Detection method and application of miRNA and miRNA analogues
By designing two DNA probes, targeting the target miRNA and miRNA analogs with single-base differences, and optimizing the hybridization temperature, highly specific miRNA detection is achieved, solving the problem of poor detection specificity in existing technologies and improving detection accuracy.
Patent Information
- Application Number
- CN202510893321.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-30
- Publication Date
- 2025-09-19
- Estimated Expiration
- 2045-06-30
AI Technical Summary
Existing miRNA detection technologies have poor detection specificity and a high proportion of nonspecific signals when facing target miRNAs and miRNA analogs with single-base differences, which affects the accuracy of the test results.
Two DNA probes were designed, probe 1 completely matched the miRNA analog, and probe 2 completely matched the target miRNA. By optimizing the hybridization temperature, probe 2 did not hybridize with the miRNA analog, but only captured the target miRNA, generating a fluorescent signal.
The specificity of miRNA detection is improved, nonspecific signals are reduced, and the accuracy of detection is enhanced.
Smart Images

Figure CN120665995A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of nucleic acid detection, relates to miRNA detection, and specifically relates to a detection method for miRNA and its analogs and applications thereof. Background Art
[0002] MicroRNAs (miRNAs) are a class of small, non-coding RNA molecules that regulate gene expression at the post-transcriptional level. Their biogenesis involves a complex, sequential process, regulating the expression of numerous genes involved in all cellular processes. Their function is essential for maintaining homeostasis within individual cells. Consequently, numerous studies have demonstrated that aberrant expression of miRNAs is associated with the development and progression of numerous diseases, particularly malignancies and viral infections. Furthermore, miRNAs can be obtained through minimally invasive procedures and analyzed using basic molecular methods in clinical laboratories, making them promising biomarkers and potential tools for personalized medicine.
[0003] MiRNA hybridization technology is a molecular detection method based on the principle of complementary base pairing. Due to its relatively low cost and high throughput, it is widely used in miRNA expression analysis and functional research. The core of this technology is the use of labeled probes to specifically bind to target miRNAs, enabling qualitative and quantitative analysis of miRNAs through signal detection. However, direct hybridization capture using RNA probes has poor detection specificity and is prone to capturing other miRNAs with similar sequences, especially those with only single base differences. This can affect the accuracy of test results and, in turn, clinical judgment.
[0004] Prior art CN112813142A discloses a microRNA capture magnetic bead, a preparation method, and a microRNA detection method. Streptavidin biomagnetic beads and biotin-modified ssDNA probes that are completely complementary to the hsa-miRNA-146b-5p to be detected are mixed to obtain microRNA capture magnetic beads; fluorescent DNA modified with a fluorescent group FAM that is partially complementary to the ssDNA probe is hybridized with microRNA capture magnetic beads to prepare fluorescent microRNA capture magnetic beads; a test solution containing hsa-miRNA-146b-5p is mixed with the fluorescent microRNA capture magnetic beads, and a chain displacement reaction is performed to obtain the replaced microRNA capture magnetic beads. The above-mentioned microRNA capture magnetic beads are detected using a flow cytometer to obtain a fluorescent detection signal on the surface of the biomagnetic beads, thereby realizing the detection of microRNA. The disadvantage of this technology is that when there is a sequence highly similar to hsa-miRNA-146b-5p, the detection specificity is poor and the proportion of non-specific signals is high.
