAGGCCCTCCAGGT

[0027] CCTAGAGGACATAAGGGAGAGAAAGGCGATAAGGGTGACCAAGGAC

[0028] CTCCCGGTCAGAAGGGTGAAATGGGAACTCCCGGTCCAAAGGGAGAT

[0029] CGTGGTCCTGCTGGACCTCCCGGTCATCCTGGACCCCCAGGCCCTCGT

[0030] GGTCATAAGGGAGAAAAAGGTGACAAAGGCGATCAGGGTCCTCCTG

[0031] GTCAGAAAGGCGAAATGGGTACTCCAGGCCCTAAAGGAGACAGAGG

[0032] TCCCGCAGGTCCACCTGGTCACCCAGGACCACCAGGTCCCCGTGGTC

[0033] ACAAGGGTGAAAAAGGTGATAAGGGTGACCAAGGTCCACCTGGTCA

[0034] GAAAGGAGAAATGGGTACGCCTGGTCCAAAAGGTGATAGAGGTCCTG

[0035] CAGGACCCCCAGGTCATCCCGGACCTCCTGGTCCTCGTGGTCACAAG

[0036] GGCGAGAAAGGAGACAAAGGCGACCAGGGTCCCCCAGGTCAGAAGG

[0037] GCGAAATGGGCACTCCAGGACCTAAAGGCGATAGAGGACCAGCAGG

[0038] TCCACCCGGCCATCCTGGTCCACCAGGTCCTAGAGGACACAAGGGAG

[0039] AAAAGGGAGATAAAGGTGATCAGGGCCCTCCCGGACAGAAAGGTGA

[0040] GATGGGAACTCCTGGACCAAAGGGTGACAGAGGACCTGCAGGACCT

[0041] CCTGGCCATCCTGGTCCTCCTGGACCTAGAGGACATAAGGGTGAGAA

[0042] GGGTGACAAGGGCGACCAG

[0043] (2) Construction of yeast expression strains

[0044] pPicZαA-XVII was linearized with Pme I and then transformed into Pichia pastoris X-33 competent cells. Transformants were screened using bleomycin resistance as a selection marker to obtain the yeast expression strain.

[0045] 2. Induced expression of the target protein

[0046] 1) Select a single colony of the constructed yeast expression strain and add it to 5 ml of YPD liquid medium (1% yeast extract, 2% peptone and 2% glucose), and incubate at 30℃ and 200 rpm for 48 h for activation;

[0047] 2) Transfer 1% of the inoculum to a 500ml Erlenmeyer flask (containing 200ml of YPD culture medium), and incubate at 30℃ and 200rpm for 24h to serve as the seed for the next flask.

[0048] 3) Prepare 3L of BSM medium and add it to a 5L fermenter. Sterilize at 121℃ for 20min. After cooling to 30℃, adjust the pH to 5.0. Add the seed prepared in (2) to the fermenter in the form of flame inoculation for fermentation culture.

[0049] 4) When the OD600 reaches 70, 50% glycerol is added. When the OD600 reaches about 120, the addition is stopped. After the dissolved oxygen rebounds to 100%, methanol is added for induction. During the induction process, the dissolved oxygen is controlled to be no less than 30% and the pH is about 5.0. The induction is carried out for 40 hours. The fermentation is then stopped. The culture medium is centrifuged at 12,000 rpm for 2 minutes. The supernatant is collected to obtain recombinant human type XVII collagen C1R6.

[0050] 5) Preparation of buffer: 20 mM / L potassium phosphate buffer (Solution A, pH 6.0), with 20 mM / L potassium phosphate buffer + 1 mol / L NaCl (Solution B, pH 6.0) as the elution buffer. The collected supernatant, after pH adjustment and filtration, is loaded onto a hydrophobic cation exchange chromatography column. Before loading, the column is equilibrated with Solution A. After loading, impurities are washed with 20% Solution B, and finally eluted with Solution B. The eluted protein is the purified target protein. Protein expression levels are validated using SDS-PAGE.

[0051] Using the same method as described above, the following recombinant human type XVII collagen was expressed, and the protein expression level was verified by SDS-PAGE.

[0052] The amino acid sequence of recombinant human type XVII collagen C14R6 was obtained by repeating the amino acid sequence of the C14 polypeptide (GPPGPPGAMGPPGPPGAPGPAGPAGLPGHQ, SEQ ID No. 1) 6 times.

[0053] The amino acid sequence of recombinant human type XVII collagen C13R6 was obtained by repeating the amino acid sequence of the C13 polypeptide (GPPGPPGPRGPPGPSIPGPPGPRGPPGEGLPGPPGPPGSF, SEQ ID No. 2) 6 times.

