Bacillus subtilis strain, biocontrol product and application
The biodefense products prepared by Bacillus subtilis BS74 effectively inhibit Fusarium erythropodite, solve the pollution and health risks of chemical pesticides in melon disease prevention and control, and achieve efficient and environmentally friendly biological control effects.
Patent Information
- Application Number
- CN202411970259.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-30
- Publication Date
- 2025-04-11
AI Technical Summary
Common Fusarium diseases in melon cultivation cause plants to wilt and fruit rot. The existing chemical control methods not only affect the quality and safety of melons, but also pollute the environment and endanger human health.
Bacillus subtilis strain BS74 is provided. The biodegradable agent and biodegradable agent are prepared by strains isolated from the soil of the melon field. It is used to inhibit the growth of mycelium and spore germination of Fusarium rosy, and is used to prevent and treat rot disease in the roots and leaves of melons.
Bacillus subtilis BS74 significantly inhibits the growth of Fusarium erythropodite, and the prevention and control of melon rot disease is as high as 67.2%, avoiding environmental and health problems caused by the use of chemical pesticides.
Smart Images
Figure CN119799565A_ABST
Abstract
Description
Technical Field
[0001] The present application relates to the technical field of biological control of plant diseases, and in particular to a Bacillus subtilis strain, a biological control product and applications. Background Art
[0002] Muskmelon (Cucumis melo) is an annual climbing or creeping herb of the Cucurbitaceae family. It is native to the tropics and is widely planted both at home and abroad. For example, it is widely planted in various parts of my country as a local specialty agricultural industry. However, during the planting process, melon plants are easily infected by pathogens, causing the plants to wilt and die, affecting the yield and quality of the fruit, and restricting the healthy development of the melon industry.
[0003] Fusarium spp. is a common pathogenic fungus that infects melons. Due to the large area of melon cultivation and the fact that most of them are grown in facilities, the high temperature and high humidity environment is very conducive to the growth and reproduction of Fusarium and the spread of the disease. After Fusarium infects melons, it causes leaf wilt, root rot, flower rot, stem base rot and fruit rot, which in turn affects the yield and quality of melon fruits.
[0004] In recent years, Fusarium incarnatum has been reported to cause a variety of plant diseases. For example, Araujo et al. found that the main pathogens of post-harvest diseases of Brazilian melons were F. falciforme of the F. fujikuroispecies complex (FFSC) and F. sulawesiense of the F. incarnatum-equiseti species complex (FIESC). Wang Yan et al. first reported in 2019 that Fusarium incarnatum caused melon fruit rot. Xu Shaohua et al. found that cucumber fruit rot in Jiangsu Province in 2019 was caused by Fusarium incarnatum. Du Lifang et al. found that Fusarium incarnatum can cause Hami melon fruit rot.
[0005] At present, the prevention and control of fungal diseases of melons mostly adopts chemical means, such as using carbendazim, pyraclostrobin and cyproconazole to control diseases caused by Fusarium rubrum. However, the long-term use of chemical agents will not only affect the quality and safety of melons, but also pollute the environment and endanger human health. Summary of the invention
[0006] In view of the problems of the prior art, the present application provides a Bacillus subtilis strain, a biocontrol product and an application thereof, so as to effectively prevent and control plant diseases caused by Fusarium rubrum.
[0007] The Bacillus subtilis strain provided in the present application was isolated from a soil sample of a melon field in Dongqianhu Town, Yinzhou District, Ningbo City, Zhejiang Province, and was classified and named Bacillus subtilis BS74. It was deposited in the China Center for Type Culture Collection (CCTCC) on May 21, 2024, with the deposit number CCTCC NO: M 20241022.
[0008] After the Bacillus subtilis BS74 was cultured at a constant temperature of 30° C. for 48 hours on the LB medium, the surface of the colony was rough, opaque, slightly yellow or off-white, with wrinkles and protrusions, and no wire drawing was found when the inoculation loop was lightly touched.
[0009] The present application also provides the use of the Bacillus subtilis strain in antagonizing Fusarium rubrotinii. The Bacillus subtilis BS74 can effectively inhibit the hyphae growth and spore germination of Fusarium rubrotinii and has a good antagonistic effect.
