Method for interfering expression of hyphantria cunea target gene

Abstract

The invention discloses a method for interfering expression of a target gene of fall webworm, and belongs to the technical field of agricultural biology.The method comprises the steps that the target gene is screened according to transcriptome data of fall webworm, dsRNA of the target gene is synthesized, and the dsRNA is diluted into a solution with the concentration of 0.6 ng / mu L; fresh mulberry leaves are soaked in the dsRNA solution and refrigerated at 4 DEG C for 24 hours, so that the dsRNA solution is fully absorbed by the mulberry leaves; feeding the hyphantria cunea with the treated mulberry leaves for 7-10 days continuously, collecting larvae, detecting gene expression through qRT-PCR (quantitative real-time polymerase chain reaction) by taking the uninterfered larvae as a contrast, and calculating the interference efficiency of the mulberry leaves soaked with dsRNA (double-stranded ribonucleic acid) to the target gene of the hyphantria cunea; according to the method, the mulberry leaves are soaked in the low-concentration dsRNA solution, and the hyphantria cunea is fed, so that expression of target genes of the hyphantria cunea is remarkably reduced, tedious injection operation is omitted, additional damage to larvae is avoided, and the method has important significance on research on insect gene functions and development of a new RNAi-based prevention and control technology.

Description

Technical Field

[0001] The invention relates to the field of agricultural biotechnology, and in particular to a method for interfering with the expression of a target gene of the gypsy moth. Background Art

[0002] The gypsy moth (Hyphantria cunea) is a widespread agricultural pest that causes serious damage to a variety of crops and trees. Due to its strong reproductive capacity and wide adaptability, traditional chemical pesticide control methods often fail to achieve the desired control effect and may cause environmental pollution. Therefore, exploring new and environmentally friendly pest control strategies has become an important topic in current agricultural research.

[0003] In recent years, RNA interference (RNAi) technology has shown great potential in the field of pest gene function research and pest control due to its high efficiency, specificity, and low toxicity. RNAi technology specifically induces the degradation of target gene mRNA by introducing double-stranded RNA (dsRNA) complementary to the target gene sequence, thereby inhibiting the expression of the target gene. This method can interfere with the key gene function of pests without directly manipulating the genome of the organism, thereby achieving the purpose of pest control.

[0004] However, the traditional application of RNAi technology, such as using a microinjector to directly inject dsRNA solution into pests, has problems such as complex operation, mechanical damage to pests, and affecting the reliability of experimental results. Especially for tiny organisms such as young larvae, direct injection is more difficult, which limits the application of RNAi technology in these fields.

[0005] Therefore, the development of a simple, efficient, and low-damage RNAi technology application method is of great significance for in-depth research on the function of the target gene of the gypsy moth and the exploration of new pest control strategies. The method of feeding mulberry leaves soaked in dsRNA to interfere with the expression of the target gene of the gypsy moth is proposed based on this demand. This method achieves non-invasive interference with the target gene of the gypsy moth by feeding mulberry leaves containing dsRNA, providing a new and environmentally friendly technical means for pest gene function research and pest control. Summary of the invention

[0006] Technical problem to be solved: In view of the technical problem that the traditional chemical pesticide control method of the gypsy moth in the prior art mentioned in the background technology is often difficult to achieve the ideal control effect and may cause pollution to the environment, the present invention provides a method for interfering with the expression of the target gene of the gypsy moth, which is to interfere with the expression of the target gene of the gypsy moth by feeding mulberry leaves soaked with dsRNA. This method can be used to effectively study the function of the target gene of the gypsy moth.

