Enhanced and orthogonal nucleic-acid detection and cleavage using specific crispr nuclease substrates

Abstract

The present invention relates to specific natural or artificial RNA or DNA / RNA substrates for cleaving by a Cas nuclease. The invention furthermore relates to a complex comprising the specific artificial RNA or DNA / RNA substrate, at least one of a Cas nuclease enzyme and at least one preselected guide RNA binding to at least one target RNA. The present invention also relates to methods for cleaving the natural or artificial RNA or DNA / RNA substrate and methods for detecting at least one target RNA in a cell, tissue, cellular nucleus, and / or sample using the substrate or for eliminating a cell expressing the at least one target RNA.

Description

[0001] ENHANCED AND ORTHOGONAL NUCLEIC-ACID DETECTION AND CLEAVAGE USING SPECIFIC CRISPR NUCLEASE SUBSTRATES

[0002] This invention was made with government support under R35 GM 138080 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0003] The present invention relates to specific natural or artificial RNA or DNA / RNA substrates for cleaving by a Cas nuclease. The invention furthermore relates to a complex comprising the specific artificial RNA or DNA / RNA substrate, at least one of a Cas nuclease enzyme and at least one preselected guide RNA binding to at least one target RNA. The present invention also relates to methods for cleaving the natural or artificial RNA or DNA / RNA substrate and methods for detecting at least one target RNA in a cell, tissue, cellular nucleus, and / or sample using the substrate or for eliminating a cell expressing the at least one target RNA.

[0004] Background of the invention

[0005] CRISPR nucleases are effector proteins from CRISPR-Cas immune systems that rely on RNA guides to identify complementary nucleic acid sequences. For a subset of the singleeffector nucleases, called Casl2 and Casl3, recognition of nucleic acid target complementary to the guide portion of the RNA guide unleashes collateral cleavage of non-specific substrates. For instance, Casl2a, Casl2b, Casl2e, and Casl2f nucleases (to name a few) naturally recognize double-stranded (ds)DNA targets flanked by a protospacer-adjacent motif (PAM) as well as single-stranded (ss)DNA targets lacking a PAM, initiating collateral cleavage of any ssDNA sequence. Separately, Cas 13 nucleases (including Cas 13 a, Cas 13b, Cas 13c, Cas 13d, and Casl3e) recognize complementary RNA targets flanked by a protospacer-flanking sequence (PFS), initiating collateral cleavage of ssRNA sequences.

[0006] Collateral cleavage of these substrates can be detected through different means, such as separation of a conjugated fluorophore and quencher, release of a methylene blue tag from a gold electrochemical sensor, or separation of two antigens that bind to antibodies on a test line and gold nanoparticles on a lateral flow strip, to name a few. Cleavage of these substrates can drive further signal amplification, such as allowing release or in vitro transcription of additional RNA targets or activating accessory proteins harboring their own collateral activities against nucleic acids and proteins. The nucleic acid target can also be amplified (e.g., by PCR, RPA, LAMP, NASBA) and / or converted between RNA and DNA using a reverse transcriptase and in vitro transcription. In any of these scenarios, these CRISPR nucleases can achieve highly sensitive detection of specific nucleic acid sequences with single-base discrimination.

[0007] As part of characterizing the collateral activities of some Cas nucleases, FRET and cryo-EM experiments demonstrated that Cas 12a undergoes a series of checkpoints during target binding that culminates in exposure of the RuvC domain, which initially cleaves the unwound dsDNA target by first cutting the non-target strand, then the target strand, and subsequently remains activate, allowing for indiscriminate ssDNA cleavage (Swarts DC, Jinek M. Mechanistic Insights into the cis- and trans-Acting DNase Activities of Casl2a. Mol Cell. 2019 Feb 7;73(3):589-600.e4. doi: 10.1016 / j.molcel.2018.11.021. Epub 2019 Jan 10. PMID: 30639240; PMCID: PMC6858279). US20200399697A1 describes the diagnostic use of Cas 12a based on its collateral degradation of ssDNA.