[0005] Prior art CN107267604A discloses a microRNA detection method based on double-stranded specific nuclease mediation. A short-chain DNA probe is designed, and a fluorescent group and a quenching group are labeled at both ends. A solution containing the DNA probe and the DSN enzyme is added to the test solution. When there is no target miRNA in the test solution, the fluorescent group labeled on the DNA probe is quenched and no fluorescence emission occurs; when the solution contains the target miRNA, the DNA probe hybridizes with the target miRNA, and the DSN enzyme cuts the DNA probe in the DNA / miRNA double strand, releasing a fluorescent signal. The hybridization-enzyme cleavage reaction occurs in a continuous cycle, and the fluorescent signal continues to increase. By optimizing the reaction conditions, a calibration curve for the detection of the target miRNA is obtained, and quantitative detection is achieved. The disadvantage of this technology is that it requires the additional addition of nuclease, and the single-base discrimination detection specificity is poor. Summary of the Invention
[0006] The present invention addresses the problem of poor detection specificity in existing technologies and provides a method for detecting miRNA and its analogs and its application. The present invention designs probes 1 and 2 for target miRNA and miRNA analogs that differ by only one base. The probes each bind to a portion of the miRNA, while probe 2 can be bound to a solid-phase carrier such as a chip or microsphere. Probe 1 is modified with a signal marker material such as a fluorescent dye or biotin. After the target miRNA or miRNA analog is mixed with probes 1 and 2 and incubated, the hybridization temperature is optimized to prevent probe 2 from hybridizing with the miRNA analog and only hybridize and capture the target miRNA, resulting in high detection specificity.
[0007] To achieve the above object, the technical solution adopted by the present invention is as follows: In one aspect, the present invention provides a method for detecting miRNA and its analogs, the detection method comprising the following steps: S1. Design probes 1 and 2 for the target miRNA and miRNA analogs, wherein there is only one different base between the target miRNA and the miRNA analog, and the different base is at least 6 bases away from the 5' end of the target miRNA, and the different base is at least 6 bases away from the 3' end of the target miRNA; S2, probe 1 completely and specifically binds to the miRNA analog and binds to the 3' end of the miRNA analog, covering the differential base described in S1, and the number of bases of probe 1 exceeding the differential base is at least 2, and the 5' end of probe 1 is modified with a group that directly or indirectly produces fluorescence; S3, probe 2 completely and specifically binds to the target miRNA, binds to the 5' end of the target miRNA, and covers the differential base described in S1, and the number of bases that probe 2 exceeds the differential base is at least 1, and the 3' end of probe 2 is connected to the solid phase support; S4. The target miRNA or miRNA analog is mixed with probe 1 and probe 2. After incubation, probe 2 replaces part of the sequence of probe 1. The mixture is washed and fluorescence detection is performed to generate a fluorescence signal to detect the target miRNA.
[0008] Preferably, in step S2, the number of bases of the probe 1 exceeding the differential base is 2-4.
[0009] Specifically, in step S2, the number of bases of the probe 1 exceeding the differential base is 3.
[0010] Preferably, in step S3, the number of bases that the probe 2 exceeds the differential base is 1-3.
[0011] Specifically, in step S2, the number of bases of the probe 2 that exceeds the differential base is 1.
[0012] Preferably, the nucleotide on probe 1 or probe 2 that is complementary to the differential base is modified.
[0013] Nucleotides are composed of a base, a pentose sugar (ribose or deoxyribose), and a phosphate group. The base is bound to the ribose or deoxyribose through a glycosidic bond. During the research and development process, nucleotides can be chemically modified to increase stability and binding activity. Generally, the following modifications are included: (1) Phosphate group modification Phosphate backbone modification is the most basic chemical modification, with phosphorothioate being the most commonly used. This involves replacing the non-bridging oxygen atoms of the phosphodiester bond of a nucleotide with sulfur atoms (PS replacing PO), which can effectively reduce the hydrophilicity of oligonucleotides.
[0014] (2) Ribose modification Common modifications include 2'-MOE (2-methoxyethyl) modification, 2'-OMe (2'-O-methyl) modification, 2'-F (2'-Fluoro) modification, etc., which can enhance its binding ability with complementary nucleotide chains.
[0015] (3) Sugar ring modification Common ones include ZNA (zip nucleic acid), LNA (locked nucleic acid), PNA (peptide nucleic acid), PMO (phosphoroamidatemorpholino oligomer), etc., which can effectively improve the performance of nucleotides.
[0016] (4) Base modification By modifying the bases of nucleotides, the Tm value can be increased. For example, methylation of cytosine can increase its melting temperature.
[0017] Preferably, the modification methods include phosphate group modification, ribose modification, sugar ring modification and base modification.
