Bifidobacterium adolescentis as well as culture method and identification method thereof

Abstract

The invention discloses bifidobacterium adolescentis as well as a culture method and an identification method thereof. Specifically, the invention provides the bifidobacterium adolescentis GSB03505, the preservation number of the bifidobacterium adolescentis GSB03505 is CGMCC (China General Microbiological Culture Collection Center) No.32483, and the invention provides a method for identifying the bifidobacterium adolescentis. The GABA yield of the bifidobacterium adolescentis reaches up to 3200mg / L and is obviously higher than that of the existing strain; in addition, the strain has the potential of being applied to living fungus food, health care products or medicines for improving sleep and regulating or treating mental diseases.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a bifidobacterium adolescentis, a culture method and an identification method thereof. Background Art

[0002] γ-aminobutyric acid (GABA) is an inhibitory neurotransmitter that plays an important role in the regulation of the central nervous system. GABA disorders are associated with many neurological and psychiatric diseases, such as anxiety, depression, Alzheimer's disease, Parkinson's disease, etc. More and more evidence shows that GABA levels in the peripheral system and brain are affected by intestinal flora. The concentration of GABA in the intestine of germ-free mice is 1.3 times lower than that of mice with normal flora, and the concentration of GABA in the brain is 3.7 times lower than that of normal mice. After vancomycin treatment, the concentration and abundance of intestinal flora in mice decreased, causing a significant decrease in GABA levels. Giving mice a GABA-producing strain will cause an increase in colonic GABA levels, affecting the nervous system and, in turn, affecting the pain perception of mice. Therefore, changes in GABA levels caused by changes in intestinal flora are believed to play an important role in regulating psychiatric and neurological diseases. GABA produced by intestinal flora has attracted more and more attention as a molecule that regulates the gut-brain axis.

[0003] Due to the research on the effect of intestinal flora producing GABA and improving various nervous system disorders, more and more studies have been conducted on bacteria / strains that can produce GABA. The main bacteria that can produce GABA in the human intestine include Bifidobacterium, Lactobacillus and Bacteroides. Due to their health effects and safety, Bifidobacterium and Lactobacillus that produce GABA have been widely developed. Research on the production of GABA by bifidobacteria is currently mainly focused on Bifidobacterium adolescentis. CN113773978B discloses two strains of Bifidobacterium adolescentis 95 and 150. When 3% (i.e. 30 g / L) of monosodium glutamate (MSG) is added, the amount of GABA produced by culturing at 37°C for 36 hours is 100-250 mg / L. CN114181868A discloses multiple strains of Bifidobacterium adolescentis MN-84, cb7y2, and Cb7y3, which have a GABA production of 7-18 mg / L after being cultured under 1% (i.e., 10 g / L) glutamate conditions for 24 hours.

[0004] However, the yields that can be achieved by the strains known to produce GABA still have room for improvement. In order to obtain a method for producing GABA at a higher yield, there is an urgent need in the art to develop a strain that produces GABA at a higher yield. Summary of the invention

[0005] The purpose of the present invention is to provide a bifidobacterium adolescentis, a culture method thereof and an identification method thereof. The bifidobacterium adolescentis of the present invention can produce high amounts of γ-aminobutyric acid.

[0006] In one aspect, the present invention provides a Bifidobacterium adolescentis, wherein the Bifidobacterium adolescentis contains a molecular marker fragment that can be amplified by primer pair 1, primer pair 2 and / or primer pair 3.

[0007] in,

[0008] The primer pair 1 includes a forward primer sequence 1 having a sequence of CGGTAATCAATGCCTTCGCG (SEQ ID NO: 1) and a reverse primer sequence 1 having a sequence of AACAAGGCGCCTAAGAACGA (SEQ ID NO: 2),

[0009] The primer pair 2 includes a forward primer sequence 2 having a sequence of GACGGGTCTTCCTTCTGGTG (SEQ ID NO: 3) and a reverse primer sequence 2 having a sequence of AGGCGTTGTCCAACATCTGT (SEQ ID NO: 4), or

[0010] The primer pair 3 includes a forward primer sequence 3 having a sequence of TTTCACGGCACCCATGTCAT (SEQ ID NO: 5) and a reverse primer sequence 3 having a sequence of ACTTCCAACAGAGCAAGCGA (SEQ ID NO: 6).

[0011] In one embodiment, the amplification is performed by a nucleic acid amplification reaction (eg, a PCR reaction).

[0012] In one embodiment, the Bifidobacterium adolescentis can produce γ-aminobutyric acid, and its 24-hour production is not less than 1500 mg / L; preferably, its 24-hour production is not less than 2400 mg / L; more preferably, its 24-hour production is not less than 3200 mg / L.

[0013] In one embodiment, the culture medium for Bifidobacterium adolescentis is an RCM culture medium with a pH of 6.8-7.2 (preferably 7.0), and the culture medium is supplemented with MSG at a concentration of 20-80 g / L (preferably 30-60 g / L; more preferably 50 g / L) and lactose at a concentration of 4-10 g / L (preferably 5 g / L).

[0014] In one embodiment, the molecular marker fragment has a characteristic sequence as shown in SEQ ID NO: 7, 8 or 9, or has a characteristic sequence with at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with any characteristic sequence shown in SEQ ID NO: 7, 8 or 9.

[0015] In one aspect, the present invention provides a Bifidobacterium adolescentis, wherein the Bifidobacterium adolescentis is Bifidobacterium adolescentis GSB03505, with a preservation number of CGMCC No. 32483.

[0016] In one embodiment, the Bifidobacterium adolescentis is in the form of living cells, non-living cells, bacterial culture solution, freeze-dried powder, or postbiotics.

[0017] In one aspect, the present invention provides a culture containing the Bifidobacterium adolescentis of the present invention.

[0018] In one embodiment, the culture is obtained by culturing the Bifidobacterium adolescentis of the present invention. In one embodiment, the culture is a biologically pure culture.

[0019] In one aspect, the present invention provides a composition comprising the Bifidobacterium adolescentis described in the present invention or the culture described in the present invention.

[0020] In one embodiment, the composition further comprises additional probiotic material.

[0021] In one embodiment, the composition further comprises a prebiotic material.

[0022] In one embodiment, the composition further comprises an ingestible carrier.

[0023] In one embodiment, the composition further comprises a pharmaceutically acceptable carrier and / or excipient.

[0024] In one aspect, the present invention provides a method for culturing a strain, comprising the steps of: culturing the Bifidobacterium adolescentis of the present invention under suitable conditions.

[0025] In one embodiment, the suitable conditions include: a culture temperature of 25-40°C; preferably 37°C.

[0026] In one embodiment, the suitable conditions include: the culture environment is anaerobic culture.

[0027] In one embodiment, the suitable conditions include: the culture medium is a culture medium containing MSG; preferably, the concentration of MSG in the culture medium is 5-80 g / L; preferably 20-60 g / L; preferably 30-60 g / L; more preferably 50 g / L.

[0028] In one embodiment, the suitable conditions include: the pH of the culture medium is 5.5-7.5; preferably 6.8-7.2; more preferably 7.0; such as the culture medium is RCM culture medium with a pH of 6.8-7.2.