[0007] Technical solution: The method for interfering with the expression of a target gene of the gypsy moth described in the present invention comprises the following steps:

[0008] Step 1, synthesizing a dsRNA solution of the target gene: according to the transcriptome sequencing data of the gypsy moth, the target gene to be interfered is selected, the corresponding dsRNA is synthesized by molecular biology technology, and the synthesized dsRNA is dissolved in ultrapure water to dilute it into a 0.6 ng / μL dsRNA solution;

[0009] Step 2, soaking mulberry leaves with dsRNA solution: Dilute the dsRNA solution into 2L flat-bottom plastic boxes, soak fresh mulberry leaves in the dsRNA solution, make sure that all the mulberry leaves are submerged in the dsRNA solution, seal well, and place in a 4°C refrigerator for 24 hours;

[0010] Step 3, feeding dsRNA-soaked mulberry leaves to gypsy moths: taking out the dsRNA-soaked mulberry leaves, absorbing the excess water remaining on the leaves with clean filter paper, and then feeding the leaves to gypsy moths to interfere with the target gene. During the feeding process, fresh dsRNA-soaked mulberry leaves are replaced every day, and the feeding is continued for 7-10 days;

[0011] Step 4, determining the interference efficiency of the target gene of the gypsy moth: collecting gypsy moths that have been fed with dsRNA-soaked mulberry leaves, taking gypsy moths without interference as controls, extracting RNA and reversely transcribing it into cDNA, using the qRT-PCR method to detect the expression of genes before and after interference, and calculating the interference efficiency of feeding dsRNA-soaked mulberry leaves on the expression of the target genes of gypsy moths.

[0012] Preferably, the specific operation of synthesizing a 0.6 ng / μL dsRNA solution in step 1 includes: using a measuring cylinder to accurately measure 1 L of ultrapure water and add it to a 2 L flat-bottomed plastic box as a dilution solvent; using a pipette to draw 200 μL of a dsRNA solution with a concentration of 3000 ng / μL, and adding it dropwise into the ultrapure water; using a glass rod to stir until the solution is evenly mixed to obtain a dsRNA working solution with a concentration of 0.6 ng / μL.

[0013] Preferably, the processing method of mulberry leaves in step 2 is: select fresh mulberry leaves with a leaf length of 15-25 cm and a leaf width of 15-20 cm every day, ensure that the leaves are intact and undamaged, wash them with pure water and then dry them; put the fresh mulberry leaves into the dsRNA solution one by one and in an orderly manner, and the operator wears disposable PE gloves to press the mulberry leaves to ensure that the mulberry leaves are completely immersed, and after sealing the plastic box, place it in a 4°C refrigerator for 24 hours to ensure that the mulberry leaves fully absorb the dsRNA.

[0014] Preferably, the mulberry leaf preparation process in step 3 is: take out the soaked mulberry leaves, wear disposable PE gloves to operate, place the mulberry leaves in a clean 1L flat-bottomed plastic box, and use clean filter paper to gently absorb excess solution on the leaves; let it stand at room temperature for 5 minutes to make the temperature of the mulberry leaves consistent with the room temperature, so as to reduce the stress effect on the gypsy moth.

[0015] Preferably, the feeding strategy for different instars of the gypsy moth in step 3 is as follows: for 1-3 instar larvae, the mulberry leaf petioles are wrapped with cotton wool soaked in dsRNA solution and then fed; for 4-6 instar larvae, the mulberry leaves soaked in dsRNA are directly fed without wrapping the petioles; the feeding amount needs to be adjusted according to the age and number of larvae to ensure that a single leaf can be completely eaten every day.

[0016] Preferably, the relationship between the feeding amount and the age and number of the larvae is as follows: 50 4th-instar larvae and 20-30 5th-6th-instar larvae can completely eat a piece of mulberry leaf in one day.

[0017] Preferably, the process of replacing mulberry leaves in step 3 is: replace new dsRNA-soaked mulberry leaves every day to ensure that the American white moth continues to ingest feed containing dsRNA; when replacing mulberry leaves, larval feces and residual leaves must be cleaned at the same time to keep the breeding environment clean and hygienic.

[0018] Preferably, the duration of feeding in step 3 is 7-10 days of continuous feeding of the gypsy moth, covering two instars of the gypsy moth.

[0019] Preferably, the interference efficiency is determined in step 4 by randomly selecting dsRNA-soaked mulberry leaves treated larvae of the same age and for the same number of feeding days as the experimental group, and larvae not interfered with under the same conditions as the control group for determination.