[0018] Preferably, the phosphate group modification includes thiophosphate backbone modification, the ribose modification includes 2'-MOE modification, 2'-OMe modification and 2'-F modification, the sugar ring modification includes ZNA modification, LNA modification, PNA modification and PMO modification, and the base modification includes methylation modification.
[0019] Preferably, the target miRNA has the nucleic acid sequence shown in SEQ ID NO.1, the miRNA analog has the nucleic acid sequence shown in SEQ ID NO.2, the probe 1 includes the nucleic acid sequence shown in SEQ ID NO.5-9, and the probe 2 includes the nucleic acid sequence shown in SEQ ID NO.4.
[0020] Preferably, the solid phase carrier in step S3 comprises a chip or microspheres, and the microspheres comprise latex microspheres, magnetic microspheres or silica microspheres; preferably, the microspheres are magnetic microspheres.
[0021] Preferably, the incubation method in step S4 comprises the following steps: first incubating at 90°C for 3 minutes, then cooling from 90°C to 30°C at a rate of 1°C per 3 minutes, and finally incubating at 30°C for 60 minutes.
[0022] Preferably, the differential base in step S1 is separated from the 5' end of the target miRNA by 6-20 bases.
[0023] Preferably, the differential base in step S1 is separated from the 5' end of the target miRNA by 10 bases.
[0024] Preferably, the differential base in step S1 is separated from the 3' end of the target miRNA by 6-20 bases.
[0025] Preferably, the differential base in step S1 is separated from the 3' end of the target miRNA by 12 bases.
[0026] Preferably, the group in step S2 includes a biotin group.
[0027] Preferably, the fluorescence detection method in step S4 includes using a fluorescence detection instrument for detection.
[0028] In another aspect, the present invention provides use of the above detection method in nucleic acid capture and / or detection.
[0029] Principle of the invention: According to the target miRNA, two DNA probes are designed to bind to a part of the miRNA respectively. Probe 2 can be bound to a solid phase carrier such as a chip or microsphere. Probe 1 is modified with a fluorescent dye or biotin or other signal marker material. When and only when both probes bind to the same miRNA, the miRNA can be captured and a fluorescent signal can be generated. The specific probe design principle is as follows. Figure 1 As shown: For highly similar miRNA sequences, such as miRNA analogs that differ from the target miRNA by only a single base, Probe 2 is designed to be longer than the base to be distinguished and to completely match the target miRNA. Probe 1 is designed to be at least 2 nt longer than the base to be distinguished and to completely match the miRNA analog. Because Probe 2 is bound to the solid phase and Probe 1 is free in solution, Probe 1 has a higher affinity for the miRNA than Probe 2, so Probe 1 hybridizes and binds to the miRNA first. Probe 1 is a perfect match for the miRNA analogue, but has a base mismatch with the target miRNA near the end. Therefore, for the target miRNA, the sequence in probe 2 that is a perfect match for the target miRNA will replace the mismatched base sequence in probe 1, and the two probes bind to the target miRNA at the same time. For the miRNA analogue, there is a mismatch in probe 2 and a perfect match in probe 1. Therefore, probe 2 cannot replace probe 1, resulting in a decrease in the number of hybridization bases between probe 2 and the miRNA analogue and a significant decrease in the binding force. By optimizing the hybridization temperature, probe 2 can be prevented from hybridizing with the miRNA analogue. Therefore, the chip or microsphere solid phase will not capture the miRNA analogue, but only the target miRNA. The fluorescent signal generated is only the fluorescent signal generated on the target miRNA, which improves the specificity of miRNA detection.
[0030] Compared with the prior art, the present invention has the following beneficial effects: The present invention designs probes 1 and 2 for target miRNA and miRNA analogs, and has strong specificity for detecting target miRNA and strong single-base discrimination capability. BRIEF DESCRIPTION OF THE DRAWINGS
[0031] Figure 1 Schematic diagram of the probe design principle of the present invention. DETAILED DESCRIPTION
[0032] Unless otherwise specified, the raw materials used in the present invention are all common commercially available products, and their sources are not specifically limited.