[0010] The present application also provides the use of the Bacillus subtilis strain in the preparation of a biocontrol product for preventing and controlling plant rot diseases. Specifically, the biocontrol product is a biocontrol fungicide, a biocontrol agent or a biological pesticide.
[0011] The present application also provides a biocontrol agent comprising a suspension of the Bacillus subtilis strain.
[0012] Optionally, the concentration of Bacillus subtilis in the biocontrol agent is 1×10 7 ~1×10 8 CFU / mL.
[0013] Optionally, the preparation method of the biocontrol agent comprises:
[0014] The Bacillus subtilis BS74 was inoculated into LB culture medium and cultured until the culture medium OD 600 is 0.5-0.8, to obtain seed liquid; the seed liquid is inoculated into a fermentation medium for expanded culture to obtain the biocontrol agent.
[0015] Optionally, the fermentation medium is NA liquid medium, and the formula of NA liquid medium is: 5g peptone, 3g beef extract, 2.5g glucose, 5g NaCl, deionized water to 1L, pH 7.0.
[0016] Optionally, the inoculation amount of the seed solution is 1-2% (v / v).
[0017] Optionally, the expansion culture is carried out in a shaker, the temperature of the expansion culture is 30° C., the rotation speed is 180 rpm, and the time is 72 h.
[0018] Optionally, the concentration of the bacterial suspension obtained after fermentation broth culture is 1×108 ~1×10 10 cfu / mL. When used, the bacterial suspension can be diluted before use, for example, diluted to 1×10 7 ~1×10 8 CFU / mL.
[0019] The present application also provides a biocontrol agent, comprising the cell-free supernatant of the Bacillus subtilis fermentation broth.
[0020] Optionally, the volume concentration of the cell-free supernatant in the biocontrol agent is 1-10%.
[0021] Optionally, the method for preparing the cell-free supernatant includes: centrifuging and filtering the fermentation broth of Bacillus subtilis BS74 to obtain the cell-free supernatant.
[0022] Optionally, the centrifugal speed is 10000 rpm and the centrifugal time is 10 min.
[0023] Optionally, filtration is performed using a 0.22 μm bacterial filter.
[0024] The present application also provides a method for preventing and treating plant rot caused by infection of Fusarium rubrotii, comprising: spraying the biocontrol agent or the biocontrol agent on plants. The spraying site may be the root and / or leaf of the plant. The suspension of the Bacillus subtilis strain and the cell-free supernatant of the fermentation broth of Bacillus subtilis can effectively inhibit the hyphae growth and spore germination of Fusarium rubrotii, and have a good antagonistic effect.
[0025] Specifically, the present application provides the biocontrol agent and the use of the biocontrol agent in preventing and controlling melon rot caused by infection of Fusarium rubrum.
[0026] Optionally, the biocontrol agent or the biocontrol agent is applied to the roots and / or leaves of the melon, for example, the biocontrol agent or the biocontrol agent is poured on the roots of the melon and / or sprayed on the leaves of the melon.
[0027] Specifically, after sowing melon seeds and culturing for 25 to 30 days, the biocontrol agent or biocontrol agent is irrigated to the roots of the melon plants, and after continuing to cultivate for 7 to 10 days, the biocontrol agent or biocontrol agent is irrigated to the roots of the melon plants again. The amount of each irrigation is 50 to 70 mL per plant.
[0028] Optionally, place 1×10 8 ~1×10 10 CFU / mL of bacterial suspension was diluted to 1×10 7 ~1×10 8 CFU / mL, as the biocontrol agent.
[0029] Optionally, the cell-free supernatant is diluted to obtain a cell-free supernatant with a volume percentage of 1 to 10% as the biocontrol agent.
[0030] Optionally, the solvent used for dilution is water.
[0031] Compared with the prior art, this application has at least the following beneficial effects:
[0032] (1) The Bacillus subtilis BS74 screened in the present application has shown in the plate antagonism test that its bacterial body and supernatant have a good inhibitory effect on the mycelial growth and spore germination of Fusarium rubrotinii, and can be used for the biological control of plant rot caused by Fusarium rubrotinii.