[0020] The more specific technical solutions of the present invention are as follows:

[0021] The specific operation of synthesizing the dsRNA solution of the target gene in step 1 includes:

[0022] Step 1-1, gene selection and sequence design: based on the transcriptome sequencing data of the gypsy moth, select the target gene to be interfered with, design and optimize the dsRNA sequence;

[0023] Step 1-2, dsRNA synthesis and dilution: Use molecular biology techniques to synthesize high-purity dsRNA; use a measuring cylinder to accurately measure 1L of ultrapure water and add it to a 2L flat-bottomed plastic box as a dilution solvent; use a high-precision pipette to draw 200μL of a dsRNA solution with a concentration of 3000ng / μL and add it dropwise into the ultrapure water; use a glass rod to stir until the solution is evenly mixed to prepare a dsRNA working solution with a concentration of 0.6ng / μL.

[0024] The processing method of mulberry leaves in step 2 is:

[0025] Step 2-1, mulberry leaf selection and preparation: select fresh mulberry leaves with a leaf length of 15-25cm and a leaf width of 15-20cm every day, make sure the leaves are intact and undamaged, wash them with pure water and dry them;

[0026] Step 2-2, mulberry leaf soaking treatment: 0.6 ng / μL dsRNA solution was divided into a group of 2L flat-bottomed plastic boxes, and fresh mulberry leaves were placed into the dsRNA solution one by one and in an orderly manner. The operator wore disposable PE gloves and pressed the mulberry leaves to ensure that the leaves were completely immersed. After sealing the plastic box, it was placed in a 4°C refrigerator for 24 hours to ensure that the mulberry leaves fully absorbed the dsRNA.

[0027] The steps of feeding the dsRNA-soaked mulberry leaves to the American white moth in step 3 are as follows:

[0028] Step 3-1, mulberry leaf preparation process: take out the soaked mulberry leaves, wear disposable PE gloves, place the mulberry leaves in a clean 1L flat-bottom plastic box, and use clean filter paper to gently absorb the excess solution on the leaves; let it stand at room temperature for 5 minutes to make the temperature of the mulberry leaves consistent with room temperature, so as to reduce the stress effect on the American white moth;

[0029] Step 3-2, adjusting the feeding strategy according to the age of the gypsy moth: for 1-3 instar larvae, feeding the larvae with mulberry leaf petioles wrapped with absorbent cotton soaked in dsRNA solution; for 4-6 instar larvae, feeding the mulberry leaves soaked in dsRNA directly without wrapping the petioles;

[0030] Step 3-3, feeding management and mulberry leaf replacement: Replace the dsRNA-soaked mulberry leaves with new ones every day to ensure that the gypsy moth continues to ingest feed containing dsRNA; when replacing mulberry leaves, clean up the larvae’s feces and remaining leaves at the same time to keep the breeding environment clean and hygienic. Feed the gypsy moth continuously for 7-10 days, covering two instars of the gypsy moth.

[0031] The method for determining the interference efficiency in step 4 is:

[0032] Step 4-1, sample collection and preparation: randomly select dsRNA-soaked mulberry leaf-treated larvae of the same age and the same number of days of feeding as the experimental group, and undisturbed larvae under the same conditions as the control group for measurement;

[0033] Step 4-2, RNA extraction and reverse transcription: extract the total RNA from the larvae of the experimental group and the control group respectively, and reverse transcribe the extracted RNA into cDNA to provide a template for subsequent detection;

[0034] Step 4-3, qRT-PCR detection and interference efficiency calculation: Real-time fluorescence quantitative PCR (qRT-PCR) technology was used to detect the expression level of the target gene before and after interference; by comparing the difference in target gene expression between the experimental group and the control group, the interference efficiency of feeding dsRNA soaked mulberry leaves on the target gene expression of the American white moth was calculated.