[0033] Example 1: Probe Design (the number of bases that probe 1 exceeds the differential base is 1) according to Figure 1 Design principle Designed DNA dual probes.
[0034] The hsa-miR-135b-5p sequence was selected as the target miRNA, and its sequence is shown in SEQ ID NO.1: rUrArUrGrGrCrUrUrUrUrCrArUrUrCrCrUrArUrGrUrGrA (5'-3', r represents the following base is an RNA base); The hsa-miR-135a-5p sequence was selected as the miRNA analog, and its sequence is shown in SEQ ID NO.2: rUrArUrGrGrCrUrUrUrUrUrArUrUrCrCrUrArUrGrUrGrA (5'-3', r represents that the following base is an RNA base).
[0035] The DNA sequence on the magnetic microspheres is SEQ ID NO. 3 shown below: GATTAGTATTTAGTAGTAATAGAG.
[0036] The sequence of DNA probe 2 is shown in SEQ ID NO. 4: TGAAAAGCCATACTCTATTACTACTAAATACTAATC.
[0037] The sequence of DNA probe 1 is shown in SEQ ID NO. 5: TCACATAGGAATAA, and the 5' end thereof is modified with a biotin group.
[0038] Example 2: Probe Design (The number of bases that probe 1 exceeds the differential base is 2) according to Figure 1 Design Principle A DNA double probe was designed. The target miRNA, miRNA analogs, DNA on the magnetic microspheres, and probe 2 were the same as those in Example 1.
[0039] The sequence of DNA probe 1 is shown in SEQ ID NO. 6: TCACATAGGAATAAA, and the 5' end thereof is modified with a biotin group.
[0040] Example 3: Probe Design (The number of bases exceeding the differential base in probe 1 is 3) according to Figure 1 Design Principle A DNA double probe was designed. The target miRNA, miRNA analogs, DNA on the magnetic microspheres, and probe 2 were the same as those in Example 1.
[0041] The sequence of DNA probe 1 is shown in SEQ ID NO. 7: TCACATAGGAATAAAA, and the 5' end thereof is modified with a biotin group.
[0042] Example 4: Probe Design (The number of bases that probe 1 exceeds the differential base is 4) according to Figure 1 Design Principle A DNA double probe was designed. The target miRNA, miRNA analogs, DNA on the magnetic microspheres, and probe 2 were the same as those in Example 1.
[0043] The sequence of DNA probe 1 is shown in SEQ ID NO. 8: TCACATAGGAATAAAAA, and the 5' end thereof is modified with a biotin group.
[0044] Example 5: Probe Design (The number of bases that probe 1 exceeds the differential base is 5) according to Figure 1 Design Principle A DNA double probe was designed. The target miRNA, miRNA analogs, DNA on the magnetic microspheres, and probe 2 were the same as those in Example 1.
[0045] The sequence of DNA probe 1 is shown in SEQ ID NO. 9: TCACATAGGAATAAAAAAG, and the 5' end thereof is modified with a biotin group.
[0046] Comparative Example 1: Probe Design (RNA Probe) The target miRNA, miRNA analogs and DNA on the magnetic microspheres are the same as those in Example 1, with only one probe having the sequence shown in SEQ ID NO. 10: rUrCrArCrArUrArGrGrArArUrGrArArArArGrCrCrArUrACTCTATTACTACTAAATACTAATC, the 5' end of which is modified with a biotin group.
[0047] Comparative Example 2: Probe Design (Ordinary Dual Probe) The target miRNA, miRNA analogs and DNA on the magnetic microspheres are the same as those in Example 1, and there are two probes. The sequence of DNA probe 2 is shown in SEQ ID NO. 11: GAAAAGCCATACTCTATTACTACTAAATACTAATC.
[0048] The sequence of DNA probe 1 is shown in SEQ ID NO. 12: TCACATAGGAAT, and the 5' end thereof is modified with a biotin group.
[0049] Test Example 1: Detection Specificity (1) Reagent and solution description: The nucleic acid fragments and probes involved in the present invention are synthesized by Shanghai Diying Biotechnology Co., Ltd.
