Cladomucor racemosus and application thereof

Abstract

The invention discloses a Cladomucor racemosus and application thereof, the strain number of the Cladomucor racemosus is JSAFC 1762, the Cladomucor racemosus is preserved in China General Microbiological Culture Collection Center on December 9, 2024, and the preservation number of the Cladomucor racemosus is CGMCC No.41702. The invention further discloses a preparation method of the Cladomucor racemosus. According to the application disclosed by the invention, the soil around the sweetgum is separated and purified to obtain the mycomucor racemosus (Mucorracemosus). The strain can be used as a biocontrol strain and has inhibitory activity on trametes maze, and the inhibition rate of plate confrontation culture reaches 58.01%; meanwhile, the strain can promote the growth of liquidambar formosana hance and regulate the growth of plants, and has great significance for the development of biocontrol microbial agents for preventing and treating wood rot in the future.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and relates to Mucor racemosus and applications thereof. Background Art

[0002] Liquidambar has a straight trunk, a majestic tree, and bright red autumn leaves. It is suitable for single planting, clump planting, and group planting. Liquidambar can be used as a street tree because of its beautiful appearance and red leaves, and has a high ornamental value. The resin is used for medicinal purposes, which can detoxify and relieve pain, stop bleeding and promote tissue regeneration. The roots, leaves and fruits are also used as medicine, which have the effects of dispelling wind and dampness, and promoting blood circulation. The wood is slightly hard and can be used to make furniture and packing of valuable goods. Wood rot is a common disease in the growth process of Liquidambar. It mainly harms the xylem of Liquidambar, causing the xylem to decay, thereby affecting the normal growth of Liquidambar, the growth of its leaves and the quality of the wood. Among them, the wood rot caused by Trametes gibbosa mainly harms the branches and heartwood of Liquidambar, causing the core wood to decay, and presents a ring pattern. The xylem of infected trees becomes white and loose, soft and brittle, decayed and fragile, often leading to tree weakness, yellowing of leaves or premature leaf fall.

[0003] At present, chemical pesticides are commonly used to prevent and control plant diseases. However, long-term use will cause many pathogens to develop resistance, reducing the disease prevention effect. Frequent and high-concentration use will pollute the environment, and excessive residual toxicity will threaten human health. There are many beneficial microorganisms in the environment around plants. These microorganisms will not only not cause plant diseases, but some can even induce plant resistance and improve the survival ability of plants under biotic or abiotic stress conditions. In addition, these microorganisms come from the natural environment and are pollution-free. Using these microorganisms to prevent and control plant diseases is conducive to maintaining ecological balance. Summary of the invention

[0004] Purpose of the invention: The purpose of the present invention is to provide a kind of Mucor racemosus, and its application in inhibiting the growth of Trametes labyrinthus and promoting the growth of Liquidambar formosana.

[0005] Technical solution: The present invention provides a Mucor racemosus, the strain number of the Mucor racemosus is JSAFC 1762, which was deposited in the General Microbiology Center of China National Microbiological Culture Collection Administration on December 9, 2024, with a deposit number of CGMCC No.41702.

[0006] Furthermore, the nucleotide sequence of the ITS gene of Mucor racemosus is shown in SEQ ID NO.1.

[0007] The present invention also provides a biocontrol fungus agent, wherein the active ingredient of the biocontrol fungus agent is the above-mentioned Mucor racemosus.

[0008] The present invention also provides the use of the above-mentioned Mucor racemosus and biocontrol bacteria agent in inhibiting the growth of Trametes labyrinthus.

[0009] The invention also provides the use of the above-mentioned Mucor racemosus and the biocontrol fungus agent in promoting the growth of Liquidambar formosana.

[0010] Furthermore, the application is specifically to promote the plant height growth and increase the number of maple leaves of Liquidambar formosana by irrigating the roots of Liquidambar formosana with a spore suspension of Mucor racemosus JSAFC 1762.

[0011] Furthermore, the preparation method of the spore suspension is as follows: (1) taking the biocontrol fungus Mucor racemosus JSAFC 1762, under sterile conditions, picking up mycelium with an inoculation needle, inoculating it into a sterilized PDA culture medium, and culturing it for 5-7 days; (2) under sterile conditions, scraping the mycelium, washing the mycelium with sterile water and filtering it with gauze; (3) under sterile conditions, adjusting the spore concentration with sterile water.

[0012] Furthermore, the culture conditions in step (1) are 25° C., 65% humidity, and dark culture.

[0013] Further, the concentration of the spore suspension is 10 5 / ml.