[0035] Compared with the prior art, the present invention has the following beneficial effects:

[0036] 1. High specificity and efficiency: This application uses RNA interference (RNAi) technology to achieve highly specific interference with the gene expression of the American white moth by synthesizing dsRNA of specific target genes. This method can accurately target and inhibit the expression of specific genes, providing a powerful tool for studying gene function. The present invention can significantly reduce the expression level of the target gene in a short period of time, providing a more direct and efficient means for studying gene function;

[0037] 2. Non-invasive operation and low damage: Compared with the method of directly injecting high-concentration dsRNA solution into the gypsy moth using a microinjector, the present invention uses the method of feeding dsRNA soaked in mulberry leaves to achieve non-invasive interference with the target gene of the gypsy moth. This method avoids the complexity and risk of directly manipulating the genome of the organism, while reducing the mechanical damage caused by injection and the mortality rate of the gypsy moth larvae. This not only improves the reliability and repeatability of the experiment, but also provides new possibilities for RNAi research on young larvae;

[0038] 3. Environmental friendliness and sustainable development: The RNAi technology used in this application is significantly environmentally friendly. Compared with traditional chemical pesticides, dsRNA does not pollute the environment or harm non-target organisms. By interfering with the expression of key genes of pests to control pest populations, the present invention provides a green and sustainable solution for pest management. This helps to reduce the use of chemical pesticides, reduce the negative impact of agricultural production on the environment, and promote sustainable agricultural development;

[0039] 4. Easy operation and strong controllability: The method of feeding dsRNA soaked mulberry leaves provided in this application is easy to operate and has strong controllability. From the synthesis of dsRNA, the soaking treatment of mulberry leaves to feeding management, each step has detailed operating instructions and parameter controls. This allows researchers to easily master the method and maintain a high degree of controllability during the experiment. In addition, the dsRNA synthesis raw materials used in this method are easy to obtain and have low cost, which is suitable for large-scale experimental research;

[0040] 5. Broad application prospects: This application is not only applicable to the research of target genes of the American white moth, but can also be extended to the research of other pests and target genes. By adjusting the sequence and concentration of dsRNA and changing the feeding strategy, researchers can conduct in-depth research on different pests and target genes. This provides broad application prospects for pest management, gene function research and the development of new pesticides;

[0041] 6. Promote interdisciplinary and technological innovation: The implementation of this application involves knowledge and technology in multiple disciplines such as molecular biology, pest biology, and gene function research. By integrating the advantageous resources and technical means of these disciplines, the present invention promotes interdisciplinary and technological innovation. This not only provides new ideas and methods for pest management and gene function research, but also provides a platform for communication and cooperation for researchers in related fields;

[0042] 7. In summary, the present invention patent "Method for interfering with the expression of target genes of the American white moth by feeding mulberry leaves soaked with dsRNA" has shown significant professional advantages and broad application prospects in gene function research, pest management and technological innovation. This method not only provides a powerful research tool for scientific researchers, but also makes positive contributions to sustainable agricultural development and environmental protection. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 A comparison chart of the effects of feeding method and immersion method on mortality of the American white moth for this application;

[0044] Figure 2 This is a comparison chart of the interference efficiency of the target gene of the American white moth using the feeding method and the immersion method in this application. DETAILED DESCRIPTION

[0045] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0046] Embodiment 1:

[0047] A method for interfering with the expression of a target gene of the cunning moth comprises the following steps:

[0048] Step 1, synthesize dsRNA solution of target gene:

[0049] Step 1-1, gene selection and sequence design: The 4th, 5th and 6th instar larvae of the American moth in non-diapause (light-dark ratio 16:8) and pre-diapause (light-dark ratio 12:12) conditions were transferred to disposable culture dishes containing phosphate buffered saline (1×PBS). Fine dissection was performed under a stereo microscope, and the fat bodies of the larvae were carefully separated and placed in a 1.5mL centrifuge tube containing 500μL phosphate buffered saline. After collecting a sufficient number of fat bodies, centrifuge at 10000rpm for 3 minutes at 4℃, and then the supernatant was discarded. The samples were quickly frozen with liquid nitrogen and stored in a -80℃ refrigerator for later use. After collecting enough samples, RNA sequencing analysis was performed using the Illumina HiSeq platform. The sequencing data were processed, and the RNA sequencing data of the fat bodies of the 4th, 5th and 6th instar larvae in pre-diapause and non-diapause were named DP4, DP5, DP6 and NDP4, NDP5, NDP6, respectively. Based on the transcriptome sequencing data of the gypsy moth, the unique differential genes in each comparison group were screened by constructing a Venn diagram of differential genes, thereby obtaining the unique gene sets of DP4, DP5, and DP6. At the same time, the differential genes between DP6 and DP4, NDP6 and NDP4, DP5 and DP4, NDP5 and NDP4, and DP6 and DP5 were analyzed by Venn diagram to screen the unique differential genes between the groups. Combined with functional annotations and FPKM values, significant differential genes closely related to diapause function were further screened, such as DH, FACR, AP, and UDPE. According to the screened target gene (DH, FACR) sequences, online tools (such as NCBI's Blast) were used to design specific primers containing T7 promoter sequences, carefully select the target genes to be interfered with, and design and optimize the dsRNA sequences to ensure that they are specific to the target genes. The sequences of dsDH and dsFACR are as follows;