[0050] The target miRNA and miRNA analogs were dissolved in TE buffer (buffer components: 10 mM Tris and 1 mM EDTA) with a final concentration of 0.2 nM to obtain target miRNA solution and miRNA analog solution.
[0051] Probe 1 and probe 2 were dissolved in TE buffer to a final concentration of 0.5 nM to obtain a probe mixture.
[0052] Magnetic microspheres were purchased from Luminex, product number MagPlex-TAG, with a concentration of 2.5×10 6 pieces / mL.
[0053] Hybridization buffer: 10 mM Tris, 200 mM sodium acetate, 5 mM EDTA, 0.05% Tween 20.
[0054] Streptavidin-R-phycoerythrin conjugate (SAPE) was purchased from Invitrogen, catalog number S866.
[0055] (2) Detection method: 2.1. Add 10 μL of probe mix (a mixture of probes 1 and 2), 10 μL of RNA solution (target miRNA solution or miRNA analog solution), and 4 μL of microspheres to a 250 μL PCR tube, mix thoroughly, and then place the tube in a PCR instrument and incubate according to the protocol in Table 1.
[0056] Table 1 Incubation procedure
[0057] 2.2. Remove the PCR tube from the PCR instrument, add 100 μL of hybridization buffer and pipette it, then place it on a magnetic separator for magnetic attraction and remove the supernatant; repeat the above washing steps once more.
[0058] 2.3. Prepare streptavidin-R-phycoerythrin conjugate (SAPE) to 2 μg / mL using hybridization buffer, add 50 μL to the above PCR tube, mix well, and incubate with shaking at room temperature for 0.5 hour.
[0059] 2.4. Place the PCR tube on a magnetic separator and remove the supernatant. Then add 100 μL of hybridization buffer and pipette it through the tube. Then place the tube on a magnetic separator and remove the supernatant.
[0060] 2.5. Add 100 μL of hybridization buffer to the PCR tube and pipette through it. Place the tube in a flow cytometer (Luminex, model Luminex 200) for detection. Record the mean fluorescence intensity (MFI) of the PE channel (excitation wavelength: 488 nm, emission wavelength: 550-600 nm). (The SAPE fluorescence value of each microsphere identified by the optical components is recognized by the instrument and recorded in units of fluorescence intensity (FI). The instrument reads 1000 microspheres to obtain 1000 FI values. The instrument's built-in software uses statistical analysis to determine the median fluorescence intensity (MFI).
[0061] Among them, background refers to the MFI result of detecting nucleic acid-free water. The MFI of miRNA analogs is the MFI obtained by detecting miRNA analogs. The MFI of the target miRNA is the MFI obtained by detecting the target miRNA.
[0062] The proportion of nonspecific signals = (MFI of miRNA analog - MFI of background) / (MFI of target miRNA - MFI of background) * 100%.
[0063] Nonspecific signal / background = MFI of miRNA mimic / MFI of background.
[0064] (3) Test results: The test results of the above comparative examples and embodiments are shown in Table 2.
[0065] The results of Comparative Examples 1 and 2 show that the specificity of RNA probe hybridization for miRNA binding is poor, and the nonspecific signal generated by the captured miRNA analogs can reach 65.59% of the target miRNA signal, which is 13.93 times the background signal. The use of DNA dual probes can greatly improve the detection specificity. The nonspecific signal generated by the captured miRNA analogs accounts for only 5.72% of the target miRNA signal, but it is still significantly higher than the background signal, which is 4.07 times the background signal.
[0066] According to the results of Example 1, using the DNA dual probe designed according to the design principle of this patent, when the sequence length of probe P1 exceeds the base to be distinguished by only 1 base, the non-specific signal generated by the captured miRNA analog is 5.81% of the target miRNA signal, which is 4.75 times the background signal. The difference is not much compared with the result of using the DNA dual probe in Comparative Example 2, and the specificity cannot be significantly improved.