[0029] In one embodiment, the suitable conditions include: lactose at a concentration of 4-10 g / L (preferably 5 g / L) is added to the culture medium.

[0030] In one embodiment, the suitable conditions include: a culture time of 0-100 h; preferably 4-80 h; preferably 20-80 h, preferably 22-72 h, and more preferably 24-48 h.

[0031] In one aspect, the present invention provides a method for producing γ-aminobutyric acid, comprising the steps of: culturing the Bifidobacterium adolescentis as described in the present invention under suitable conditions.

[0032] In one embodiment, the suitable conditions include: a culture temperature of 25-40°C; preferably 37°C.

[0033] In one embodiment, the suitable conditions include: the culture environment is anaerobic culture.

[0034] In one embodiment, the suitable conditions include: the culture medium is a culture medium containing MSG; preferably, the concentration of MSG in the culture medium is 5-80 g / L; preferably 20-60 g / L; preferably 30-60 g / L; more preferably 50 g / L.

[0035] In one embodiment, the suitable conditions include: the pH of the culture medium is 5.5-7.5; preferably 6.8-7.2; more preferably 7.0; such as the culture medium is RCM culture medium with a pH of 6.8-7.2.

[0036] In one embodiment, the suitable conditions include: lactose at a concentration of 4-10 g / L (preferably 5 g / L) is added to the culture medium.

[0037] In one embodiment, the suitable conditions include: a culture time of 0-100 h; preferably 4-80 h; preferably 20-80 h, preferably 22-72 h, and more preferably 24-48 h.

[0038] In one aspect, the present invention provides use of the Bifidobacterium adolescentis of the present invention, the culture of the present invention, or the composition of the present invention in the preparation of a live bacteria agent or food for improving sleep, regulating or treating mental illness in a subject.

[0039] In one embodiment, improving sleep includes improving sleep quality and / or increasing sleep duration.

[0040] In one embodiment, the psychiatric disorder is a psychiatric disorder with sleep disorders, such as autism spectrum disorder (ASD), depression, anxiety, bipolar disorder, post-traumatic stress disorder, schizophrenia, attention deficit hyperactivity disorder, obsessive-compulsive disorder, or sleep disorders caused by alcohol, smoking cessation and / or stimulant abuse.

[0041] In one aspect, the present invention provides a specific primer pair, the specific primer pair comprising:

[0042] Primer pair 1, comprising a forward primer sequence 1 having a sequence of CGGTAATCAATGCCTTCGCG (SEQ ID NO: 1) and a reverse primer sequence 1 having a sequence of AACAAGGCGCCTAAGAACGA (SEQ ID NO: 2),

[0043] Primer pair 2, comprising a forward primer sequence 2 having a sequence of GACGGGTCTTCCTTCTGGTG (SEQ ID NO: 3) and a reverse primer sequence 2 having a sequence of AGGCGTTGTCCAACATCTGT (SEQ ID NO: 4), and / or

[0044] Primer pair 3, which includes a forward primer sequence 3 having a sequence of TTTCACGGCACCCATGTCAT (SEQ ID NO: 5) and a reverse primer sequence 3 having a sequence of ACTTCCAACAGAGCAAGCGA (SEQ ID NO: 6).

[0045] In one aspect, the present invention provides a kit, comprising the specific primer pair described in the present invention.

[0046] In one aspect, the present invention provides a specific molecular marker for identifying Bifidobacterium adolescentis, wherein the molecular marker has a characteristic sequence as shown in SEQ ID NO: 7, 8 or 9; the Bifidobacterium adolescentis is the Bifidobacterium adolescentis described in the present invention.

[0047] In one aspect, the present invention provides use of the primer pair according to the present invention, the kit according to the present invention or the specific molecular marker according to the present invention in detecting or identifying Bifidobacterium adolescentis, wherein the Bifidobacterium adolescentis is the Bifidobacterium adolescentis according to the present invention.

[0048] In one aspect, the present invention provides a method for detecting or identifying Bifidobacterium adolescentis, wherein the method comprises the following steps:

[0049] (1) using the primer pair described in the present invention or the kit described in the present invention to perform PCR amplification on a sample containing a genome, and detecting the amplification result, and

[0050] (2) Identifying whether the sample contains Bifidobacterium adolescentis according to the present invention based on the amplification result, comprising:

[0051] After PCR amplification using primer pair 1 in step (1), if a target band at about 220 bp appears in the electrophoresis band of the amplification result, the sample contains Bifidobacterium adolescentis as described in the present invention;

[0052] After PCR amplification using primer pair 2 in step (1), if a target band at about 256 bp appears in the electrophoresis band of the amplification result, the sample contains Bifidobacterium adolescentis as described in the present invention; and / or

[0053] After PCR amplification using primer pair 3 in step (1), if a target band at about 595 bp appears in the electrophoresis band of the amplification result, the sample contains Bifidobacterium adolescentis as described in the present invention.

[0054] In one embodiment, the method further comprises: extracting nucleic acid from the sample before detection.

[0055] In one embodiment, the amplification result is detected by gel electrophoresis.

[0056] In one embodiment, the method further comprises the step of sequencing the target band fragments obtained by amplification.

[0057] In one embodiment, the nucleotide sequence of the target band at 220bp obtained by sequencing is as shown in SEQ ID NO: 7, or has a sequence identity of at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% to SEQ ID NO: 7.

[0058] In one embodiment, the nucleotide sequence of the target band at 256bp obtained by sequencing is as shown in SEQ ID NO: 8, or has a sequence identity of at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% to SEQ ID NO: 8.

[0059] In one embodiment, the nucleotide sequence of the target band at 595bp obtained by sequencing is as shown in SEQ ID NO: 9, or has at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with SEQ ID NO: 9.

[0060] In one aspect, the present invention provides a method for detecting or identifying Bifidobacterium adolescentis, wherein the method comprises the following steps:

[0061] (1) performing genome sequencing on samples containing genomes, and

[0062] (2) Identifying whether the sample contains the Bifidobacterium adolescentis as described in the present invention based on the sequencing results; if the measured sequence contains the specific molecular marker described in the present invention, or contains a characteristic sequence with a sequence identity of at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% to the specific molecular marker, then the sample contains the Bifidobacterium adolescentis as described in any one of the present invention.

[0063] In a specific embodiment of the present invention, in order to obtain Bifidobacterium adolescentis with higher GABA production, the inventors isolated 8 strains of Bifidobacterium adolescentis from the human intestine, and screened out strain GSB 03505 by evaluating the GABA production ability. The strain has a GABA production of up to 3200 mg / L, which is significantly higher than the existing strains. In another specific embodiment, the inventors also developed a strain-specific identification method, and conducted a preliminary evaluation of the acid resistance, adhesion characteristics and safety of the strain, all of which showed high application performance. The Bifidobacterium adolescentis GSB03505 of the present invention has the potential to be used in live bacterial foods, health products or medicines for improving sleep, regulating or treating mental illnesses.

[0064] On the basis of being in accordance with the common sense in the art, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present invention.

[0065] The reagents and raw materials used in the present invention are commercially available.

[0066] The positive and progressive effects of the present invention are:

[0067] (1) The high-GABA-producing Bifidobacterium adolescentis GSB 03505 (CGMCC No. 32483) provided by the present invention has a yield of up to 3200 mg / L, which is significantly higher than other Bifidobacterium adolescentis strains reported in known literature and patents.