[0033] (2) The Bacillus subtilis BS74 screened in the present application showed significant effects in controlling Fusarium rubrum in melon plants under greenhouse pot test conditions, effectively inhibiting the spread of pathogenic bacteria on the surface of melon leaves and preventing root atrophy, with a control efficiency of up to 67.2%.
[0034] (3) The Bacillus subtilis BS74 screened in the present application is applied to the prevention and treatment of melon rot, which can overcome a series of problems caused by the use of chemical pesticides, and is thus conducive to the pollution-free production of agricultural products. Farmers can avoid or reduce the use of other chemical pesticides, which not only saves farmers money but also helps improve product quality. BRIEF DESCRIPTION OF THE DRAWINGS
[0035] Figure 1 This is the colony morphology of Bacillus subtilis BS74 of this application;
[0036] Figure 2 The figure is the result of the physiological and biochemical properties of Bacillus subtilis BS74 in Example 1;
[0037] Figure 3 This is a plate antagonistic result diagram of Bacillus subtilis BS74 against Fusarium rubrum in Application Example 1;
[0038] Figure 4 This is a graph showing the results of the biocontrol agent in Application Example 2 inhibiting the hyphae of Fusarium rubrum;
[0039] Figure 5 This is a graph showing the results of the biocontrol agent in Application Example 3 inhibiting the spore germination of Fusarium rubrum;
[0040] Figure 6 This is a diagram showing the effect of using the biocontrol agent in Application Example 4 to control melon rot. DETAILED DESCRIPTION
[0041] The following will be combined with specific implementation methods and drawings to clearly and completely describe the technical solutions in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, not all of the embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of this application.
[0042] This application involves a variety of culture media, and the specific formulas of each culture medium are as follows:
[0043] The formula of LB culture medium (per liter) is: 10 g tryptone, 10 g sodium chloride, 5 g yeast extract, pH = 7.2.
[0044] The formula of WA medium (per liter): 5g peptone, 10g glucose, 3g meat extract, 5g sodium chloride, 20g agar, pH=7.0, pour into plates for later use.
[0045] The formula of starch solution medium (per liter): peptone 5.0g, glucose 5.0g, sodium chloride 5.0g, ddH 2 O to 1000 mL, pH 7.2, autoclave at 121°C for 20 min, and pour into plates for later use.
[0046] Formula of skim milk culture medium (per liter): 3.0 g skim milk powder and 3.0 g agar powder, respectively, with ddH 2 O to 100 mL, sterilize under high pressure at 121°C for 20 min, and then mix the two to make a plate for later use.
[0047] Formula of cellulose Congo red medium (per liter): magnesium sulfate 0.5g, dipotassium hydrogen phosphate 0.9g, sodium nitrate 1.0g, disodium hydrogen phosphate 1.2g, potassium chloride 0.5g, yeast powder 0.5g, Congo red 0.2g, cellulose powder 5.0g, acid hydrolyzed casein 0.5g, agar powder 15.0g, ddH 2 O to 1000 mL, pH 7.0, autoclave at 121°C for 20 min, and pour into plates for later use.
[0048] Formula of inorganic phosphorus bacterial culture medium (per liter): glucose 10.0g, calcium phosphate 0.2g, ammonium sulfate 0.5g, yeast extract powder 0.5g, sodium chloride 0.3g, potassium chloride 0.3g, magnesium sulfate 0.3g, manganese sulfate 0.03g, ferrous sulfate 0.03g, agar powder 15.0g, ddH 2 O to 1000 mL, sterilize under high pressure at 121℃ for 20 min, and pour into plates for later use.
[0049] Formula of CAS solid medium (per liter): Take 0.121g of chrome azurol S and mix with 85mL ddHO 2O dissolved, add 15 mL of 1 mM FeCl 3 This is liquid A; take 0.2187 g of hexadecyltrimethylammonium bromide and use 600 mL of ddH 2 O dissolved to obtain solution B; take 43.07 g of anhydrous piperazine and use 200 mL of ddH 2 O was dissolved, HCl was added to adjust the pH to 5.6, and the volume was adjusted to 300 mL as liquid C. The three solutions were mixed in sequence to obtain CAS liquid detection agent. When making solid plates, 20% agar was added to the liquid detection solution and then sterilized at 121℃ for 20 minutes, and the plates were poured for use.
