CrRNA and application thereof in gene editing pig nucleic acid detection

Abstract

The invention discloses crRNA and application of the crRNA in gene editing pig nucleic acid detection. The invention provides crRNA, and a nucleotide sequence for identifying a target spot of the crRNA is SEQ ID NO. 1. The crRNA is obtained by in-vitro transcription of a transcription template; the transcription template is a product obtained by annealing a single-stranded DNA molecule as shown in SEQ ID NO. 2 and a single-stranded DNA molecule as shown in SEQ ID NO. 3. The invention provides the CRISPR / Cas12a system-based detection method for the gene editing pig, and the method is high in sensitivity, strong in specificity and convenient for on-site rapid detection.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to a crRNA and its application in nucleic acid detection of gene-edited pigs. Background Art

[0002] As one of the important development directions of animal breeding in the future, gene editing breeding technology has gradually entered the stage of production and application internationally. The United States, Japan and other countries have approved the entry of a variety of gene-edited animals and their products such as GalSafe gene-edited pigs, Madai red snapper, 22-seiki fugu tiger pufferfish, and PRLR-SLICK gene-edited cattle into the market. Myostatin (MSTN) is a muscle growth inhibitor. Studies have shown that knocking out the MSTN gene can significantly increase the muscle production of livestock and poultry. Several domestic teams have successfully prepared pigs, cattle, sheep, rabbits and other animals with MSTN knockouts, significantly increasing meat production. The Beijing Institute of Animal Husbandry and Veterinary Medicine of the Chinese Academy of Agricultural Sciences successfully bred MSTN gene-edited pigs using TALEN gene editing technology. After the MSTN gene of the pig was genetically modified, a 2 bp base deletion occurred in the third exon, which significantly increased the lean meat rate.

[0003] Nucleic acid detection of gene-edited animals is a key prerequisite for the large-scale production of gene-edited animals and their products, and is also an urgent need for breeding, testing, supervision and management. The development of a highly sensitive and easy-to-operate nucleic acid detection method for MSTN gene-edited pigs is of great significance to accelerate the industrialization of animal biological breeding. Summary of the invention

[0004] The technical problem solved by the present invention is how to quickly and accurately detect MSTN gene-edited pigs.

[0005] In order to solve the above technical problems, the first aspect of the present invention provides crRNA, whose nucleotide sequence for recognizing the target is SEQ ID NO.1.

[0006] The above crRNA targets the MSTN gene.

[0007] In the crRNA described above, the crRNA is transcribed in vitro from a transcription template; The transcription template is the product obtained by annealing the single-stranded DNA molecule shown in SEQ ID NO.2 and the single-stranded DNA molecule shown in SEQ ID NO.3.

[0008] In the crRNA described above, the nucleotide sequence of the crRNA is SEQ ID NO.4.

[0009] In a second aspect, the present invention provides a product comprising the crRNA, Cas12a protein, a primer pair for specific amplification of the target, and a single-stranded DNA probe described in the first aspect.

[0010] In the above-mentioned product, the primer pair consists of a single-stranded DNA molecule shown in SEQ ID NO.5 and a single-stranded DNA molecule shown in SEQ ID NO.6; In the above-mentioned product, the two ends of the single-stranded DNA probe are respectively labeled with different groups.

[0011] In the above-mentioned product, the group is a fluorescent group, a quenching group and / or biotin.

[0012] The products described above are test kits, test strips or fluorescence detection systems.

[0013] The single-stranded DNA probe is a single-stranded DNA rich in AT bases with a length of 10-50 nt.

[0014] The above-mentioned single-stranded DNA probe can be specifically as follows: The two ends of the single-stranded DNA probe used for fluorescence detection are labeled with a fluorescent group and a quenching group respectively; The single-stranded DNA probe used for test strip detection is labeled with a fluorescent group and biotin at both ends.

[0015] The products mentioned above have any of the following functions: B1) Identify or assist in identifying MSTN gene-edited pigs; B2) identifying or assisting in identifying whether the sample to be tested contains the MSTN gene editing sequence; B3) Identify or assist in identifying the genotype of MSTN gene-edited pigs.