[0068] (2) At the same time, metabolomics studies have found that GSB03505 produces a series of neuromodulatory substances related to GABA metabolism and function; animal experiments have found that oral administration of the GSB03505 strain can effectively prolong the sleep time of mice and improve their sleep.

[0069] (3) In order to better determine the specificity of the strain, the strain-specific sequence of GSB 03505 was discovered through comparative genomics analysis. Three pairs of strain-specific primers were successfully designed based on the specific sequence, and a strain characteristic detection method was developed, which can be used to perform strain-specific identification of the strain under single-bacteria and mixed-bacteria conditions.

[0070] (4) In addition, the strain genome does not contain virulence factors and has a high safety profile. Its adhesion ability to Caco-2 monolayer cells is as high as 80.75%, which indicates that it has a high intestinal adhesion potential. After being treated in simulated gastric fluid at pH 3.0 for 3 h, the number of viable bacteria decreased by about one order of magnitude, indicating that it has a high ability to tolerate gastric acid.

[0071] In summary, the high-GABA-producing Bifidobacterium adolescentis GSB03505 has the potential to be used in live bacteria foods, health products or medicines to improve sleep, regulate or treat mental illnesses.

[0072] Biomaterial Deposit Information

[0073] The Bifidobacterium adolescentis GSB03505 of the present invention has been deposited in the China General Microbiological Culture Collection Center (CGMCC) on November 4, 2024, with the deposit address at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101, the deposit number is: CGMCC No. 32483, the culture name is GSB03505, and the classification name is Bifidobacterium adolescentis. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] Figure 1 This is the result of GABA production by Bifidobacterium adolescentis strains.

[0075] Figure 2 The GABA-producing properties of Bifidobacterium adolescentis GSB03505 were shown.

[0076] Figure 3 The adhesion ability of the strains to Caco-2 cell monolayers is shown.

[0077] Figure 4 The acid resistance of the experimental strains was shown.

[0078] Figure 5 Phylogenetic tree of Bifidobacterium adolescentis.

[0079] Figure 6 This is the specific primer amplification result in Example 8.

[0080] Figure 7 The results are validation results of the specific primers in stool samples.

[0081] Figure 8 This is the verification result of the detection effect of specific primers in mixed samples containing GSB03505.

[0082] Fig. 9 The experimental design and animal grouping in Example 9 are shown.

[0083] Fig.10 The effect of oral administration of different strains on the sleep time of mice is shown. DETAILED DESCRIPTION

[0084] In order to more easily understand the present disclosure, some terms are first defined. As used in this application, unless otherwise expressly provided herein, each of the following terms should have the meaning given below. Other definitions are set forth throughout the application.

[0085] The term "about" can refer to a value or composition that is within an acceptable error range for a particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined. For example, as used herein, the expression "about 100" includes 99 and 101 and all values ​​therebetween (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0086] As used herein, the term "comprising" or "including (comprising)" may be open, semi-closed and closed. In other words, the term also includes "consisting essentially of" or "consisting of".

[0087] The term "sequence identity" refers to the identity or homology between biological sequences, which is determined by comparing two aligned sequences along a predetermined comparison window (which can be 50%, 60%, 70%, 80%, 90%, 95% or 100% of the length of a reference nucleotide sequence or protein) and determining the number of positions where identical residues occur. Typically, this is expressed as a percentage. The measurement of sequence identity of nucleotide sequences is a method well known to those skilled in the art.

[0088] As used herein, the term "molecular marker fragment" or "characteristic sequence" refers to a nucleic acid fragment that is specifically present in a particular strain and can be used to distinguish the strain from other different strains. In a specific embodiment of the present invention, the strain GSB 03505 of the present invention has molecular marker fragments SEQ ID NOs: 7, 8 and 9 that can be detected by primer pairs 1, 2 and / or 3. The specific sequence information is as follows:

[0089] SEQ ID NO: 7

[0090] CGGTAATCAATGCCTTCGCGACCCTGAGTCCGAGGACATCGACCTCCGACTTGTCGGGCATCGAGCGCTTGGGGACCGATTTCTTCATCGCCTCAAGGTGCTTTGAATACAGCTCACGCTCTCCGCCGTGAGCGTCCCATCGCTCGCATGAGTGCGAAGCAACGCGACCTCGTCGGGCGTCAAGATGTCCGCGTCCTTGTCGTTCTTAGGCGCCTTGTT

[0091] SEQ ID NO: 8

[0092] GACGGGTCTTCCTTCTGGTGCAAATAAACCCCGAAGTTCCACATCGCCTCGTCGCTCCAAATATGTCGGCGCACCTCGGTCATATCGGACGTGCCCCGAAGACCGCTCACCACCTCGTCGAAGAAGCA TTGGCCGGGAAACCTCCCCGATTCGGGTTCCGCGGCTAAAGAGCGCATGTTTTGATAAAAGCTCCCCAAGTCAAAAGCTCTGCCGCCAGACAGCAATTTCGCCATGCTACAGATGTTGGACAACGCCT

[0093] SEQ ID NO: 9

[0094] TTTCACGGCACCCATGTCATGCGTCACTAAAATAACGGTCTTCGTCGGATCTTTTTTCACCTTCGCGAAATAGTTATCGCACTTACGCTGGAATGCTTCATCACCGACAGCAAGAACCTCATCCAGAACCAGAATGTCACCCTTAGCT TGGATAGCCACAGAAAACGCTAAACGAACTTGCATACCAGATGAATAGTTCTTTAGCTTCTGATCCATGAATTCTTCAAGCTCAGCAAACTCGACGATGTCGTCGTACATGTCCTCGATTTCTTCACGGGTAAAACCAAGCAAAGTCC GTTGAGGAAAACATTCCTCGACCGGTCAGTTCAGGATTAAAGCCGACACCAAGCTCGATGAAAGGAACGAGCTTACCCTTTACCTCAATCCTTCCGGAATCCGGAACATATATGCCGGAAATCAGTTTCAACAACGTTGACTTGCCAC TGCCGTTACGGCCTACAATTCCAAAGAAGTCACCTTGGTGGACTTCAAAATTGATGTCTCGAAGCACATGCTGTTCTTTGTAGCCTTTGATGCCTTTAGTCCAATTAATGAAGGCCTGCTTCAAACCGCTCGCTTGCTCTGTTGGAAGT

[0095] The term "probiotics" refers to a class of active microorganisms that are beneficial to the host by colonizing in the host and changing the composition of the flora in a certain part of the host. Probiotics promote nutrient absorption and maintain intestinal health by regulating the host mucosal and systemic immune functions or by regulating the balance of intestinal flora, thereby producing single microorganisms or mixed microorganisms with clear composition that are beneficial to health. The beneficial bacteria or fungi in humans and animals mainly include yeast, probiotic spore bacteria, Clostridium butyricum, Lactobacillus, Bifidobacterium, Actinomycetes, etc.