[0054] The amino acid sequence of recombinant human type XVII collagen C12R6 was obtained by repeating the amino acid sequence of the C12 polypeptide (GPPGPPGPPGPKGDQGPPGPRGHQGEQGLPGFS, SEQ ID No. 3) six times.

[0055] The amino acid sequence of recombinant human type XVII collagen C11R6 was obtained by repeating the amino acid sequence of the C11 polypeptide (GPPGPPGPQGPKGDKGDPGVPGALGIP, SEQ ID No. 4) 6 times.

[0056] The amino acid sequence of recombinant human type XVII collagen C3R6 was obtained by repeating the amino acid sequence of the C3 polypeptide (GGAGSLGAGGAFGEAAGDRGPYGTDIGPGGGYGAAAEGGMYAGNGG LLGAD, SEQ ID No. 5) 6 times.

[0057] Protein expression level validation results showed that C14R6, C13R6, and C11R6 proteins were not expressed, while C12R6, C3R6, and C1R6 proteins were successfully expressed, with the protein expression levels in the order: C1R6 > C3R6 > C12R6. SDS-PAGE electrophoresis results are as follows: Figure 1 As shown, the results are presented in Table 1.

[0058] Table 1. Different amino acid sequences and expression results

[0059]

[0060] Example 2: Determination of the cell adhesion-promoting activity of recombinant human type XVII collagen

[0061] Normally cultured HSF (human skin fibroblast) cells were used. C1R6, C12R6, and C3R6 collagen purified lyophilized products and natural human collagen (purchased from Sigma, catalog number C7774) (commercially available, obtained by extraction method) were prepared with PBS solution to 0.25 mg / L, 0.5 mg / L, and 1 mg / L concentrations, respectively, and applied to HSF (human skin fibroblast) cells to perform cell adhesion promotion experiments. The specific steps are as follows: Human HSF cells were seeded into sterile 96-well plates with 200 μL of culture medium per well. The blank control group was added with only PBS. After incubation at 37°C for 2 hours, each group was washed 3 times with PBS to remove unadhered cells. 100 μL of culture medium and 50 μL of MTT solution were added to each well, shaken well, and incubated in an incubator for 4 hours. The mixture was then aspirated, and 150 μL of DMSO was added to dissolve the purple formazan crystals. The mixture was shaken for 10 minutes and then placed in a microplate reader. The absorbance value of each well was measured at a wavelength of 570 nm.

[0062] Cell adhesion promotion rate = (OD of experimental group - OD of blank group) × 100% / blank group.

[0063] The results are shown in Table 2. It can be seen that recombinant human type XVII collagen C1R6 and C3R6 have better cell adhesion-promoting activities than commercial natural human collagen, and the cell adhesion-promoting activities are: C1R6 > C12R6 > C3R6.

[0064] Table 2. Cell adhesion rate values ​​of different concentrations of recombinant collagen on the adhesion-promoting effect of skin fibroblasts.

[0065]

[0066] Example 3: Preparation of C1R1 peptide and C1R13 recombinant human type XVII collagen and determination of their cell adhesion-promoting activity

[0067] The C1R1 polypeptide (SEQ ID No. 6) was synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0068] C1R13 recombinant human type XVII collagen (obtained by repeating the amino acid sequence of SEQ ID No. 6 13 times) was obtained according to Example 1.

[0069] The cell adhesion-promoting activities of the above-mentioned C1R1 polypeptide and C1R13 recombinant human type XVII collagen were determined according to the method of Example 2. The results are shown in Table 3. It can be seen that both of them also have good cell adhesion-promoting activities.

[0070] Table 3. Cell adhesion rate values ​​of different concentrations of recombinant collagen on the adhesion-promoting effect of skin fibroblasts.

[0071]

Claims

1. A recombinant human type XVII collagen, obtained by repeating the amino acid sequence of SEQ ID No. 3 n times, wherein, n is 6.

2. A polynucleotide encoding the recombinant collagen of claim 1.

3. An expression vector comprising the polynucleotide of claim 2.

4. The host cell into which the expression vector of claim 3 is introduced.

5. A method for producing the recombinant human type XVII collagen according to claim 1, comprising: The steps of culturing the host cells of claim 4 to express the recombinant human type XVII collagen and collecting the cell culture.

6. A product comprising the recombinant human type XVII collagen as described in claim 1, wherein the product is a cosmetic or a medical device.

7. Use of the recombinant human type XVII collagen according to claim 1 in the preparation of cosmetics or medical devices.

Citation Information

Patent Citations

  • Recombinant X VII humanized collagen as well as preparation method and application thereof

    CN116751282A

  • High-stability recombinant XVII type collagen as well as construction method and application thereof

    CN119751646A