[0016] In a third aspect, the present invention provides any of the following substances: A1) the Cas12a protein and the crRNA described in the second aspect, or a complex formed by the two; A2) The primer pair described in the second aspect.

[0017] In a fourth aspect, the present invention provides the use of the crRNA described in the first aspect and the product described in the second aspect in any of the following: B1) Identify or assist in identifying MSTN gene-edited pigs; B2) identifying or assisting in identifying whether the sample to be tested contains the MSTN gene editing sequence; B3) Identify or assist in identifying the genotype of MSTN gene-edited pigs; B4) Prepare products for identification or assisting in the identification of MSTN gene-edited pigs; B5) preparing a product for identifying or assisting in identifying whether the sample to be tested contains the MSTN gene editing sequence; B6) Prepare products for identifying or assisting in identifying the genotype of MSTN gene-edited pigs.

[0018] In a fifth aspect, the present invention provides a method for identifying or assisting in identifying MSTN gene-edited pigs, comprising the following steps: C1) using the nucleic acid of the sample to be tested as a template, and performing RPA amplification with the primer pair described in the second aspect to obtain an RPA product; C2) preparing a CRISPR-Cas12a detection system containing the following components: the RPA product, the Cas12a protein described in the second aspect, the crRNA in the crRNA described in the second aspect, and the single-stranded DNA probe in the second aspect; C3) reacting the CRISPR-Cas12a detection system and detecting the reaction product, thereby identifying or assisting in identifying the MSTN gene-edited pig.

[0019] The above detection reaction products are used to identify or assist in identifying the MSTN gene-edited pigs as E or F as follows: E. Detect the fluorescence intensity of each reaction product using a fluorescence detection instrument such as an enzyme-labeled instrument or a fluorescence quantitative PCR instrument: If the fluorescence intensity of the reaction product of the detection system is extremely significant ( P <0.01) is higher than the reaction product of the negative control system, then the sample to be tested is derived from or is a candidate to be derived from the MSTN gene-edited pig; if the fluorescence intensity of the reaction product of the detection system is not significant ( P >0.05) is higher than the reaction product of the negative control system, then the sample to be tested does not come from or the candidate does not come from the MSTN gene-edited pig; the negative control system is different from the detection system 1 only in that crRNA is not added; F. Each reaction product is tested with colloidal gold test strips (Cas12 / 13 special nucleic acid colloidal gold test strips (JY0301) Beijing Libo Taiye Technology Co., Ltd.): If both the T and C lines detected by the reaction product of the detection system are colored or only the T line is colored (positive), the sample to be tested is derived from or may be derived from the MSTN gene-edited pig; if the C line detected by the reaction product of the detection system is colored and the T line is not colored (negative), the sample to be tested is not derived from or may not be derived from the MSTN gene-edited pig.

[0020] In the above, the sample to be tested is the ear or other tissue of the pig to be tested.

[0021] The method is not for the purpose of disease diagnosis and treatment.

[0022] The nucleotide sequence of the MSTN gene editing sequence above is SEQ ID NO.8.

[0023] The experiments of the present invention have proved that the present invention provides a nucleic acid detection method for MSTN gene-edited pigs based on the CRISPR / Cas12a system, which has high sensitivity and strong specificity and can realize rapid on-site detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Standard plasmid sequencing results for MSTN gene-edited pigs (A) and MSTN gene wild-type pigs (B).

[0025] Figure 2 The results of RPA primer amplification are shown in Figure 2.

[0026] Figure 3 The results of crRNA activity detection for targeting MSTN gene editing of pig MSTN gene sequence. ** indicates a very significant difference compared with the negative control group (NC) ( P <0.01), ns indicates no significant difference compared with the negative control group (NC) ( P >0.05).