[0096] The term "prebiotics" refers to some organic substances that are not digested and absorbed by the host, but can selectively promote the metabolism and proliferation of beneficial bacteria in the body, thereby improving the health of the host. Commonly used prebiotics include oligosaccharides, including oligofructose, oligogalactose, oligoxylose, oligomaltolide, soy oligosaccharide, inulin, etc. Some microalgae can also be used as prebiotics, such as spirulina, spirulina, etc. In addition, polysaccharides (such as Coriolus versicolor polysaccharides, carrot nitrogen-containing polysaccharides), protein hydrolysates (such as casein hydrolysates, α-lactalbumin, lactoferrin, etc.), and vegetables, Chinese herbal medicines, wild plants, etc. in natural plants can also be used as prebiotics.

[0097] The term "postbiotics" is a general term for the metabolites of probiotics after probiotics have been processed, including bacteria and metabolites. Postbiotic form is an inactive form of bacteria. Existing studies have confirmed that screened postbiotics are better than original live bacteria in enhancing immunity, and they still retain high physiological activity even after being exposed to high temperatures or treated with gastrointestinal digestive fluids. Probiotic metabolites that are postbiotics include: vitamins, lipids, enzymes, proteins, peptides, organic acids, short-chain fatty acids, intracellular polysaccharides, etc. Bacterial components that are postbiotics include lipoteichoic acid, teichoic acid, peptidoglycan, cell surface proteins, polysaccharides, cell membrane proteins, extracellular polysaccharides, etc.

[0098] The term "biologically pure grade" or "biologically pure" means that in a biological experiment, the content of a certain component in a certain substance under specific conditions reaches a certain standard, while the content of other components is low to meet the purity requirements required by the experiment. In a specific embodiment of the present invention, in the culture of the present invention, the Bifidobacterium adolescentis of the present invention is biologically pure compared to other strains. Preferably, the content of Bifidobacterium adolescentis of the present invention in all strains in the culture is not less than 85%, not less than 90%, not less than 91%, not less than 92%, not less than 93%, not less than 94%, not less than 95%, not less than 96%, not less than 97%, not less than 98%, or not less than 99%.

[0099] The present invention is further described below by way of examples, but the present invention is not limited to the scope of the examples. The experimental methods in the following examples without specifying specific conditions are carried out according to conventional methods and conditions, or selected according to the product specifications.

[0100] Example 1 Isolation and identification of Bifidobacterium adolescentis

[0101] (1) Fecal sample collection: dig about 5 g of the middle part of the fecal sample (the center of the fecal strip) into a 50 mL centrifuge tube and transport it to the laboratory at low temperature in an anaerobic box;

[0102] (2) Sample dilution: After the sample is weighed and transferred into the anaerobic chamber, the fecal sample is diluted 10 times with saline, recorded as 10-1 , take 1mL 10 -1 The diluent was added to 9 mL of saline to obtain 10 -2 , and so on, dilute step by step to 10 -9 During the dilution process, the centrifuge tube needs to be shaken up and down, and the pipette needs to be blown several times to mix evenly;

[0103] (3) Plate coating: Take 200µl and dilute it by 10 -7 , 10 -8 , 10 -9 On MRS (Oxoid, CM1163) plates; culture conditions were 37°C, relative humidity 70%, anaerobic;

[0104] (4) Enrichment culture: Select a moderate number of bacteria (10 -7 , 10 -8 , 10 -9 ) plates, observe the colony morphology, colony color, size, and surface wetness or dryness, and use an inoculation loop to select single clones of different morphologies and place them into 3 ml of corresponding liquid culture medium for bacterial enrichment culture;

[0105] (5) When visible turbidity appears, take 200µl for 16S DNA full-length PCR amplification sequencing. Use a pipette to draw 700µl of the remaining bacterial solution into a 2ml seed tube (add 300µl of glycerol seed solution in advance), and save 2 copies of each strain. Store at -80℃.

[0106] (6) Strain identification: The 16S sequence was compared with NCBI blast (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi), and the experimental strain was identified as Bifidobacterium adolescentis, and its number is shown in Table 1. Strain GSB03505 was deposited in the China General Microbiological Culture Collection Center on November 4, 2024, with the deposit number: CGMCC 32483.

[0107] The gene sequence of 16s RNA is as follows (SEQ ID NO: 10, shown as a DNA sequence):

[0108]

[0109] Table 1 List of successfully isolated Bifidobacterium adolescentis

[0110]

[0111] Example 2 Screening of Bifidobacterium adolescentis strains with high γ-aminobutyric acid production

[0112] (1) Culture medium preparation

[0113] Prepare the culture medium according to the following table. Add monosodium glutamate (MSG) to adjust the pH of the culture medium to about 7.0. Autoclave at 115°C for 15 minutes.

[0114] Table 2 Culture medium formula for screening of GABA-producing strains

[0115]

[0116] (2) Cultivation of GABA-producing strains and sample preparation

[0117] Take the glycerol strains stored in Table 1 and culture them anaerobically at 37°C on RCM plates for 72 hours; pick a single clone and transfer it to liquid RCM medium (Reinforced Clostridium Medium) for further activation for 24 hours. After mass spectrometry identification confirms that the strain is correct, continue to subculture it as P2 seeds for subsequent experiments.

[0118] The qualified P2 strains were transferred to 20 mL RCM + lactose medium containing different concentrations of MSG (Table 2) at a 5% inoculation rate, and each strain was cultured for 24 h as P3 strains; P3 strains were inoculated in the corresponding RCM + lactose medium with different concentrations of MSG (Table 2) at a 5% inoculation rate, and cultured anaerobically at 37°C for 4 h. After 8 h, 1 mL of the bacterial solution was taken for OD600 determination. At the same time, 1.5 mL of the bacterial solution was taken into a 2 mL centrifuge tube, centrifuged at 10,000 rpm for 5 min, and the supernatant was taken and frozen at -80°C for GABA detection.

[0119] (3) Study on the GABA production characteristics of Bifidobacterium adolescentis GSB 03505

[0120] Take the GSB 03505 glycerol strain and culture it as described in Section 2 (2) above, except that the P3 strain is cultured anaerobically for 4 h, 8 h, and 24 h.

[0121] (4) Sample testing

[0122] Sample preparation: 50 µL sample was added with 50 µL internal standard (GABA-d6, 1000 ng / mL 50% acetonitrile; 100 µL acetonitrile was added and vortexed for 5 min; 100 µL pH 8.6 borate buffer was added and vortexed for 2 min; 100 µL derivative solution (5 mg / mL Fmoc-chloride derivative solution) was added and mixed, then added to a centrifuge tube or 96-well plate, vortexed for 5 min, and centrifuged at 15°C, 5800 rpm for 10 min; 20 µL supernatant was taken and added with 180 µL 50% acetonitrile and vortexed for 2 min; 1 µL was taken for LC-MC determination.

[0123] Mass spectrometry conditions: Instrument, LC-MS / MS-42 (Triple Quad 6500+), SCIEX, USA;

[0124] Internal standard: GABA-d6;

[0125] HPLC conditions: The equipment included a LC (Liquid chromatography) system with dual pumps (LC-30AD), an autosampler (SIL-30AC), a column oven (CTO-20A), a system controller (CBM-20A), and a degasser (DGU-20A), purchased from Shimadzu Co., Japan.