[0067] According to the results of Examples 2, 3, and 4, when the DNA dual probes designed using the design principles of this patent are used, when the sequence length of probe 1 exceeds the bases to be distinguished by 2-4 bases, the non-specific signal generated by the captured miRNA analog is only 0.77%-1.14% of the target miRNA signal, which is 1.45-1.62 times the background signal, close to the background signal, and the specificity is further improved relative to the method using DNA dual probes.
[0068] According to the results of Example 5, when the DNA dual probe designed using the design principle of this patent exceeds the base length of probe 1 by 5 bases that need to be distinguished, the nonspecific signal remains at a low level, but the signal of capturing the target miRNA decreases significantly. The nonspecific signal generated by the captured miRNA analog is 1.31% of the target miRNA signal, which is 1.50 times the background signal.
[0069] Table 2 Effects of different probe designs on specificity
[0070] Comparative Example 3: Detection Specificity Prior art CN112813142A discloses a microRNA capture magnetic bead, a preparation method, and a microRNA detection method. Streptavidin magnetic beads and a biotin-modified ssDNA probe that is completely complementary to the hsa-miRNA-146b-5p to be detected are mixed to obtain microRNA capture magnetic beads; fluorescent DNA modified with a fluorescent group FAM that is partially complementary to the ssDNA probe is hybridized with the microRNA capture magnetic beads to prepare fluorescent microRNA capture magnetic beads; a test solution containing hsa-miRNA-146b-5p is mixed with the fluorescent microRNA capture magnetic beads, and a strand displacement reaction is performed to obtain the replaced microRNA capture magnetic beads. The microRNA capture magnetic beads are detected using a flow cytometer to obtain a fluorescent detection signal on the surface of the biomagnetic beads, thereby realizing microRNA detection.
[0071] The experiment was designed according to the technical solution of CN112813142A as follows: The target miRNA and miRNA analogs are the same as those in Example 1.
[0072] The sequence of the biotin-modified probe ssDNA is shown in SEQ ID NO. 13: TCACATAGGAATGAAAAGCCATA, and the 5' end thereof is modified with a biotin group.
[0073] The sequence of the complementary strand of the ssDNA modified with the fluorescent group FAM is shown in SEQ ID NO.14: TATGGCTTTTCATTCC, its 5' end is modified with a FAM fluorescent group.
[0074] 1. First, dilute 20 μL of a 10 mg / mL suspension of streptavidin magnetic beads (purchased from Invitrogen, USA) with 1 mL of buffer A. Wash the beads three times with buffer A to remove the passivating agent and preservative from the surface of the streptavidin beads, then resuspend them in 400 μL of buffer B. Next, add 40 μL of 20 nM biotin-modified probe DNA (ssDNA) to 360 μL of distilled water. The bead suspension and ssDNA solution are mixed and incubated at 25°C with gentle shaking for 30 minutes. Buffer A consists of 5 mM Tris-HCl (pH 7.5), 0.5 mM EDTA, and 1 M NaCl. Buffer B consists of 10 mM Tris-HCl (pH 7.5), 1 mM EDTA, and 2 M NaCl.
[0075] 2. The prepared ssDNA-modified magnetic beads were resuspended in 400 μL of buffer C. 4 μL of 100 μM fluorophore FAM-modified ssDNA partial complementary strand (f-DNA) was added. The mixture was incubated on a shaker set at 30°C and 140 rpm for 1 hour. The ssDNA / f-DNA / magnetic bead probe was then washed three times with buffer C and dispersed in 2 mL of buffer C for further use. Buffer C consists of 20 mM Tris-HCl, 150 mM NaCl, and 15 mM MgCl2 in DEPC-treated and autoclaved ultrapure water; pH 7.0.
[0076] 3. Mix 50 μL of the prepared fluorescent microRNA capture magnetic bead solution with 5 μL of the test solution. Perform a strand displacement reaction on a shaker at 37°C and 170 rpm for 1 hour to obtain the microRNA capture magnetic beads. The test solution in the target miRNA group is a 0.2 nM target miRNA solution, the test solution in the miRNA analog group is a 0.2 nM miRNA analog solution, and the test solution in the control (background) group is nuclease-free water.