[0027] Figure 4 The sensitivity results of the MSTN-RPA-Cas12a fluorescence reporter detection system. ** indicates a significant difference compared with the negative control group (NC) ( P <0.01), ns indicates no significant difference compared with the negative control group (NC) ( P >0.05).

[0028] Figure 5 The MSTN-RPA-Cas12a colloidal gold test strip system is used to detect pig nucleic acid samples. DETAILED DESCRIPTION

[0029] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0030] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0031] Unless otherwise specified, the quantitative tests in the following examples were performed three times and the results were averaged.

[0032] The present invention is described below in conjunction with specific examples, which are merely exemplary and are not intended to limit the scope of the present invention. Unless otherwise specified, the examples are all based on conventional experimental conditions, such as Sambrook et al. Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or the conditions recommended by the manufacturer's instructions.

[0033] The main reagents used in the following examples are: LbCas12a protein (EDE0005) was purchased from Guangzhou Aidi Gene Technology Co., Ltd.; 10×LbCas12aCleavage Buffer (EDE0005) was purchased from Guangzhou Aidi Gene Technology Co., Ltd.; tissue DNA extraction kit (DP304-03) was purchased from Tiangen Biochemical Technology Co., Ltd.; EX Taq enzyme (RR001Q) was purchased from Takara; CloneSmarter TOPO cloning vector kit (C5865-50) was purchased from Sino-US Taihe Biotechnology (Beijing) Co., Ltd.; Escherichia coli DH5α competent cells (B528413-0100) were purchased from Sangon Biotechnology (Shanghai) Co., Ltd.; primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.; T7 in vitro transcription kit (AM1354) was produced by Invitrogen; RNA Purification kit RNA purification and recovery kit (T2040ST) was produced by NEB; single-stranded DNA fluorescent probe was synthesized by Sangon Biotech (Shanghai) Co., Ltd.; single-stranded DNA colloidal gold test paper probe (EDN-THD02) was purchased from Guangzhou Aidi Gene Technology Co., Ltd.; Cas12 / 13 special nucleic acid detection test strip (JY0301) was purchased from Beijing Libo Taiye Technology Co., Ltd.; TwistAmp Basic kit (TABS03KIT) was purchased from Beijing Libo Taiye Technology Co., Ltd.

[0034] The main instruments are as follows: PCR instrument (C1000 Touch TM, BIO-RAD); desktop high-speed refrigerated centrifuge (Heraeus Multifuge X1R, Thermo); bacterial incubator (MIR-254, SANYO); vortex shaker (SA8, Stuart-equipment); electronic weighing balance (Sartorius SQP, Sartorius Scientific Instrument Co., Ltd.); gel imaging system (BIO-RAD, Universal Hood II); constant temperature water bath (HHS-21-4, Changzhou Noki Instrument Co., Ltd.); fluorescent quantitative PCR instrument (QuantStudio™5, Thermo Scientific).

[0035] The MSTN gene-edited pigs in the following examples were prepared according to the following method: The MSTN gene-edited pigs were bred by the Beijing Institute of Animal Husbandry and Veterinary Medicine, Chinese Academy of Agricultural Sciences. A 2 bp base deletion occurred in the third exon of the MSTN gene, causing the MSTN gene to terminate translation prematurely and unable to produce functional MSTN protein, thereby increasing the lean meat rate.

[0036] The MSTN gene-edited pig is described in the following literature, and its name in the literature is “MSTN − / − MS pigs", the literature is Fan, Z., Z. Liu, K. Xu, T. Wu, J. Ruan, 362-375. The MSTN gene-edited pigs in the following examples were prepared according to the following method: “MSTN − / − The "MS pigs" were mated with wild-type Meishan pigs (from the Meishan pig breeding farm in Jiading District, Shanghai, hereinafter referred to as MSTN gene wild-type pigs (wild type, WT)) to produce offspring pigs. The offspring pigs were genotyped, and the offspring pigs with a 2 bp base deletion in the third exon of the MSTN gene were the MSTN gene-edited pigs in the following embodiments.