[0126] Column: Column - Synergi Max-RP, 2.0mm / 50mm / 2.5µm;

[0127] Phase A: water-10 mM ammonium formate; Phase B: acetonitrile / water (98 / 2 v / v)-10 mM ammonium formate; Flow rate: 0.4 mL / min; Column temperature: 40°C; Separation procedure as shown in the table:

[0128] Table 3 Liquid phase separation conditions for GABA determination

[0129]

[0130] Detection parameters: GABA, retention time 1.39min, Q1 / Q3 Masses: 324.20 / 102.00 Da; GABA-d6 retention time 1.39min, Q1 / Q3 Masses: 330.10 / 108.00 Da;

[0131] (5) Screening results of high-yield GABA strains

[0132] from Figure 1It can be seen that under the conditions of MSG concentrations of 5g / L, 20g / L and 50g / L, after 4h and 8h of cultivation, strain GSB03505 showed a high GABA production, which was significantly higher than the other 7 experimental strains. After 8h of cultivation, under the conditions of 20g / LMSG, the GABA production of GSB 03505 reached 783mg / L; under the conditions of 50g / L MSG, the GABA production of GSB 03505 reached 1100 mg / L, which were 10-20 times that of the other experimental strains.

[0133] (6) Study on the GABA production characteristics of strain GSB03505

[0134] Since the ability of strain GSB03505 to produce GABA is significantly higher than that of other strains, strain GSB03505 was used as the research object to further explore the characteristics of GABA production by the strain and to improve the yield of GABA by the strain. The bacterial culture conditions were the same as those in part (2) of Example 2, and the culture times were 4 h, 8 h, and 24 h, respectively. Figure 2 It can be seen that after culturing for 24 hours under the condition of 20 g / L MSG, the GABA production of GSB03505 reached 2400 mg / L; after culturing for 24 hours under the condition of 50 g / L MSG, the production was as high as 3200 mg / L.

[0135] The efficiency of GSB03505 in producing GABA is significantly higher than that of the patented strains Bifidobacterium adolescentis 95 (CN113773978B) and Bifidobacterium adolescentis MN-84 (CN114181868A). Bifidobacterium adolescentis 95 produces 200-250 mg / L of GABA in 36 hours under the condition of 30 g / L MSG; MN-84 produces 10-18 mg / L of GABA in 24 hours under the condition of 10 g / L MSG.

[0136] Example 3 Metabolomics analysis of high GABA-producing strain GSB03505

[0137] (1) Sample preparation

[0138] Glycerol strains of Bifidobacterium adolescentis GSB03505 and F35-07 were collected and cultured as described in section 2 (2) above, except that 5% of the P3 strain was inoculated into 50 g / L MSG in RCM+lactose medium and cultured anaerobically at 37°C for 24 h. 1.5 mL of the bacterial solution was placed in a 2 mL centrifuge tube and centrifuged at 10,000 rpm for 5 min. The supernatant was collected and frozen at -80°C for metabolomics analysis.

[0139] (2) Metabolite extraction

[0140] After the sample was slowly thawed at 4°C, an appropriate amount of sample was added to precooled methanol / acetonitrile / water solution (2:2:1, v / v), vortexed, low-temperature ultrasonicated for 30 min, allowed to stand at -20°C for 10 min, centrifuged at 14000 g for 20 min at 4°C, the supernatant was vacuum dried, and for mass spectrometry analysis, 100 μL of acetonitrile aqueous solution (acetonitrile: water = 1:1, v / v) was added for re-dissolution, vortexed, centrifuged at 14000 g for 15 min at 4°C, and the supernatant was taken for sampling and analysis.

[0141] (3) Chromatography-mass spectrometry analysis

[0142] The samples were separated by Agilent 1290 Infinity LC ultra-high performance liquid chromatography (UHPLC) system HILIC column; column temperature 25℃; flow rate 0.5 mL / min; injection volume 2 μL; mobile phase composition A: water + 25 mM ammonium acetate + 25 mM ammonia, B: acetonitrile; gradient elution program as follows: 0-0.5 min, 95% B; 0.5-7min, B linearly changed from 95% to 65%; 7-8 min, B linearly changed from 65% to 40%; 8-9 min, B maintained at 40%; 9-9.1 min, B linearly changed from 40% to 95%; 9.1-12min, B maintained at 95%; the samples were placed in the 4℃ autosampler during the entire analysis process. To avoid the influence of instrument detection signal fluctuations, the samples were analyzed continuously in random order. QC samples were inserted into the sample queue to monitor and evaluate the stability of the system and the reliability of the experimental data.

[0143] The primary and secondary spectra of the samples were collected using an AB Triple TOF 6600 mass spectrometer. After separation using an Agilent 1290 Infinity LC ultra-high performance liquid chromatography system (UHPLC), the samples were analyzed by mass spectrometry using a Triple TOF 6600 mass spectrometer (AB SCIEX), using electrospray ionization (ESI) positive and negative ion modes for detection. The ESI source setting parameters are as follows: nebulizer gas auxiliary heating gas 1 (Gas1): 60, auxiliary heating gas 2 (Gas2): 60, curtain gas (CUR): 30psi, ion source temperature: 600℃, spray voltage (ISVF) ±5500 V (positive and negative modes); primary mass-to-charge ratio detection range: 60-1000 Da, secondary product ion mass-to-charge ratio detection range: 25-1000 Da, primary mass spectrometry scan accumulation time: 0.20 s / spectra, secondary mass spectrometry scan accumulation time 0.05 s / spectra; secondary mass spectrum was obtained using data-dependent acquisition mode (IDA), and peak intensity value screening mode was used, declustering voltage (DP): ±60 V (positive and negative modes), collision energy: 35±15 eV, IDA settings are as follows: dynamic exclusion of isotope ion range: 4 Da, 10 fragment spectra were collected for each scan.

[0144] (4) Data analysis process

[0145] The raw data were converted into .mzXML format by ProteoWizard, and then peak alignment, retention time correction and peak area extraction were performed using XCMS software. The data extracted by XCMS were first subjected to metabolite structure identification and data preprocessing (null value filtering: deleting ion peaks with missing values ​​> 50%; null value filling: KNN filling: data filtering: filtering features with RSD > 50%), and then experimental data quality evaluation (6 major quality controls) was performed, and finally data analysis was performed.

[0146] (5) Experimental results

[0147] In order to clarify the mechanism and impact of high GABA production in GSB03505, this study compared the metabolomes of the high GABA-producing strain GSB03505 and the low GABA-producing strain F35-017. The experiment successfully identified 2,343 metabolites, 184 differential metabolites between the GSB03505 strain and the F35-017 strain, of which 13 metabolites related to GABA metabolism or mental regulation function were significantly increased in the high GABA-producing strain GSB03505 (Table 4).