[0050] The sequence of dsDH is as shown in SEQ ID NO.1: TGTAGAACACTAACTTAACCCCCTCCTGAGAA GTGACCCGAGCCCAGAAGTGGGCATTATGGGTTGTTGACAAATTCAATCTTCTGTAAGCTACATTTTACAAAAAATATGAAAAAGTAGGTGGCTGACCATTAATTTGTATAATCGGAGAAGTTAGAACGACTATAACGTTCGTTCACCACTCGACTAGACGTAATGAAACTGGGGATTTCGGTGCTAGTAGAAAATCGAATTGAATGTCCAACTCGCCGTCAAACTCAACGCGCCATCTCTGCATGATCTTAGCAAGTAGCAGATGCAGCTCCATATCGACGAATCGTTTTCCGGGACACATTCGCCTCCCGCGTCCGAAGGGTGCCACCAATGACGGAGCGTGTGGAGTCATCGGTTGAATCCAACGTTCTGGTAGAAACTCCTCAGGGCGGCAGAAGTTCTCCTCACGACGGCAGGCTGCACCCGTATGAGCTAATACGAAAGTCCCAGCAGGTAGCTTATGGCCGGCAATAGTCATTGGCGAATCCAGAAGTCTTGCCAAAAACGGAGCCGTAGGTAAAAGTCTAAAA;

[0051] The sequence of dsFACR is as shown in SEQ ID NO.2: CAAAGGGTCATCGAACCTAAAAGAAATCTT;

[0052] Step 1-2, dsRNA synthesis and dilution: extract total RNA from the 6th instar diapause nymph larvae, and obtain cDNA template by reverse transcription. Subsequently, use primers containing T7 promoter sequence for PCR amplification, insert T7 promoter sequence into the target fragment, and obtain DNA template with T7 linker. Finally, mix and incubate the PCR amplified product with transcription reagent to synthesize the required dsRNA solution. Every 1000ng DNA can synthesize 40ul dsRNA with a concentration of 3000ng / μL. Use advanced molecular biology technology to accurately synthesize high-purity dsRNA; use a measuring cylinder to accurately measure 1L ultrapure water and add it to a 2L flat-bottomed plastic box as a dilution solvent; use a high-precision pipette to accurately draw 200μL of dsRNA solution with a concentration of 3000ng / μL and slowly add it to ultrapure water; use a glass rod to gently stir until the solution is evenly mixed to obtain a dsRNA working solution with a concentration of 0.6ng / μL.

[0053] Step 2, soak mulberry leaves with dsRNA solution:

[0054] Step 2-1, mulberry leaf selection and preparation: Considering the difference in feeding amount of larvae at different ages, the present invention adopts the method of soaking mulberry leaves to feed 5th and 6th instar larvae of the American white moth. Five leaves with a leaf length of about 15 cm and a leaf width of about 8 cm are selected for the 5th instar larvae and 10 leaves with a leaf length of about 15 cm and a leaf width of about 8 cm are selected for the 6th instar larvae every day. Ensure that the leaves are intact and undamaged, wash them with pure water and dry them;

[0055] Step 2-2, mulberry leaf soaking treatment: Divide the diluted dsRNA solution into multiple 2L flat-bottomed plastic boxes, ensuring that the amount of solution in each box is appropriate. Place fresh mulberry leaves in the dsRNA solution one by one in an orderly manner, ensuring that the mulberry leaves are completely immersed. The operator needs to wear disposable PE gloves and press the mulberry leaves hard to promote their full absorption of the dsRNA solution. After sealing the plastic box, place it in a 4°C refrigerator for 24 hours to ensure that the mulberry leaves fully absorb the dsRNA.