[0037] The method of the above genotype detection is as follows: The genomic DNA of the pig ear edge skin tissue or tail skin tissue was extracted, and PCR amplification was performed with primers MSTN-PCR-F (5`-TTGCTACTATTAACTCTTCTTTCA-3`) and MSTN-PCR-R (5`-TATATTATTTGTTCTTTGCCATTA-3`) and gel electrophoresis was performed. The sample with a single band of about 370 bp in length was successfully amplified, and the PCR amplification product was sent to Shanghai Biotechnology Co., Ltd. for sequencing.

[0038] The Sanger sequencing results of the PCR products were compared with the MSTN genome reference sequence (genbank number: NM_214435, submitted on 2024-4-3) in the SnapGene software. The sequencing results showed a genotype with MSTN single gene editing on two homologous chromosomes and a deletion of bases 126-127 in the third exon (748-1128 of NM_214435), which was named MSTN gene-edited pig homozygous.

[0039] The sequencing results showed that one homologous chromosome had the MSTN single gene edited genotype and the base 126-127 of the third exon was deleted, and the other homologous chromosome had the wild-type MSTN genotype, named MSTN gene-edited pig heterozygote.

[0040] The sequencing results showed that both homologous chromosomes had wild-type MSTN genotypes, and the pigs were named MSTN gene wild-type pigs or wild-type pigs.

[0041] The homozygous MSTN gene-edited pig has only a base deletion (i.e., 2 bp base deletion) at positions 126-127 of the third exon of the MSTN gene (genbank number: NM_214435, submitted on 2024-4-3) in the third exon of the MSTN gene in the two homologous chromosomes, compared with the MSTN gene in the wild MSTN gene-bearing pig (genbank number: NM_214435, submitted on 2024-4-3), and the other nucleotide residues remain unchanged.

[0042] The MSTN gene-edited pig heterozygote is a pig with only a base deletion (i.e., 2 bp base deletion) at positions 126-127 of the third exon of the MSTN gene (genbank number: NM_214435, submitted on 2024-4-3) in one homologous chromosome compared to the wild-type pig with the MSTN gene (genbank number: NM_214435, submitted on 2024-4-3), and the other nucleotide residues remain unchanged; the other homologous chromosome is the same as the MSTN gene in the wild-type pig with the MSTN gene.

[0043] Example 1: RPA-CRISPR / Cas12a nucleic acid detection system for detecting MSTN gene-edited pigs 1. Acquisition of crRNA 1. Standard plasmid construction A tissue DNA extraction kit was used to extract ear tissue DNA from homozygous MSTN gene-edited pigs and wild-type MSTN pigs (WT), and the primers shown in Table 1 were used to amplify the upstream and downstream sequences of the target site of the third exon of the MSTN gene to obtain PCR products.

[0044] Table 1 shows the primers for amplifying the MSTN gene

[0045] The PCR reaction system is as shown in Table 2: Table 2 shows the PCR reaction system

[0046] PCR reaction program: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 57.6°C annealing for 30 s, 72°C extension for 30 s, 34 cycles; 72°C for 5 min.

[0047] The PCR products were gel-recovered and purified, and the purified products were connected to the pClone-EZ-TOPO vector (China-US Taihe Biotechnology (Beijing) Co., Ltd., C5865-50). After sequencing verification, the gene-edited pig MSTN gene standard plasmid MSTN-GE and the wild-type pig MSTN gene standard plasmid MSTN-WT were obtained.

[0048] MSTN-GE is a vector obtained by replacing the TOPOI site of the pClone-EZ-TOPO vector with the MSTN gene editing sequence (SEQ ID NO.8).

[0049] MSTN-WT is a vector obtained by replacing the TOPO I site of the pClone-EZ-TOPO vector with the wild-type sequence (SEQ ID NO. 9).

[0050] Compared with the wild-type sequence, the above-mentioned MSTN gene editing sequence is a sequence obtained by deleting bases 161-162 of the wild-type sequence.