[0148] Some of these metabolites are produced in the GABA metabolic pathway, indicating that the GABA metabolic pathway is activated, such as 4-acetylaminobutyric acid, L-2,3-diaminopropionic acid, N-carboxyethyl-γ-aminobutyric acid, and glutaric acid. Several other metabolites can increase the effect of GABA, such as vigabatrin, which can inhibit the degradation of GABA by GABA transaminase, increase the concentration of GABA in the brain, and thus enhance the effect of GABA; thiamine monophosphate can participate in the production of GABA in the nervous system, improve sleep quality, and prolong sleep time; 1,4-butynediol, as a precursor of GABA, can pass through the blood-brain barrier, and has the effects of inducing sleep and causing central nervous system inhibition. The third type of metabolites participate in neuromodulatory effects and complement GABA, such as indole lactic acid, hesperidin, 3,4-dihydroxymandelic acid, propionic acid, etc., which can participate in the regulation of mental nerves or sleep. The fourth type of metabolites participate in the regulation of intestinal flora, increase the abundance of bifidobacteria in the intestine, and are also important substances for regulating the gut-brain axis, such as raffinose.

[0149] It can be seen from the metabolomics data that Bifidobacterium adolescentis GSB03505 not only has the ability to produce high GABA, but also can produce a series of metabolites related to GABA metabolism, or related to sleep regulation, mental regulation, etc., and has the potential to be used in regulating sleep and alleviating mental illnesses.

[0150] Table 4 Differential metabolites related to GABA metabolism and function

[0151]

[0152]

[0153]

[0154] Example 4 GSB03505 strain adhesion experiment

[0155] (1) Strain culture and bacterial liquid treatment

[0156] Take the glycerol strains preserved in Table 1 and culture them as described in Section 2 (2) above, except that the P3 strain was inoculated at a 5% inoculum into fresh RCM medium and cultured anaerobically at 37°C until the end of the logarithmic phase. Take 1 mL of the bacterial solution for bacterial count determination.

[0157] The remaining bacterial solution was centrifuged at 12000 rpm for 2 min to collect the bacteria; the bacteria were resuspended in PBS and the bacterial solution was adjusted to 2*10 according to the bacterial count results. 8 / 600µL, repeat centrifugation at 12000rpm for 2min; resuspend the bacteria in the same volume of DMEM-H (Gibco, 11995065) medium and use it as a cell interaction sample.

[0158] (2) Caco-2 cell culture (Beina Biotechnology, BNCC350769)

[0159] Caco-2 cells were cultured in a 37°C, 5% CO2 incubator with complete culture medium (90% DMEM-H + 10% fetal bovine serum FBS (Gibco, 10099141C) + 1% penicillin-streptomycin + 1% non-essential amino acid NEAA (Gibco, 11140050)), subcultured every 2 to 3 days, and logarithmic phase cells were used for experiments.

[0160] Caco-2 cells cultured to the logarithmic growth phase were inoculated into a Transwell 24-well culture plate. 0.4 mL of cell suspension (cell number: e5) was added to the apical side (AP) of the filter membrane, and 0.6 mL of cell culture medium was added to the basolateral side (BL). Do not shake well, but let it stand for 2 minutes. After observing the cells under a microscope, place them in an incubator for culture.

[0161] The culture medium was replaced 48 hours after inoculation, and then every 24 hours. The cell growth was observed every day, and the cells were cultured for 14±2 days without serum to differentiate into mature intestinal cells. The cell resistance value was detected by a resistor meter at 7, 10, 12, and 14 days of cell culture. When the cell resistance value stabilized at a value and did not rise, the subsequent experiments could be carried out. (Generally, the TEER value is 200-1000 Ω·cm 2 The larger the value, the more dense and complete the cell monolayer is).

[0162] (3) Co-culture and counting of cells and bacteria

[0163] Caco-2 cells were infected with the strain (Caco2: test strain) at a ratio of about 1:1000 in DMEM-H medium, i.e., 300µl of bacterial suspension was added and incubated at 37°C for 45 min. After incubation, the wells were gently washed with 1xPBS (pH 7.4) to collect the bacterial supernatant and the remaining non-adherent bacteria (a total of 600µl). The initial and collected non-adherent bacterial suspensions were plate counted to calculate the cell adhesion rate.

[0164] (4) Adhesion ability of strains to Caco-2 cell monolayers

[0165] like Figure 3 As shown, the adhesion rate of the high-GABA-producing strain GSB 03505 to human intestinal epithelial cells CaCo-2 was 80.75%, showing a high adhesion ability.

[0166] Example 5 Gastric acid resistance of GSB03505 strain

[0167] (1) Preparation of main reagents

[0168] Weigh 0.9 g of sodium chloride and dissolve it in 100 mL of pure water to obtain a 0.9% saline solution. Then adjust the pH to 3.0 with 0.1 mol / L hydrochloric acid solution, sterilize with high-pressure steam at 115°C for 15 min, cool to room temperature after sterilization, add 0.3 g of pepsin, mix thoroughly, filter with a 0.22 µm filter membrane to sterilize, and set aside. Prepare and use immediately.

[0169] (2) Strain preparation

[0170] Strain recovery: Take out the strain from the -80°C refrigerator, inoculate the strain onto the RCM solid culture medium plate by streaking, and culture it in an anaerobic workstation at 37°C for 24-48 h.

[0171] Inoculation of the revived strain: Observe the revived plate, pick up a single colony grown from a single bacterium on the plate with a pipette tip, place it in a 5 mL centrifuge tube containing 3 mL RCM + 0.5% lactose liquid culture medium, and culture it in an anaerobic workstation at 37°C for 24 h.

[0172] Identification and expansion of bacterial strains: After confirming that the bacterial strain is correct according to the mass spectrometry results, 500 μL of bacterial solution was transferred to a 15 mL centrifuge tube containing 9.5 mL of liquid culture medium, and cultured in an anaerobic workstation at 37°C. The early bacterial cells of the platform were taken for experiments.

[0173] (3) In vitro simulation of strain acid resistance to gastric juice

[0174] Take 1 mL of the prepared experimental strain bacterial solution to measure the OD value of the bacterial solution, measure the number of particles by flow cytometry, and adjust the bacterial concentration to 1.0×10 8 CFU / mL. Take 1 mL of the adjusted bacterial solution and dilute it to 10 -6 , take 100 μL 10 -4 , 10 -5 , 10 -6 After the gradient dilutions were spread on the RCM plate, they were placed in a 37°C anaerobic workstation for 24-48 h, and the live bacteria were counted (three replicates for each bacterial strain) as the 0h bacterial count. 1 mL of the adjusted bacterial solution was mixed with 9 mL of simulated gastric fluid and placed in a 37°C anaerobic workstation (100 rpm for culture), incubated for 1h and 3h respectively, and 1 mL of the bacterial solution was taken for gradient dilution, and diluted to 10 -6 , take 100 μL 10 -4 , 10 -5 , 10 -6The gradient dilutions were spread on RCM plates and cultured in an anaerobic workstation at 37°C for 24-48 h. The live bacteria were counted as the 1h and 3h bacterial counts.

[0175] (4) Acid resistance of the strain

[0176] The results are as follows Figure 4 As shown, the number of live bacteria of the experimental strain decreased by 0.69 log compared with the initial number of bacteria after 1 hour of treatment with pH 3.0 simulated gastric juice, and decreased by 1.96 log after 3 hours, indicating that Bifidobacterium adolescentis GSB03505 exhibited strong acid resistance.