[0056] Step 3, feeding the dsRNA-soaked mulberry leaves to the gypsy moth:

[0057] Step 3-1, mulberry leaf preparation and feeding: Take out the soaked mulberry leaves and wear disposable PE gloves to avoid contamination. Place the mulberry leaves in a clean 1L flat-bottomed plastic box and use clean filter paper to gently absorb the excess solution on the leaves. Let it stand at room temperature for 5 minutes to make the temperature of the mulberry leaves consistent with the room temperature, reducing the stress on the gypsy moth;

[0058] Step 3-2, adjust the feeding strategy according to the age of the gypsophila: for 1-3 instar larvae, because they are highly dependent on leaves, use cotton wool soaked in dsRNA solution to wrap the petioles of mulberry leaves and feed them to prevent the leaves from withering and drying and affecting the larvae's feeding; for 4-6 instar larvae, feed directly with mulberry leaves soaked in dsRNA without wrapping the petioles; usually, 50 4-instar larvae and 20-30 5-6-instar larvae can completely eat a piece of mulberry leaf in one day; in order to continuously interfere with the expression of the target gene, mulberry leaves soaked in low-concentration dsRNA solution are used to feed the gypsophila larvae continuously for 7-10 days to cover the age and the previous age with high expression levels of the target gene. In this embodiment, the selected target gene has a high expression level at the 6th instar. In order to interfere with its expression, healthy 5th instar larvae of uniform size and just molted are selected for feeding experiments. The larvae were placed in an incubator with a humidity of 60%, a temperature of (25±1)°C, and a photoperiod of 12L:12D, and were fed with mulberry leaves soaked in dsDH, dsFACR, and dsRFP solutions for more than 24 hours. After the larvae molted and entered the 7th instar, they were fed with normal mulberry leaves until they pupated. Each treatment group had 40 larvae, and a total of five repeated experiments were conducted, with the control group being fed with mulberry leaves soaked in dsRFP solution. In order to continuously interfere with the expression of the target gene, it is necessary to continuously feed the mulberry leaves soaked in low-concentration dsRNA to the hyphal moth larvae for about 7-10 days, covering the instar and the previous instar with high expression levels of the target gene. In this embodiment, the selected target gene has a higher expression level at the 6th instar, so healthy 5th instar larvae of uniform size and just molted are selected for feeding experiments. The larvae were raised in an incubator with a humidity of 60%, a temperature of (25±1)℃, and a photoperiod of 12L:12D, and were fed with mulberry leaves soaked with dsDH, dsFACR, and dsRFP solutions. After the larvae molted and entered the 7th instar, they were fed with normal mulberry leaves until they pupated. Each treatment group had 40 larvae, and a total of five repeated experiments were conducted, with the dsRFP gene as the control group;

[0059] Step 3-3, feeding management and mulberry leaf replacement: Replace the dsRNA-soaked mulberry leaves with new ones every day to ensure that the gypsy moth continues to ingest feed containing dsRNA. When replacing mulberry leaves, clean the larvae feces and residual leaves in the insect box at the same time to keep the feeding environment clean and hygienic. Or transfer the larvae directly to a new insect box to reduce the impact on their growth and development. Feed the gypsy moth continuously for 7-10 days, covering its two instars, to ensure that the interference effect is fully manifested.