[0051] The sequencing results of the two plasmids are as follows Figure 1 As shown, Figure 1 A is the sequencing result of the standard plasmid of gene-edited pig MSTN gene. Figure 1 B is the sequencing result of the standard plasmid of wild-type porcine MSTN gene.

[0052] 2. crRNA target design According to the DNA sequences within the range of 40 bp upstream and downstream of the 2 bp deletion site in the third exon of the MSTN gene of the MSTN gene-edited pigs and the MSTN gene wild-type pigs, the sequences that met the recognition requirements of LbCas12a were searched, and then one candidate target site was screened according to the rules such as sequence GC content and sequence complementarity, as shown in Table 3.

[0053] Table 3 shows the crRNA of candidate target sites

[0054] 3. Preparation of specific crRNA in vitro transcription template According to the candidate target site sequence, the T7 promoter sequence (TAATACGACTCACTATAGGG) (Chen JS et al. Science, 2018, 360(6387): 436-439.) and the crRNA repeat region template sequence (TAATTTCTACTAAGTGTAGAT) were added to form the specific crRNA in vitro transcription template positive-strand DNA sequence (SEQ ID NO.2) shown in Table 4, and the negative-strand DNA sequence (SEQ ID NO.3) was formed according to the complementary pairing of the positive-strand DNA sequence.

[0055] Table 4 shows the positive and negative strands of the specific crRNA in vitro transcription templates.

[0056] The positive-strand DNA and the negative-strand DNA were synthesized, and the specific crRNA in vitro transcription template was prepared by annealing. The annealing reaction system as shown in Table 5 was prepared in the PCR tube: Table 5 shows the annealing reaction system

[0057] Place the PCR tube in a PCR instrument and incubate at 95°C for 10 min, then immediately turn off the PCR instrument to allow the double-stranded strand to slowly cool down at room temperature, and incubate on ice for 5 min after 90 min. The annealed product is the crRNA in vitro transcription template and can be used for crRNA in vitro transcription.

[0058] 4. Specific crRNA in vitro transcription The T7 in vitro transcription kit (AM1354) produced by Invitrogen was used to prepare the transcription system in a PCR tube as shown in Table 6: Table 6 is a specific crRNA in vitro transcription system

[0059] The transcription system was placed in a 37°C incubator for overnight incubation. The crRNA was recovered using an RNA purification and recovery kit produced by NEB.

[0060] The recovered crRNA sequences are shown in Table 7: Table 7 is the crRNA sequence

[0061] 2. Design and Screen RPA Primers According to the upstream and downstream sequences of the target site of the third exon of the porcine MSTN gene, RPA amplification primers were designed. The candidate RPA primer sequences are shown in Table 8 below: Table 8 shows the RPA amplification primers

[0062] The RPA reaction system is as shown in Table 9: Table 9 shows the RPA reaction system

[0063] The RPA reaction conditions are as follows: Incubate at 39°C for 30 min.

[0064] At 4.1×10 10 The standard plasmid pClone-EZ-TOPO-GE of MSTN gene-edited pig MSTN gene with 10 copies / μL was used as a template, and RPA amplification was performed using the primer pairs (F and R) shown in Table 8, the system and RPA reaction conditions shown in Table 9 to obtain RPA amplification products.

[0065] The RPA amplification products of each primer pair were subjected to agarose gel electrophoresis. Figure 2 As shown in the figure, MSTN-PRA-1 represents MSTN-RPA-1F / MSTN-RPA-1R, and so on. It can be seen that the amplification product of MSTN-RPA-1F / R has a single and brighter band than the amplification products of the other two pairs of primers.

[0066] Primers MSTN-RPA-1F (SEQ ID NO. 5) and MSTN-RPA-1R (SEQ ID NO. 6) with better amplification effects were selected as RPA amplification primers.