[0050] The formula of liquid NA medium (per liter) is: peptone, 5 g, beef extract, 3 g, glucose, 2.5 g, NaCl, 5 g, and the pH is adjusted to 7.0.
[0051] The formula of PDA medium (per liter): 200 g potato, 20 g glucose, 10 g agar powder, autoclaved at 121°C for 20 min.
[0052] The red Fusarium strain used in this application was obtained from diseased melon leaves and fruit samples obtained by the laboratory from Shanghai and Zhejiang, and was isolated, purified and identified. A total of 14 red Fusarium strains were isolated in this laboratory. Judging from the morphology and color of the strains, these red Fusarium strains have different strain types. It was found that the biocontrol bacteria BS74 of this application has an inhibitory effect on all red Fusarium strains.
[0053] Example 1 Collection, Isolation and Identification of Bacillus subtilis BS74
[0054] (1) Collection and isolation of strains
[0055] Soil samples were collected from a melon field in Dongqianhu Town, Yinzhou District, Ningbo City, Zhejiang Province. 1 g of soil sample was weighed and added to 10 mL of 0.7 mol / L sodium chloride solution, and oscillated for 1 min to prepare a soil suspension. The soil solution was then diluted with 0.7 mol / L sodium chloride solution to a concentration of 1 × 10 -4 , 1×10 -5 and 1×10 -6 Gradient. Apply different gradient soil solutions (100μL / each plate) on LB plates. Place the coated plates in a 28℃ constant temperature incubator for culture. After culturing for 24 hours, pick the colonies and purify them on the LB plates to obtain purified strains. Store the purified strains in a 4℃ refrigerator for later use. After activating the purified colonies, streak them on the WA plates in sequence. After 24 hours, connect a circular bacterial block with a diameter of 6mm punched from the outer edge of the colony with a sterilized puncher in the center of the plate. After 4 days, select the strain that most obviously inhibits the growth of Fusarium rubrum hyphae as the biocontrol strain.
[0056] See also Figure 1 The surface of the colony of this strain on LB medium is rough, opaque, slightly yellowish or grayish white, with wrinkles and protrusions, and there is no stringiness when the inoculation loop is touched lightly.
[0057] (2) Identification
[0058] The bacterial 16S rDNA sequence was amplified by colony PCR using bacterial 16S primers, 16S-27f:AGAGTTTGATCCTGGCTCAG (SEQ ID NO: 1) and 16S-1492r:AAGGAGGTGATCCAGCCGCA (SEQ ID NO: 2). The PCR amplification reaction system was 25 μL: ddH 2 O 8μL, Taq Mix 12.5μL, 16S-27f primer 1μL, 16S-1492r primer 1μL, DNA template 2.5μL. The PCR reaction program was 94℃, 5min; 94℃, 30s, 58℃, 30s, 72℃, 60s, 33 cycles; the obtained PCR product was stored at 16℃. The PCR amplification product was sent to Hangzhou Qingke Biotechnology Co., Ltd. for sequence analysis. The sequencing sequence result is shown in SEQ ID NO: 3.
[0059] The sequences were compared in NCBI, and the comparison results showed that the strain of the present application had the highest homology with Bacillus subtilis, so it was classified and named Bacillus subtilis BS74. The strain was deposited in the China Center for Type Culture Collection (CCTCC) on May 21, 2024, with the deposit number CCTCCNO: M 20241022.
[0060] (3) Physiological and biochemical analysis
[0061] Amylase production assay: inoculate Bacillus subtilis BS74 on starch-dissolving medium, culture at 37°C for 4 days, then add iodine solution to the bacterial plate. If a transparent circle is formed, it means that the strain can hydrolyze starch and the reaction result is positive, otherwise it is negative.