[0060] Step 4, determine the interference efficiency of the target gene of the American white moth:

[0061] Step 4-1, sample collection and preparation: randomly select larvae of the American white moth of the same age and the same number of days of feeding treated with dsRNA soaked mulberry leaves as the experimental group, randomly select active larvae that have molted 48 hours after feeding and place them in centrifuge tubes, use liquid nitrogen to freeze them, and store them in a -80°C refrigerator. Set up 4 replicates for each group, and each replicate contains 3 larvae. At the same time, select larvae that are not disturbed under the same conditions as the control group, and use larvae of the same age fed with mulberry leaves soaked in dsRFP solution as the control group to ensure the accuracy of the experimental results;

[0062] Step 4-2, RNA extraction and reverse transcription: Use FreeZol Reagent R711 kit to extract total RNA from the larvae of the experimental group and the control group, respectively. Use a high-quality RNA extraction kit for the operation. IIQRT SuperMix for qPCR (+gDNA wiper) reverse transcription kit, which reverse transcribes the extracted RNA into cDNA to provide a template for subsequent detection;

[0063] Step 4-3, qRT-PCR detection and interference efficiency calculation: ChamQ SYBR qPCRMaster Mix (HighROX Premixed) kit real-time fluorescence quantitative PCR (qRT-PCR) technology was used to accurately detect the expression level of the target gene before and after interference. The 2^-ΔΔCt method was used to calculate the relative expression of the gene, and EF1-α and RPL13 were selected as reference genes for standardization. Since the data may not conform to the normal distribution, the Mann Whitney test was used for significant difference analysis. The data analysis process was completed using IBM SPSS Statistics 26 software, and the visualization of the results was achieved through GraphPad Prism 8.0.2 software. By comparing the difference in target gene expression between the experimental group and the control group, the interference efficiency of feeding dsRNA soaked mulberry leaves on the expression of the target gene of the American white moth was scientifically calculated.

[0064] In this example, the 5th instar larvae of the gypsy moth were fed with mulberry leaves soaked in a low-concentration dsRNA solution until they molted to the 7th instar, and 48 hours after they molted to the 6th instar, the interference efficiency of the target gene was detected by qPCR. The experiment set up two target genes (DH and FACR) and a control group (dsRFP), and used a method of interfering with the target gene of the gypsy moth by micro-syringe injection as a control. The results showed that compared with the micro-syringe injection method, which can significantly increase the mortality rate of the gypsy moth, the effect of the immersion feeding method on the mortality rate of the gypsy moth is very small and even negligible ( Figure 1). Compared with the dsRFP control group, the target gene expression levels in the dsDH and dsFACR treatment groups were significantly reduced, with silencing efficiencies of 83.7% and 53.4%, respectively. This indicates that interfering with the target gene of the gypsy moth by continuously soaking mulberry leaves in a low-concentration dsRNA solution can effectively reduce the expression level of the target gene of the gypsy moth ( Figure 2 ).

[0065] Therefore, the patent of this invention proposes an innovative non-invasive method to achieve efficient interference with the target gene of the American white moth by feeding mulberry leaves soaked in dsRNA. This method is not only simple to operate and environmentally friendly, but also significantly reduces the expression level of the target gene, providing a new technical means for the field of pest control. The successful development of this technology not only demonstrates the application potential of RNAi technology in agricultural pest management, but also opens up a new path for the study of gene function and green control strategies of other pests, with broad application prospects and far-reaching social and economic benefits.

[0066] The above are preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A method for interfering with the expression of a target gene of the cunea gypsophila, characterized in that: The preparation method comprises the following steps: Step 1, synthesizing a dsRNA solution of the target gene: according to the transcriptome sequencing data of the gypsy moth, the target gene to be interfered is selected, the corresponding dsRNA is synthesized by molecular biology technology, and the synthesized dsRNA is dissolved in ultrapure water to dilute it into a 0.6 ng / μL dsRNA solution; Step 2, soaking mulberry leaves with dsRNA solution: Dilute the dsRNA solution into 2L flat-bottom plastic boxes, soak fresh mulberry leaves in the dsRNA solution, make sure that all the mulberry leaves are submerged in the dsRNA solution, seal well, and place in a 4°C refrigerator for 24 hours; Step 3, feeding dsRNA-soaked mulberry leaves to gypsy moths: taking out the dsRNA-soaked mulberry leaves, absorbing the excess water remaining on the leaves with clean filter paper, and then feeding the leaves to gypsy moths to interfere with the target gene. During the feeding process, fresh dsRNA-soaked mulberry leaves are replaced every day, and the feeding is continued for 7-10 days; Step 4, determining the interference efficiency of the target gene of the gypsy moth: collecting gypsy moths that have been fed with dsRNA-soaked mulberry leaves, taking gypsy moths without interference as controls, extracting RNA and reversely transcribing it into cDNA, using the qRT-PCR method to detect the expression of genes before and after interference, and calculating the interference efficiency of feeding dsRNA-soaked mulberry leaves on the expression of the target genes of gypsy moths.