[0014] Furthermore, the spore suspension is applied in an amount of 5 mL / time / 2 days for 30 days.

[0015] Beneficial effects: Compared with the prior art, the present invention has the following outstanding advantages: The present invention obtains a species of Mucorracemosus by isolating and purifying the soil around Liquidambar formosana. The strain can be used as a biocontrol strain to inhibit the fungus Pyrophilum labyrinthum, and the inhibition rate of plate confrontation culture is 58.01%. At the same time, the strain can promote the development of Liquidambar formosana and regulate the growth of plants, which is of great significance for the future development of biocontrol agents for preventing and controlling wood rot. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 : Phylogenetic tree of Mucor racemosus JSAFC 1762.

[0017] Figure 2 :Confrontation culture of Mucorracemosus JSAFC 1762 and Trametes labyrinthus.

[0018] Figure 3 :Effects of Mucorracemosus JSAFC 1762 on the growth of Liquidambar formosana. DETAILED DESCRIPTION

[0019] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0020] As described in the present invention, the term "biocontrol bacteria" refers to beneficial microorganisms that can prevent and control plant diseases, mainly bacteria, fungi, and actinomycetes.

[0021] Example 1: Isolation and identification of Mucorracemosus JSAFC 1762

[0022] 1. Isolation of Mucorracemosus JSAFC 1762

[0023] JSAFC 1762 was isolated from soil with good growth conditions of Liquidambar formosana in Nanning, Guangxi. The characteristics of the colony are as follows: when cultured on PDA plate culture medium, the colony grows rapidly, is sparse and flocculent, and its surface color is light yellow.

[0024] 2. Molecular biological identification of Mucor racemosus JSAFC 1762

[0025] (1) The genomic DNA of strain JSAFC 1762 was extracted using a kit from TIANGEN.

[0026] (2) Amplification of ITS gene from genomic DNA. DNA amplification was performed in a 30 μL reaction volume, including 15 μL 2×EasyTaq PCR SuperMix (+dye), 1 μL (10 μM) of primer pair ITS1 (SEQ ID NO.2: 5'-CTTGGTCATTTAGAGGAAGTAA-3') & ITS4 (SEQ ID NO.3: 5'-TCCTCCGCTTATTGATATGC-3'), 2 μL template DNA and 11 μL ddH2O. The PCR amplification program conditions were as follows: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 54°C annealing for 45 s, 72°C extension for 60 s, for a total of 35 cycles; and finally 72°C extension for 10 min.

[0027] (3) The amplified PCR products were subjected to 1% agarose gel electrophoresis and observed under ultraviolet light. The PCR products with target bands were sent to Nanjing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were as follows: the ITS gene sequence of strain JSAFC 1762 was SEQ ID NO. 1 (TCTATTTACTGTGAACTGTATTATTATTTGACATTTGAGGGATGTTCCAATGTTATA AGGATAGACATTGGAAATGTTAACCGAGTCATAATCAGGTTTAGGCCTGGTATCCTATTATTATTTACCAAATGAATTCAGAATTAATATTGTAACATAGACCTAAAAAATCTATAAAACAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCG AGTCTTTGAACGCAACTTGCGCTCATTGGTATTCCAATGAGCACGCCTGTTTCAGTATCAAAACAAACCCTCTATCCAACTTTTGTTGTATAGGATTATTGGGGGCCTCTCGATCTGTATAGATCTTGAAATCCCTGAAATTTACTAAGGCCTGAACTTGTTTAAATGCCTGAACTTTTTTTTAATATAAAGGAAAGCTCTTGTAATTGAC).

[0028] (4) Compare the sequence of SEQ ID NO.1 on the NCBI database website and establish a phylogenetic tree, see Figure 1 . The comparison results are shown in Table 1. According to the results in Table 1, it can be inferred that the biocontrol bacteria JSAFC 1762 of the present invention is Mucorracemosus, named Mucorracemosus JSAFC 1762, and the strain was deposited in the General Microbiological Center of China Microorganism Culture Collection Administration on December 9, 2024, with a deposit number of CGMCC No.41702, and a classification name of Mucorracemosus JSAFC 1762. The deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen 1st Courtyard, Chaoyang District, Beijing.

[0029] Table 1 Sequence alignment results of SEQ ID NO.1

[0030]

[0031] Example 2: Inhibitory effect of Mucorracemosus JSAFC 1762 on Psoralea corylifolia

[0032] (1) On a clean bench, a 4 mm diameter bacterial cake of Mucor racemosus JSAFC 1020 was inoculated on one side of a PDA culture medium plate, and the other side was not inoculated with Mucor racemosus JSAFC 1762 as a control group, and the other side was symmetrically inoculated with a 4 mm diameter bacterial cake of Mucor racemosus JSAFC 1762 as an experimental group.