[0062] Protease production assay: Inoculate Bacillus subtilis BS74 on skimmed milk medium, culture at 37°C for 2 days, and observe whether a transparent circle appears. If so, the reaction result is positive, otherwise it is negative.
[0063] Determination of cellulase activity: Inoculate Bacillus subtilis BS74 on cellulose Congo red medium, culture at 37°C for 2 days, and observe whether there is a transparent circle. If a transparent hydrolysis circle is produced, it is positive, otherwise it is negative.
[0064] Determination of inorganic phosphorus solubilization ability: inoculate Bacillus subtilis BS74 on inorganic phosphorus bacterial culture medium, culture at 28℃ for 4 days, and observe whether there is a phosphorus solubilization circle. If there is a phosphorus solubilization circle, it is positive, otherwise it is negative.
[0065] Determination of iron carrier production ability: inoculate Bacillus subtilis BS74 on CAS solid culture medium, culture at 28°C for 3 days, and observe whether there is an orange halo. If there is an orange halo, it is positive, otherwise it is negative.
[0066] The diameter of the circle layer (D) and the diameter of the colony (d) produced on each culture plate were measured, and the ratio of the circle diameter to the colony diameter (D / d) was calculated.
[0067] The activity of several enzymes secreted by Bacillus subtilis BS74, the ability to degrade inorganic phosphorus and produce siderophores were tested using selective culture medium. The strain was able to form circles on the culture medium, which means that its secondary metabolites contain specific enzymes or have the ability to degrade inorganic phosphorus and produce siderophores. A larger circle size means that the strain has stronger enzyme production activity or the ability to degrade inorganic phosphorus and produce siderophores. The ratio of the circle diameter to the colony diameter was used as a quantitative indicator to compare its activity.
[0068] See also Figure 2 On the amylase test plate, the diameter of the transparent circle produced by BS74 was 19.5 mm, and the D / d was 1.62. On the protease test plate, the diameter of the transparent circle produced by BS74 was 30.0 mm, and the D / d was 1.43. On the cellulase plate, no transparent circle was produced. It was preliminarily judged that BS74 did not have the ability to produce cellulase to decompose cellulose. On the inorganic phosphorus plate, a faint phosphorus dissolving circle appeared, indicating the ability to dissolve inorganic phosphorus. The diameter of the phosphorus dissolving transparent circle produced by BS74 was 12.5 mm, and the D / d was 1.09. On the CAS solid plate, an orange-yellow halo was produced. The diameter of the orange-yellow transparent circle produced by BS74 was 18.5 mm, and the D / d was 1.32.
[0069] Example 2 Preparation of biocontrol agents and biocontrol agents
[0070] (1) Preparation of seed solution: Bacillus subtilis was inoculated into LB culture medium and cultured with shaking at 30°C and 180 r / min. After 12 to 16 hours, samples were taken in an ultra-clean bench and the OD value at 600 nm was measured. During the OD measurement process, the uninoculated culture medium was used as zero. When the OD value of the culture medium was between 0.5 and 0.8, it was the seed culture medium.
[0071] (2) Preparation of fermentation broth: 500 μL of seed solution was inoculated into 500 mL of liquid NA culture medium, and cultured at 30° C. and 180 rpm for 72 h to obtain fermentation broth.
[0072] (3) Preparation of biocontrol agents: Dilute the fermentation broth 10 to 100 times to obtain a concentration of 1×10 7 ~1×10 8 CFU / mL of biocontrol agents.
[0073] (4) Preparation of biocontrol agent: The fermentation broth was centrifuged at 10,000 rpm for 10 min, and the supernatant was collected. The supernatant was filtered through a bacterial filter (0.22 μm) and set aside to obtain a cell-free supernatant. The cell-free supernatant was gradiently diluted with sterile water to obtain a biocontrol agent with a volume concentration of 1 to 10%.