[0067] 3. crRNA Verification The DNA probe in Table 10 is a single-stranded DNA fluorescent probe double-labeled with a 6-FAM group and a BHQ1 group, and the sequence is 6-FAM-TTATT-BHQ1. The CRISPR / Cas12a fluorescence detection system is prepared according to the components shown in Table 10 below: Table 10 is a CRISPR / Cas12a fluorescence detection system

[0068] Among them, the RPA products were 4.1×10 10 The standard plasmid pClone-EZ-TOPO-GE with 10 copies / μL was used as the DNA template for RPA amplification.

[0069] The GEcrRNA detection system was prepared according to the above system, and the crRNA was GEcrRNA.

[0070] Three technical replicates were set up, and a negative control (NC) without crRNA was set up. The prepared detection system was reacted in a Q5 quantitative PCR instrument at 37°C for 60 minutes, and the fluorescence intensity was set to be detected every 30 seconds.

[0071] The results are as follows Figure 3 As shown, GEcrRNA only specifically targets and cuts the MSTN gene editing (GE) sequence, producing fluorescence with a very significant difference (P<0.01) compared with the NC group, and does not cut the wild-type (WT) sequence of the MSTN gene. Therefore, GEcrRNA can specifically recognize the GE sequence and can be used to distinguish GE and WT samples.

[0072] IV. Establishment of RPA-CRISPR / Cas12a nucleic acid detection system 1. RPA amplification The DNA of the sample to be tested was extracted as a template, and RPA amplification was performed using the MSTN-RPA-1F / MSTN-RPA-1R primers according to the system and RPA reaction conditions shown in Table 9 to obtain an RPA amplification product.

[0073] 2. CRISPR / Cas12a detection of MSTN gene-edited pigs 1) CRISPR / Cas12a fluorescence detection The above RPA amplification product and GEcrRNA were used to prepare a CRISPR / Cas12a fluorescence detection system according to the system shown in Table 10 to obtain a GEcrRNA fluorescence detection system; Three technical replicates were set up for each of the above detection systems, and a negative control (NC) without crRNA was set up.

[0074] The prepared detection system was reacted in a Q5 quantitative PCR instrument at 37°C for 60 minutes.

[0075] The reaction products of each of the above fluorescence detection systems were used to detect the fluorescence intensity in real time using a Q5 quantitative PCR instrument.

[0076] If the fluorescence intensity of the reaction product of the GEcrRNA detection system is extremely significant ( P <0.01) is higher than the reaction product of the negative control system, then the sample to be tested contains or is a candidate for containing the MSTN gene editing sequence (SEQ ID NO.8), or the sample to be tested is derived from or is a candidate for being derived from the MSTN gene-edited pig; if the fluorescence intensity of the reaction product of the GEcrRNA reaction system is not significant ( P >0.05) is higher than the reaction product of the negative control system, then the sample to be tested does not contain or the candidate does not contain the MSTN gene editing sequence (SEQ ID NO.8), or the sample to be tested does not originate from or the candidate does not originate from the MSTN gene-edited pig.

[0077] The above negative control system differs from the GEcrRNA detection system only in that no crRNA is added.

[0078] The above-mentioned MSTN gene-edited pigs are MSTN gene-edited pigs homozygous or MSTN gene-edited pigs heterozygous.

[0079] 2) CRISPR / Cas12a test strip detection The above RPA amplification product and GEcrRNA were prepared into a CRISPR / Cas12a test strip detection system according to the system shown in Table 11 to obtain a GEcrRNA test strip detection system; The DNA probe in Table 11 is a single-stranded DNA test strip probe doubly labeled with a Biotin group and a 6-FAM group, and the sequence is 6-FAM-TTTTTTTATTTTTTT (SEQ ID NO. 7)-C6Biotin.

[0080] Table 11 shows the CRISPR / Cas12a test strip detection system

[0081] The GEcrRNA test strip detection system was prepared according to the above system, and a negative control (NC) without crRNA was set up.

[0082] The prepared detection system was reacted in a PCR instrument at 37° C. for 30 minutes to obtain a reaction product (reaction solution).

[0083] The reaction products of each of the above-mentioned test strip detection systems are detected using Cas12 / 13 dedicated nucleic acid detection test strips.