[0077] The reaction solution containing the microRNA capture beads was placed in a flow cytometer (the instrument used in the test example of this application, manufacturer Luminex, model Luminex 200) for detection. 1000 magnetic bead samples were collected and the FL1-A median fluorescence intensity (MFI) on the surface of the collected and detected magnetic beads was used for quantitative analysis of RNA. The RNA content in the test sample was analyzed by calculating the difference between the MFI of the test sample and the control group. The results are shown in Table 3, where "background" refers to the MFI result of the control group. A higher MFI in the miRNA analog group or the target miRNA group indicates that less fluorescent probe was replaced and the RNA binding affinity to ssDNA is lower; a lower MFI indicates that more fluorescent probe was replaced and the RNA binding affinity to ssDNA is higher. The proportion of non-specific signal in this comparative example = (background MFI - miRNA analog MFI) / (background MFI - target miRNA MFI) * 100%.
[0078] The proportion of non-specific signals detected using the CN112813142A patented technology was 12.88%, which was significantly higher than 0.77% in Example 3 of the present application, that is, the miRNA detection specificity of the patented technology solution was significantly better than that of the CN112813142A technology solution.
[0079] Table 3 Effects of different protocols on specificity
[0080] Comparative Example 4: Detection specificity under different incubation conditions This comparative example compares the differences in detection specificity under different incubation conditions. The specific experimental settings are as follows.
[0081] Based on Example 3, the test was performed according to the method of Test Example 1, and experimental groups 1-4 were added. Compared with Example 3, the only difference was the incubation conditions, and the other conditions were the same; the results corresponding to Example 3 in the test example were used as the control group.
[0082] The incubation conditions of experimental group 1 are shown in Table 4, which differ from those of Example 3 in that the temperature was lowered to 40°C.
[0083] Table 4 Incubation procedure
[0084] The incubation conditions of Experimental Group 2 are shown in Table 5, which differ from those of Example 3 in that the temperature was lowered to 20°C.
[0085] Table 5 Incubation procedure
[0086] The incubation conditions of experimental group 3 are shown in Table 6. The difference compared with Example 3 is that the temperature is lowered by 1°C every 3 minutes instead of every 6 minutes.
[0087] Table 6 Incubation procedure
[0088] The incubation conditions of experimental group 4 are shown in Table 7, which are different from those of Example 3 in that the incubation was maintained at 30°C for 30 minutes.
[0089] Table 7 Incubation procedure
[0090] The test results are shown in Table 8. Table 8 Effects of different incubation methods on specificity
[0091] According to the results of experimental group 1, the cooling termination temperature was changed from 30°C to 40°C, the specific signal decreased significantly from 663 to 239, and the proportion of non-specific signals increased from 0.77% to 0.87%.
[0092] According to the results of experimental group 2, the cooling termination temperature was changed from 30°C to 20°C, and the nonspecific signal increased significantly from 16 to 124, and the proportion of nonspecific signals increased from 0.77% to 10.92%.
[0093] According to the results of experimental group 3, the cooling rate was changed from 1°C every 3 minutes to 1°C every 6 minutes, and the proportion of non-specific signals increased from 0.77% to 0.91%. Because the cooling rate was slower, the total incubation time was extended by 3 hours.
[0094] According to the results of experimental group 4, when the holding time at 30°C was changed from 1h to 30min, the specific signal decreased significantly from 663 to 508, and the proportion of non-specific signals increased from 0.77% to 1.20%.
[0095] In summary, the incubation scheme of the present application has significant advantages over other incubation schemes, especially in terms of significant improvement in detection specificity.
[0096] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions of the technical solution of the present invention by ordinary technicians in this field do not deviate from the essence and scope of the technical solution of the present invention.