[0074] Application Example 1 Determination of the Antagonistic Activity of Bacillus subtilis BS74 against Fusarium rubrum on Plates
[0075] (1) Test method
[0076] Using the confrontation culture method, the red Fusarium rubrum stored at 4°C was inoculated on the PDA plate for activation. After the fungus grew all over the plate, a sterilized punch was used to evenly punch the outer edge of the colony into a circular fungus block with a diameter of 5 mm. The circular fungus block was inoculated in the center of the WA plate, and Bacillus subtilis BS74 was inoculated at about 30 mm from the center on all sides. The negative control strain Escherichia coli, sterile water and 1μg / mL tebuconazole were used as the control group. Cultured at 25°C, the colony radius was measured when the radius of the colony reached about 30 mm in the direction of sterile water, and the inhibition rate was calculated.
[0077] The inhibition rate was calculated as follows:
[0078] Inhibition rate = 100% × (R 1 -R 2 ) / R 1 , R 1 R is the colony radius of the control pathogen in the direction of sterile water; 2 is the colony radius of the pathogen in the treatment direction.
[0079] (2) Result analysis:
[0080] like Figure 3 As shown, the plate antagonism test showed that Bacillus subtilis BS74 had a strong inhibitory effect on the growth of Fusarium rubra, with a mycelium inhibition rate of 66.67%; 1 μg / mL tebuconazole had a weak inhibitory effect on the growth of Fusarium rubra, with a mycelium inhibition rate of 27.5%; while the negative control strain and sterile water had no antagonistic effect.
[0081] Application Example 2 Determination of the Activity of Biocontrol Agents in Inhibiting Fusarium Rubra Mycelium
[0082] (1) Test method
[0083] Add the spore suspension of Fusarium rubrum to the WA medium at 50°C to a final spore concentration of 10 5 Pour WA culture medium containing spores of Fusarium rubrum into a 9 cm diameter plate, 20 mL per plate. After cooling and solidification, use a 7 mm diameter hole puncher to punch three holes in symmetrical positions of the plate, add 25 μL of the biocontrol agent prepared in Example 2 (the solvent is water, and the volume concentration of the cell-free supernatant is 10%) to each hole, and use the culture fluid and 1 μg / mL tebuconazole as the control group. Cultivate statically at 25°C and observe the size of the antagonistic zone (calculated from the center of the hole).
[0084] (2) Results Analysis
[0085] like Figure 4 As shown, the biocontrol agent prepared from Bacillus subtilis BS74 can effectively inhibit the growth of mycelium, with an inhibition zone radius of 9.5 mm, and the inhibition zone radius of 10-fold concentrated sterile supernatant is 15.5 mm.
[0086] Application Example 3 Determination of the activity of biocontrol agents in inhibiting the germination of spores of Fusarium rubrum
[0087] (1) Test method
[0088] Take the biocontrol agent prepared in Example 2 (volume concentration of cell-free supernatant 10%), add sucrose to the biocontrol agent to make the final concentration of sucrose 2%, and then add spores of Fusarium rubrum. The control group is a culture solution containing 2% sucrose. Take 10 μL of the spore suspension in the sucrose solution and place it on a glass slide, and repeat 3 times for each treatment. The glass slide is placed in a moisturizing box and statically cultured at 25°C. The spore germination of each treatment group is observed every 6 hours, and the germination rate is calculated.
[0089] (2) Results Analysis
[0090] like Figure 5 As shown, the biocontrol agent prepared by Bacillus subtilis BS74 can significantly inhibit the germination of Fusarium rubrum spores. The spores after treatment germinate very slowly, it is difficult to form germ tubes, and obvious swelling and other deformities appear. After inducing germination, the germination rate of each treatment group was counted at 6 and 12 hours respectively. The results showed that when the germination rate of the negative control group was 100%, the spores of the BS74 treatment group still did not germinate. The statistical results are shown in Table 1.
[0091] Table 1 Germination rate of red Fusarium spores in each treatment group
[0092]
[0093] Application Example 4 Evaluation of the effect of biocontrol agents on the control of melon rot
[0094] (1) Test method
[0095] Melon seeds were sown in a plug tray containing nutrient soil for cultivation, and melon seedlings at the two-leaf and one-heart stage were selected for treatment. The biocontrol agent prepared in Example 2 was poured into the roots of the seedlings in the treatment group, and 50 mL of the biocontrol agent was poured into each seedling; the seedlings in the negative control group were poured with 50 mL of sterile water, and each group was repeated for 4 plants. After 48 hours, the treatment group and the positive control group were inoculated with 50 mL of spore suspension of Fusarium rubrum (1×10 5 After 7 days of cultivation, 50 mL of biocontrol agent and sterile water were applied to the treatment group and the control group, respectively. 14 days after inoculation, the disease of the plants was observed.