[0177] Example 6 Detection of virulence factors of GSB03505 strain

[0178] Virulence factor (VF) refers to molecules with invasive and toxin-like toxic components produced by the metabolism of bacteria, viruses, fungi, etc., which are mainly used to enter and exit host cells by inhibiting or evading the host's immune response when microorganisms infect the host, and to obtain nutrition and self-reproduction and growth from the host. Virulence factors can be encoded on mobile genetic elements (such as plasmids, gene islands, bacteriophages, etc.) and undergo horizontal gene transfer, turning harmless bacteria into dangerous pathogens. Therefore, gene islands, secreted proteins, etc. are generally considered when identifying virulence factors. The Virulence Factor Database (VFDB) was developed by the Chinese Academy of Medical Sciences. It collects and organizes the composition, structure, function, pathogenic mechanism, virulence island, sequence and genome information of known virulence factors of various important medical pathogens, and is widely used in the identification of virulence factor genes.

[0179] According to the results of identification and comparison, the similarity (identify) of all genes in the bacterial genome with known virulence factors is greater than 80%, which is considered to be highly likely to exist and is determined to be positive. There are no genes with a similarity greater than 80% in the comparison of GSB03505 in the VFDB database, so it is believed that there are no virulence factors in the genome.

[0180] Example 7 Evolutionary relationship of GSB03505 in Bifidobacterium adolescentis

[0181] In order to study the evolutionary relationship between strain GSB03505 and other Bifidobacterium adolescentis, the genome data of 18 strains of Bifidobacterium adolescentis were obtained from the public database. In addition, the genome data of the low-yielding GABA strain F35-017 and GSB03505 in this study were determined to construct a phylogenetic tree. The specific method is as follows: orthofinder v2.5.5 (Genome Biol. 20, (2019)) was used for comparative genome analysis to obtain the core gene sequence; then the core gene sequences in all strains were directly connected together, and mafft v7.525 (Brief. Bioinform. 20, 1160–1166 (2017)) was used for multiple sequence alignment, and the comparison results were used to construct a phylogenetic tree using FastTree v2.1 (PLOS ONE 5, e9490 (2010)). The results are shown in the figure. Figure 5 As shown, on the phylogenetic tree, the GSB03505 strain has an independent branch and is far away from other Bifidobacteria in evolution, indicating that GSB03505 has high specificity at the strain level and is a new strain of Bifidobacterium adolescentis with unique genetic evolutionary characteristics.

[0182] Example 8 GSB03505 strain specific identification

[0183] (1) Design of GSB 03505 strain-specific detection primers

[0184] Through comparative genomics analysis, five specific sequences of Bifidobacterium adolescentis GSB03505 were determined, namely 803-2, 804-3, 99-5, 99-6, and 975-2; five pairs of primers were designed based on the specific sequences, as shown in Table 5.

[0185] In order to ensure the accuracy of the experiment, in addition to selecting 5 pairs of strain-specific primers, this study also selected bacterial universal primer V4, Bifidobacterium-specific primer Bifi662, and Bifidobacterium adolescentis-specific primer BiA-2 as experimental controls.

[0186] Table 5 Primer sequences for strain-specific detection

[0187]

[0188]

[0189] (2) Strains used for strain-specific detection

[0190] As shown in Table 5, the intestinal flora-derived strains Bifidobacterium adolescentis F54-016, F35-017, and F33-008, and the standard strain Bifidobacterium adolescentis ATCC15703 were selected as strain-specific verification strains; Bifidobacterium bifidum ATCC29521 and Bifidobacterium longumsubsp. longum ATCC 15707 were selected as species-specific control strains for experimental verification.

[0191] Table 6 Validated strains for strain-specific identification

[0192]

[0193] (3) Strain-specific detection and verification

[0194] Strain recovery: Take 40 μL of the strain seed culture solution and inoculate it into 3 mL of RCM + 0.5% lactose medium for liquid recovery culture, and streak the corresponding solid plate at the same time;

[0195] Strain expansion: Pick a single clone from the recovery plate and culture it in the corresponding 3 mL liquid culture medium. Identify the strain culture medium by mass spectrometry. After confirming that the strain is correct, use it for genomic DNA extraction.

[0196] DNA extraction: Genomic DNA was extracted using the TIANGEN Bacterial DNA Extraction Kit (DP302).

[0197] PCR system:

[0198] Table 7 PCR system for strain-specific detection

[0199]

[0200] PCR program: pre-denaturation: 94°C for 3 min; denaturation: 94°C for 30 s; annealing: 55°C for 30 s; extension: 72°C for 40 s; number of cycles: 30; final extension: 72°C for 5 min

[0201] Electrophoresis conditions: Prepare 2% agarose gel: weigh 1.8 g agarose powder, add 90 mL 1XTAE solution, heat in a microwave to dissolve, add 9 uL 4S GREEN nucleic acid stain and prepare gel for use; Loading: Mix 2 µL PCR amplification product with 1 µL 10X loading buffer and inject into the agarose gel sample well; Run the gel: run at 120 V for 30-40 min; Gel imaging: Place the agarose gel in a gel imager for imaging.

[0202] (4) Validation results of strain-specific detection methods

[0203] Depend on Figure 6 It can be seen that using the universal bacterial primer V4, all 7 experimental strains amplified obvious bands, indicating that the genome and PCR procedures are effective. Using the Bifidobacterium-specific primer Bifi662, all Bifidobacteria had target bands. Using the Bifidobacterium adolescentis strain-specific primer BiA-2, only 5 strains of Bifidobacterium adolescentis amplified the target band, and the control strains Bifidobacterium bifidum ATCC29521 and Bifidobacterium longum ATCC15707 had no target bands, indicating that the strain-specific primers are effective.

[0204] Among the five candidate GBS03505 strain-specific primers, 803-2, 804-3 and 975-2 only successfully amplified the target band in the target strain, and the band size was consistent with expectations, so they can be used as strain-specific identification primers. Both 99-5 and 99-6 amplified non-target bands in non-target strains and were not suitable as strain-specific identification primers.

[0205] (5) Validation of strain-specific primers in stool samples

[0206] In order to verify the effect of strain-specific primers 803-2, 804-3 and 975-2 in complex samples, fecal DNA was randomly extracted from 8 healthy people and amplified using strain-specific primers 803-2, 804-3, 975-2, Bifidobacterium adolescentis species-specific primer BiA-2, Bifidobacterium genus-specific primer Bifi662 and bacterial universal primer V4. The amplification results are shown in Figure 2. Figure 7 As shown in the figure, the negative control had no amplification bands, and the six primer pairs using GSB03505 genomic DNA as the template all had amplification bands of the target size, indicating that the PCR reaction system was normal; among the eight healthy samples, samples 01, 02, 03, 04, 06, 07, and 08 all had target bands of bacteria V4, Bifidobacterium Bifi662, and Bifidobacterium adolescentis BiA-2, indicating that the samples contained Bifidobacterium adolescentis. However, although some of the three pairs of specific primers had relatively weak non-specific amplification bands in some samples (such as samples 01, 03, 04, 07, and 08), none of them amplified molecular marker fragment bands of the target size, indicating that all samples did not contain the Bifidobacterium adolescentis strain GSB03505.