[0084] Open the tube cap and insert the pad end of the test strip into the reaction solution. The liquid level should not exceed the top of the pad. Wait until the reading area is completely soaked (it takes about 1 to 2 minutes. When the ambient temperature is low, such as in winter, the water absorption speed will be reduced and the soaking time of the reading area will be extended). Read the test results directly according to the color development of the test strip.

[0085] If only the T line of the test strip of the GEcrRNA detection system is colored, or both the C line and the T line are colored (positive), the sample to be tested contains or is a candidate for containing the MSTN gene editing sequence (SEQ ID NO.8), or the sample to be tested is derived from or is a candidate for being derived from an MSTN gene-edited pig; if only the C line of the test strip of the GEcrRNA detection system is colored and the T line is not colored (negative), the sample to be tested does not contain or is a candidate for not containing the MSTN gene editing sequence (SEQ ID NO.8), or the sample to be tested does not originate from or is a candidate for not being derived from an MSTN gene-edited pig.

[0086] The above-mentioned MSTN gene-edited pig RPA-CRISPR / Cas12 detection system includes: GEcrRNA, MSTN-RPA-1F primer, MSTN-RPA-1R primer, LbCas12a protein, and single-stranded DNA probe.

[0087] Example 2: Sensitivity analysis of the MSTN gene-edited pig CRISPR / Cas12a nucleic acid detection system Use nuclease-free ddH 2 O dilute the gene-edited porcine MSTN gene standard plasmid MSTN-GE to 4.1×10 10 4.1×10 9 4.1×10 8 4.1×10 7 4.1×10 6 4.1×10 5 4.1×10 4 4.1×10 3 4.1×10 2 4.1×10 1 4.1×10 0 copies / μL concentration.

[0088] Using gradient concentrations of MSTN-GE plasmid as template, RPA amplification was performed using the aforementioned RPA primers (MSTN-RPA-1F / R) and conditions, and the RPA products were detected by electrophoresis.

[0089] The detection system and reaction conditions are shown in Example 1.

[0090] The fluorescence intensity detection results of the GEcrRNA fluorescence detection system are shown in Figure 4 When the standard plasmid concentration is 4.1×10 1 When the detection results were 100 copies / μL, there was still an order of magnitude difference compared with the negative control, and the difference in fluorescence intensity was extremely significant ( P<0.01). This indicates that the detection sensitivity of the GEcrRNA system is 4.1×10 1 copies / μL, with higher sensitivity.

[0091] Example 3: Detection of pig nucleic acid samples using the MSTN gene-edited pig RPA-Cas12a nucleic acid detection system The MSTN gene-edited pig nucleic acid detection system provided by the present invention is used to analyze MSTN gene-edited pigs (homozygous samples: 77, 78, 80, 82, 1407; heterozygous samples: 1394, 1396, 1398, 1399, 1401), MSTN gene wild-type pigs (sample numbers: 3082, 3086, 3090, 3097, 3106), and other gene-edited pigs (sample numbers: 191, 193, 1347, 1350, 1356) samples to detect whether the system can accurately identify MSTN gene-edited pig samples.

[0092] The above nucleic acid samples are all extracted from the genomic DNA of each pig.

[0093] The RPA amplification system was prepared according to the composition in Table 9, and the prepared amplification system was reacted in a thermostat at 39° C. for 30 minutes.

[0094] A single-stranded DNA test strip probe double-labeled with a Biotin group and a 6-FAM group was synthesized, and the sequence was 6-FAM-TTTTTTTATTTTTTT (SEQ ID NO.7)-C6Biotin. A CRISPR / Cas12a detection system was prepared according to the components in Table 11, a GEcrRNA test strip detection system was prepared according to the above system, and a negative control (NC) without crRNA was set up.

[0095] The prepared test strip detection system was reacted in a thermostat at 37° C. for 30 minutes to obtain a reaction product (reaction solution).

[0096] The reaction solution is tested with a Cas12 / 13 dedicated nucleic acid test strip, and the test result is directly read according to the color development of the test strip.