Claims
1. A method for detecting miRNA and its analogs, characterized in that: The detection method comprises the following steps: S1. Design probes 1 and 2 for the target miRNA and miRNA analogs, wherein there is only one different base between the target miRNA and the miRNA analog, and the different base is at least 6 bases away from the 5' end of the target miRNA, and the different base is at least 6 bases away from the 3' end of the target miRNA; S2, probe 1 completely and specifically binds to the miRNA analog and binds to the 3' end of the miRNA analog, covering the differential base described in S1, and the number of bases of probe 1 exceeding the differential base is at least 2, and the 5' end of probe 1 is modified with a group that directly or indirectly produces fluorescence; S3, probe 2 completely and specifically binds to the target miRNA, binds to the 5' end of the target miRNA, and covers the differential base described in S1, and the number of bases that probe 2 exceeds the differential base is at least 1, and the 3' end of probe 2 is connected to the solid phase support; S4. The target miRNA or miRNA analog is mixed with probe 1 and probe 2. After incubation, probe 2 replaces part of the sequence of probe 1. The mixture is washed and fluorescence detection is performed to generate a fluorescence signal to detect the target miRNA.
2. The detection method according to claim 1, wherein In step S2, the number of bases of the probe 1 exceeding the differential base is 2-4.
3. The detection method according to claim 2, characterized in that In step S2, the number of bases of the probe 1 exceeding the differential base is 3.
4. The detection method according to claim 1, wherein In step S3, the number of bases of the probe 2 that exceed the differential base is 1-3.
5. The detection method according to claim 4, characterized in that In step S2, the number of bases of the probe 2 that exceeds the differential base is 1.
6. The detection method according to claim 1, characterized in that The nucleotide on the probe 1 or probe 2 that is complementary to the differential base is modified.
7. The detection method according to claim 6, characterized in that The modification methods include phosphate group modification, ribose modification, sugar ring modification and base modification.
8. The detection method according to claim 7, characterized in that The phosphate group modification includes thiophosphate backbone modification, the ribose modification includes 2'-MOE modification, 2'-OMe modification and 2'-F modification, the sugar ring modification includes ZNA modification, LNA modification, PNA modification and PMO modification, and the base modification includes methylation modification.
9. The detection method according to claim 1, wherein The target miRNA has the nucleic acid sequence shown in SEQ ID NO.1, the miRNA analog has the nucleic acid sequence shown in SEQ ID NO.2, the probe 1 includes the nucleic acid sequence shown in SEQ ID NO.5-9, and the probe 2 includes the nucleic acid sequence shown in SEQ ID NO.
4.
10. The detection method according to claim 1, characterized in that The solid phase carrier in step S3 includes a chip or microspheres, and the microspheres include latex microspheres, magnetic microspheres or silica microspheres; preferably, the microspheres are magnetic microspheres.
11. The detection method according to claim 1, characterized in that The incubation method in step S4 includes the following steps: first incubating at 90°C for 3 minutes, then cooling from 90°C to 30°C at a rate of 1°C per 3 minutes, and finally incubating at 30°C for 60 minutes.
12. The detection method according to claim 1, characterized in that The differential base in step S1 is separated from the 5' end of the target miRNA by 6-20 bases.
13. The detection method according to claim 12, characterized in that: The differential base in step S1 is separated from the 5' end of the target miRNA by 10 bases.
14. The detection method according to claim 1, characterized in that The differential base in step S1 is separated from the 3' end of the target miRNA by 6-20 bases.
15. The detection method according to claim 14, characterized in that: The differential base in step S1 is separated from the 3' end of the target miRNA by 12 bases.
16. The detection method according to claim 1, characterized in that The group in step S2 includes a biotin group.
17. The detection method according to claim 1, characterized in that The fluorescence detection method in step S4 includes using a fluorescence detection instrument for detection.
18. Use of the detection method according to any one of claims 1 to 17 in nucleic acid capture and / or detection.
Citation Information
Patent Citations
Detection of nucleic acids
CN103146825A
Method for detecting content of target miRNA in sample to be detected
CN107119124A
MicroRNA capture magnetic bead, preparation method and MicroRNA detection method
CN112813142A
Method and kit for nucleic acid sequence detection
US20070269825A1
Cited By
Reagent for pre-miRNA detection and product and detection method thereof
CN122128436A
A reagent for pre-miRNA detection and its product and detection method
CN122128436B