2. The method for interfering with the expression of a target gene of the cunea according to claim 1, characterized in that: The specific operation of synthesizing a 0.6 ng / μL dsRNA solution in step 1 includes: using a measuring cylinder to accurately measure 1 L of ultrapure water and add it to a 2 L flat-bottomed plastic box as a dilution solvent; using a pipette to draw 200 μL of a dsRNA solution with a concentration of 3000 ng / μL, and adding it dropwise into the ultrapure water; using a glass rod to stir until the solution is evenly mixed to obtain a dsRNA working solution with a concentration of 0.6 ng / μL.

3. The method for interfering with the expression of a target gene of the cunea according to claim 1, characterized in that: The processing method of mulberry leaves in step 2 is as follows: select fresh mulberry leaves with a leaf length of 15-25 cm and a leaf width of 15-20 cm every day, ensure that the leaves are intact and undamaged, wash them with pure water and then dry them; put the fresh mulberry leaves into the dsRNA solution one by one and in an orderly manner, and the operator wears disposable PE gloves to press the mulberry leaves to ensure that the mulberry leaves are completely immersed. After sealing the plastic box, place it in a 4°C refrigerator for 24 hours to ensure that the mulberry leaves fully absorb the dsRNA.

4. The method for interfering with the expression of a target gene of the cunea according to claim 1, characterized in that: The mulberry leaf preparation process in step 3 is: take out the soaked mulberry leaves, wear disposable PE gloves, place the mulberry leaves in a clean 1L flat-bottomed plastic box, and use clean filter paper to gently absorb excess solution on the leaves; let it stand at room temperature for 5 minutes to make the temperature of the mulberry leaves consistent with the room temperature, reducing the stress on the gypsy moth.

5. The method for interfering with the expression of a target gene of the cunea according to claim 1, characterized in that: The feeding strategy for different instars of the gypsy moth in step 3 is as follows: for 1-3 instar larvae, wrap the petioles of mulberry leaves with cotton wool soaked in dsRNA solution and feed them; for 4-6 instar larvae, feed them directly with mulberry leaves soaked in dsRNA without wrapping the petioles; the feeding amount needs to be adjusted according to the age and number of larvae to ensure that a single leaf can be completely eaten every day.

6. The method for interfering with the expression of a target gene of the cunea according to claim 5, characterized in that: The relationship between feeding amount and larval age and number is: 50 4th-instar larvae and 20-30 5th-6th-instar larvae can completely eat a mulberry leaf in one day.

7. The method for interfering with the expression of a target gene of the cunea according to claim 1, characterized in that: The treatment of replacing mulberry leaves in step 3 is as follows: replace new dsRNA-soaked mulberry leaves every day to ensure that the American white moth continues to ingest feed containing dsRNA; when replacing mulberry leaves, it is necessary to clean up larval feces and residual leaves at the same time to keep the breeding environment clean and hygienic.

8. The method for interfering with the expression of a target gene of the cunea according to claim 1, characterized in that: The duration of feeding in step 3 is to feed the gypsy moth continuously for 7-10 days, covering two instars of the gypsy moth.

9. The method for interfering with the expression of a target gene of the cunea according to claim 1, characterized in that: The method for determining the interference efficiency in step 4 is as follows: randomly select dsRNA-soaked mulberry leaves treated larvae of the same age and for the same number of feeding days as the experimental group, and use larvae that are not disturbed under the same conditions as the control group for determination.

Images