[0097] The results are as follows Figure 5As shown, the number above each test strip indicates the sample number. When the RPA-Cas12a detection system with GEcrRNA as crRNA detects nucleic acid samples of MSTN gene-edited pig homozygotes, MSTN gene-edited pig heterozygotes, MSTN gene wild-type pigs (wild pigs), and other gene-edited pigs, the nucleic acid samples containing MSTN gene-edited sequences (MSTN gene-edited homozygotes, MSTN gene-edited heterozygotes) have a positive result of only T line coloring or both C line and T line coloring. The test results of nucleic acid samples (wild pigs, other gene-edited pig nucleic acid samples) without MSTN gene-edited sequences are consistent with the negative control results, with C line coloring and T line no coloring reaction, showing a negative result. This shows that the GEcrRNA system combined with colloidal gold test paper can accurately detect nucleic acid samples containing MSTN gene-edited sequences.

[0098] The experimental results of the above samples are consistent with the results of genotype identification. Therefore, the GEcrRNA and detection method provided by the present invention can be used to quickly, highly sensitively and specifically identify MSTN gene-edited pigs or nucleic acid samples containing MSTN gene-edited pigs, which can be applied to the detection, breeding, production, and supervision of MSTN gene-edited pigs.

[0099] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. crRNA, the nucleotide sequence of which recognizes the target is SEQ ID NO.

1.

2. The crRNA according to claim 1, characterized in that: The crRNA is obtained by in vitro transcription from a transcription template; The transcription template is the product obtained by annealing the single-stranded DNA molecule shown in SEQ ID NO.2 and the single-stranded DNA molecule shown in SEQ ID NO.

3.

3. The crRNA according to claim 1 or 2, characterized in that: The nucleotide sequence of the crRNA is SEQ ID NO.

4.

4. A product comprising the crRNA, Cas12a protein, a primer pair for specific amplification of a target, and a single-stranded DNA probe described in any one of claims 1-3.

5. The product according to claim 4, characterized in that: The primer pair consists of a single-stranded DNA molecule shown in SEQ ID NO.5 and a single-stranded DNA molecule shown in SEQ ID NO.

6.

6. The product according to claim 4 or 5, characterized in that: The two ends of the single-stranded DNA probe are respectively labeled with different groups; And / or, the group is a fluorescent group, a quenching group and / or biotin.

7. The product according to any one of claims 4 to 6, characterized in that: The product is a test kit, a test strip or a fluorescence detection system.

8. Any of the following substances: A1) the Cas12a protein and the crRNA described in any one of claims 4 to 7, or a complex formed by the two; A2) The primer pair according to any one of claims 4 to 7.

9. Use of the crRNA according to any one of claims 1 to 3 or the product according to any one of claims 4 to 7 in any of the following: B1) Identify or assist in identifying MSTN gene-edited pigs; B2) identifying or assisting in identifying whether the sample to be tested contains the MSTN gene editing sequence; B3) Identify or assist in identifying the genotype of MSTN gene-edited pigs; B4) Prepare products for identification or assisting in the identification of MSTN gene-edited pigs; B5) preparing a product for identifying or assisting in identifying whether the sample to be tested contains the MSTN gene editing sequence; B6) Prepare products for identifying or assisting in identifying the genotype of MSTN gene-edited pigs.

10. A method for identifying or assisting in identifying MSTN gene-edited pigs, comprising the following steps: C1) using the nucleic acid of the sample to be tested as a template, and performing RPA amplification using the primer pair described in any one of claims 4 to 7 to obtain an RPA product; C2) preparing a CRISPR-Cas12a detection system containing the following components: the RPA product, the Cas12a protein described in any one of claims 4-7, the crRNA described in any one of claims 4-7, and the single-stranded DNA probe described in any one of claims 4-7; C3) reacting the CRISPR-Cas12a detection system and detecting the reaction product, thereby identifying or assisting in identifying the MSTN gene-edited pig.

Images