[0096] According to the characteristics of fungal rot of melon, the incidence of fungal rot is divided into 5 levels. The lesion classification standard is as follows: Level 0: no disease on the leaves; Level 1: yellowing of leaves but no lesions; Level 2: lesion area of leaves <10%; Level 3: 10%≤lesion area of leaves <25%; Level 4: 25%≤lesion area of leaves <50%; Level 5: lesion area of leaves >50% or leaf death.
[0097] Disease index (%) = ∑ (number of diseased leaves at each level × relative level) / (total number of leaves × highest level) × 100; control effect (%) = (average disease index of positive control group - average disease index of treatment) / average disease index of positive control group × 100.
[0098] (2) Results Analysis
[0099] See also Figure 6 The negative control group had no lesions, while the positive control group had obvious symptoms. The use of biocontrol agents had a certain degree of control effect on melon.
[0100] The melon plants in the negative control group all grew healthily; after cleaning the root soil, the roots were thick, firmly grasped the soil, and the root system was well developed. 20-24 days after the positive control group and the treatment group were inoculated with red Fusarium, the melon leaves in the positive control group were seriously ill, 1-2 leaves had completely rotted and died, and there were a large number of white fluffy hyphae on the leaves that were not completely rotten. Some leaves turned yellow, and the lesion area was large. The disease index on the melon was 52.1; after cleaning the root soil, the roots were sparse and the ability to grasp the soil was weak. In the treatment group, only a few plants had one leaf completely rotten, and most of them only turned yellow or formed 1-2 small lesions. The disease index on the melon was 17.1, and the prevention and control effect reached 67.2%; after cleaning the root soil, the roots were healthy, slightly sparser than the negative control, but the overall difference was not large, and the soil was firmly grasped.
[0101] The above only expresses several specific implementation methods of the present application, and the description is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present application. It should be pointed out that for ordinary technicians in this field, several modifications and improvements can be made without departing from the concept of the present application, which all belong to the protection scope of the present application. Therefore, the protection scope of the present application shall be based on the attached claims.
Claims
1. A Bacillus subtilis strain, characterized in that The classification name is Bacillus subtilis BS74, and the preservation number is CCTCC NO: M 20241022.
2. Use of the Bacillus subtilis strain according to claim 1 in antagonizing Fusarium rubrum.
3. Use of the Bacillus subtilis strain according to claim 1 in preventing and treating melon rot.
4. Use of the Bacillus subtilis strain according to claim 1 in preparing a biocontrol product for preventing and controlling melon rot.
5. A biocontrol agent, characterized in that: A suspension comprising the Bacillus subtilis strain as claimed in claim 1.
6. The biocontrol agent according to claim 5, characterized in that The concentration of Bacillus subtilis in the biocontrol agent is 1×10 7 ~1×10 8 CFU / mL.
7. A biocontrol agent, characterized in that: The invention comprises a cell-free supernatant of the fermentation broth of the Bacillus subtilis strain as claimed in claim 1.
8. The biocontrol agent according to claim 7, characterized in that The method for preparing the cell-free supernatant comprises: The activated Bacillus subtilis BS74 is inoculated into a fermentation medium for expansion culture to obtain a fermentation liquid of the strain; The fermentation broth is centrifuged, filtered, and the supernatant is taken to obtain the cell-free supernatant.
9. The biocontrol agent according to claim 7, characterized in that The volume concentration of the cell-free supernatant in the biocontrol agent is 1-10%.
10. A method for preventing and treating melon rot caused by infection with Fusarium rubrum, characterized in that: The biocontrol agent according to claim 5 or the biocontrol agent according to claim 7 is applied to the roots and / or leaves of melon plants.