[0207] To further confirm the effectiveness of the primers, two stool samples (samples 01 and 07) were added with 10%, 1%, and 0.5% GSB03505 DNA, respectively, and amplified with the above five pairs of primers together with the pure GSB03505 control (the pure GSB03505 was also amplified with V4 primer). The amplification results are shown in Figure 2. Figure 8 As shown, the three pairs of strain-specific primers amplified the target bands in stool samples containing different concentrations of GSB03505 DNA, and no non-specific amplification bands appeared, indicating that 803-2, 804-3 and 975-2 can effectively amplify the target strain Bifidobacterium adolescentis GSB03505 in mixed samples.

[0208] Example 9 GSB03505 improves sleep in mice

[0209] (1) Experimental animals

[0210] ICR mice, male, 7–8 weeks old, 125 mice, SPF grade, were purchased from Zhejiang Weitonglihua Laboratory Animal Technology Co., Ltd., Laboratory Animal Production License No.: SCXK (Zhejiang) 2019-0001, and arrived at the facility before the experiment.

[0211] (2) Animal husbandry

[0212] The animals were maintained by Hanshu Biopharmaceutical Co., Ltd. (Experimental Animal Use License: SYXK (Shanghai) 2022-0021).

[0213] After all animals arrive at the animal facility, they enter a 5-7 day adaptation period. At the end of the period, animals that pass the health check are selected to enter the experiment and records are kept. Fig. 9 The experiments were performed as shown.

[0214] (3) Pentobarbital sodium experiment

[0215] Sodium pentobarbital was injected intraperitoneally, and the loss of righting reflex (LORR) was used as an indicator. After intraperitoneal injection of sodium pentobarbital, the animal was placed in a supine position. If the mouse could not turn over for more than 30 seconds, it was considered that the righting reflex was lost and the sleep state began; if the righting reflex of the mouse was restored, the sleep state ended. After the animal was administered sodium pentobarbital, whether LORR occurred, the latency of LORR, and the duration of LORR were recorded.

[0216] Experiment on prolonging sleep time of sodium pentobarbital: A preliminary experiment was conducted before the formal experiment to determine the intraperitoneal injection dose of sodium pentobarbital. The dose that allowed all mice to fall asleep and sleep for a moderate duration after intraperitoneal injection was used as the standard, and the formal experiment was conducted at this dose (30-60 mg / kg).

[0217] According to the sodium pentobarbital dose determined in the preliminary experiment, sodium pentobarbital was intraperitoneally injected 30 min after the last gavage on D28 and D42, and the time from the disappearance to the reappearance of the righting reflex was recorded as the sleep time.

[0218] (4) Effect of Bifidobacterium adolescentis GSB03505 on improving sleep

[0219] Depend on Fig.10 It can be seen that 28 days after the experimental animals were administered the drug, the sleep time of the mice in the high-GABA-producing Bifidobacterium adolescentis GSB03505 group was prolonged. After 42 days of administration, the sleep time of the mice in the GSB03505 group was significantly prolonged compared with the PBS group and the low-GABA-producing F35-017 control strain group. Oral administration of Bifidobacterium adolescentis GSB03505 can prolong the sleep time of mice and effectively improve the sleep of mice.

Claims

1. A Bifidobacterium adolescentis, characterized in that The Bifidobacterium adolescentis is Bifidobacterium adolescentis GSB03505, with the deposit number being CGMCC No. 32483.

2. The Bifidobacterium adolescentis according to claim 1, characterized in that The Bifidobacterium adolescentis is in the form of living cells, non-living cells, bacterial culture solution, freeze-dried powder, or postbiotics.

3. A culture, characterized in that The culture contains the Bifidobacterium adolescentis according to claim 1 or 2.

4. A composition, characterized in that The composition comprises the Bifidobacterium adolescentis according to claim 1 or 2 or the culture according to claim 3.

5. A method for culturing a strain, characterized in that: The method comprises the steps of: culturing the Bifidobacterium adolescentis as claimed in claim 1 or 2 under suitable conditions.

6. A method for producing γ-aminobutyric acid, characterized in that: The method comprises the steps of: culturing the Bifidobacterium adolescentis as claimed in claim 1 or 2 under suitable conditions.

7. Use of the Bifidobacterium adolescentis according to claim 1 or 2, the culture according to claim 3 or the composition according to claim 4 in the preparation of a live bacteria-based medicament or food for improving sleep, regulating or treating mental illness in a subject.

8. A specific primer pair, characterized in that: The specific primer pair comprises: Primer pair 1, comprising a forward primer sequence 1 having a sequence of CGGTAATCAATGCCTTCGCG (SEQ ID NO: 1) and a reverse primer sequence 1 having a sequence of AACAAGGCGCCTAAGAACGA (SEQ ID NO: 2), Primer pair 2, comprising a forward primer sequence 2 having a sequence of GACGGGTCTTCCTTCTGGTG (SEQ ID NO: 3) and a reverse primer sequence 2 having a sequence of AGGCGTTGTCCAACATCTGT (SEQ ID NO: 4), and / or Primer pair 3, which includes a forward primer sequence 3 having a sequence of TTTCACGGCACCCATGTCAT (SEQ ID NO: 5) and a reverse primer sequence 3 having a sequence of ACTTCCAACAGAGCAAGCGA (SEQ ID NO: 6).

9. A kit, characterized in that: The kit comprises the specific primer pair as claimed in claim 8.

10. A specific molecular marker for identifying Bifidobacterium adolescentis, characterized in that: The molecular marker has a characteristic sequence as shown in SEQ ID NO: 7, 8 or 9; the Bifidobacterium adolescentis is the Bifidobacterium adolescentis as described in claim 1 or 2.

11. Use of the primer pair according to claim 8, the kit according to claim 9 or the specific molecular marker according to claim 10 in detecting or identifying Bifidobacterium adolescentis, characterized in that: The Bifidobacterium adolescentis is the Bifidobacterium adolescentis according to claim 1 or 2.

12. A method for detecting or identifying Bifidobacterium adolescentis, characterized in that: The method comprises the following steps: (1) using the primer pair of claim 8 or the kit of claim 9 to perform PCR amplification on a sample containing a genome, and detecting the amplification result, and (2) Identifying whether the sample contains the Bifidobacterium adolescentis according to claim 1 or 2 based on the amplification results, comprising: After PCR amplification using primer pair 1 in step (1), if a target band at 220 bp appears in the electrophoresis band of the amplification result, the sample contains the Bifidobacterium adolescentis according to claim 1 or 2; After PCR amplification using primer pair 2 in step (1), if a target band at 256 bp appears in the electrophoresis band of the amplification result, the sample contains the Bifidobacterium adolescentis according to claim 1 or 2; and / or After PCR amplification using primer pair 3 in step (1), if a target band at 595 bp appears in the electrophoresis band of the amplification result, the sample contains the Bifidobacterium adolescentis according to claim 1 or 2.

13. The method for detecting or identifying Bifidobacterium adolescentis according to claim 12, characterized in that: The method also includes the step of sequencing the target band fragments obtained by amplification.

14. A method for detecting or identifying Bifidobacterium adolescentis, characterized in that: The method comprises the following steps: (1) performing genome sequencing on samples containing genomes, and (2) Identifying whether the sample contains the Bifidobacterium adolescentis according to claim 1 or 2 based on the sequencing results; if the measured sequence contains the specific molecular marker according to claim 10, then the sample contains the Bifidobacterium adolescentis according to claim 1 or 2.

Images