[0033] (2) The experimental group and control group cultures of step (1) were inverted and cultured in a constant temperature incubator at 25° C. under the conditions of 8 h of light, followed by 16 h of dark culture, for a total of 7 days.

[0034] (3) The colony radius of Mucor racemosus was measured by the plate confrontation method, and the inhibitory effect of Mucor racemosus JSAFC 1762 on Mucor racemosus was observed.

[0035] The results are as follows Figure 2 As shown, the colony radius of Mucorracemosus in the blank control group was 2.12 cm; in the experimental group, the average radius of the Mucorracemosus pathogen was only 0.89 cm as determined by the plate confrontation method, and the inhibition rate was 58.01%, indicating that Mucorracemosus JSAFC 1762 had a significant inhibitory effect on Mucorracemosus.

[0036] Example 3: Effect of Mucor racemosus JSAFC 1762 on the growth of Liquidambar formosana

[0037] (1) A 5 mm diameter mycelium block of the strain Mucor racemosus JSAFC 1762 was taken out using a borer and inoculated into a 9 cm diameter culture dish (containing 15 ml of PDA medium) and cultured in the dark at 25° C. and 65% humidity for 7 days.

[0038] (2) Under sterile conditions, scrape the mycelium, rinse it with sterile water and filter it with gauze, then adjust the spore concentration to 10 5 / ml.

[0039] (3) Select pots with a diameter of 12 cm, and transplant one healthy Liquidambar seedling (variety: Shahong) with uniform growth into each pot. The experiment was set up in two groups (control group and treatment group), and each treatment was set up with 10 replicates. The experimental group: each pot was irrigated with 5 mL of Mucor racemosus JSAFC 1762 spore suspension; the control group: each pot was irrigated with 5 mL of sterile water.

[0040] (4) Water each group of Liquidambar seedlings every 2 days. After 30 days, count the plant heights of the Liquidambar seedlings and observe the root growth and development of the Liquidambar seedlings.

[0041] The results are as follows Figure 3 And as shown in Table 2.

[0042] Table 2 Statistical results of Liquidambar formosana plant height

[0043]

[0044] The numerical expression of plant height in the table is mean ± standard error.

[0045] from Figure 3 As shown in the data in Table 2, the plant height and maple leaf growth of the experimental group were significantly better than those of the control group, indicating that Mucorracemosus JSAFC 1762 promoted the growth of Liquidambar formosana.

Claims

1. A Mucor racemosus, characterized in that The strain number of the Mucorracemosus is JSAFC 1762, which was deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration on December 9, 2024, with the deposit number CGMCC No.41702.

2. The Mucor racemosus according to claim 1, characterized in that The nucleotide sequence of the ITS gene of Mucor racemosus is shown in SEQ ID NO.

1.

3. A biocontrol agent, characterized in that: The active ingredient of the biocontrol fungus agent is the Mucor racemosus described in any one of claims 1 to 2.

4. Use of the Mucor racemosus according to any one of claims 1 to 2 and the biocontrol agent according to claim 3 in inhibiting the growth of Trametes labyrinthus.

5. Use of the Mucor racemosus according to any one of claims 1 to 2 and the biocontrol agent according to claim 3 in promoting the growth of Liquidambar formosana.

6. The use according to claim 5, characterized in that: The application is specifically to promote the plant height growth and increase the number of maple leaves of Liquidambar formosana by irrigating the roots of Liquidambar formosana with a spore suspension of Mucorracemosus JSAFC 1762.

7. The use according to claim 6, characterized in that: The preparation method of the spore suspension is as follows: (1) taking the biocontrol fungus Mucor racemosus JSAFC 1762, picking up hyphae with an inoculation needle under sterile conditions, inoculating the hyphae into a sterilized PDA culture medium, and culturing for 5-7 days; (2) scraping the hyphae under sterile conditions, washing the hyphae with sterile water and filtering with gauze; (3) adjusting the spore concentration with sterile water under sterile conditions.

8. The use according to claim 7, characterized in that: The culture conditions in step (1) are 25° C., 65% humidity, and dark culture.

9. The use according to claim 6, characterized in that: The concentration of the spore suspension is 10 5 / ml.

10. The use according to claim 6, characterized in that: The spore suspension was applied in an amount of 5 mL / time / 2 days for 30 days.

Images