[0008] WO 2022 / 253903A1 relates to methods for RNA-directed cleavage of a nucleic acid molecule selected from dsDNA, ssDNA, and RNA based on a complex comprising a CasQ nuclease (more recently called Casl2a2) and at least one pre-selected guide RNA designed for binding to at least one target RNA. Further provided is the complex of the present invention bound to a target RNA molecule, as well as respective systems for cleaving of a nucleic acid molecule, and diagnostic and therapeutic uses thereof. No sequence preferences of the collateral substrates were known for Casl2a2.

[0009] A number of Cas nucleases, including Casl2a2, Cast 3, and Cas 12a, have been used for nucleic-acid detection based on their collateral cleavage activities. As these nucleases normally non-specifically cleave nucleic acids, multiplexing requires testing for individual biomarkers in separate reactions. This need has resulted in the use of microfluidic setups, such as CARMEN-Casl3a. Some Cas nucleases exhibit some preferences for collateral substrates, such as LwaCasl3a nucleases preferring RNA substrates containing A or PsmCasl3b nucleases preferring RNA substrates containing U. These insights allowed these nucleases to be combined with LbCasl2a nuclease and three collateral substrate reporters unique to each nuclease (AAAAA for LwaCasl3a, UUUUU for PsmCasl3b, TTATT for Casl2a), allowing multiplexed detection of a DNA sequence and two RNA sequences in the same reaction. However, these combinations have represented the limits of multiplexing when combining current Cas nucleases and collateral substrates.

[0010] Smith CW, et al. (in: Probing CRISPR-Casl2a Nuclease Activity Using Double-Stranded DNA-Templated Fluorescent Substrates. Biochemistry. 2020 Apr 21 ;59(15): 1474- 1481. doi: 10.1021 / acs.biochem.0c00140. Epub 2020 Apr 7. PMID: 32233423; PMCID: PMC7384386) report a dsDNA substrate (probe-full) for probing Casl2a trans-cleavage activity upon target detection. A diverse set of Casl2a substrates with alternating dsDNA character were designed and studied using fluorescence spectroscopy. They observed that probe-full without any nick displayed trans-cleavage performance that was better than that of the form that contains a nick. Different experimental conditions of salt concentration, target concentration, and mismatch tolerance were examined to evaluate the probe performance. The activity of Cas 12a was programmed for a dsDNA frame copied from a tobacco curly shoot virus (TCSV) or hepatitis B virus (HepBV) genome by using a guide RNA against TCSV or HepBV, respectively. While on-target activity offered detection of as little as 10 pM dsDNA target, off-target activity was not observed even at 1 nM control DNAs. They demonstrated that trans-cleavage of Casl2a is not limited to ssDNA substrates, and Casl2a-based diagnostics can be extended to dsDNA substrates.

[0011] Yang and Patel (in: Structures, mechanisms and applications of RNA-centric CRISPR-Casl3. Nat Chem Bioll , 673-688 (2024). https: / / doi.org / 10.1038 / s41589-024-01593-6) focus on CRISPR-Cas type VI Cas 13 systems that use single-subunit RNA-guided Cas endonucleases for targeting and subsequent degradation of foreign RNA, thereby providing adaptive immunity. Notably, distinct from single-subunit DNA-cleaving Cas9 and Casl2 systems, Casl3 exhibits target RNA-activated substrate RNase activity. The review outlines structural, biochemical and cell biological studies toward elucidation of the unique structural and mechanistic principles underlying surveillance effector complex formation, precursor CRISPR RNA (pre-crRNA) processing, self-discrimination and RNA degradation in Cast 3 systems as well as insights into suppression by bacteriophage-encoded anti-CRISPR proteins and regulation by endogenous accessory proteins.

[0012] Granados-Riveron and Aquino-Jarquin (in: CRISPR / Cas 13 -Based Approaches for Ultrasensitive and Specific Detection of microRNAs. Cells. 2021 Jul 1; 10(7): 1655. doi: 10.3390 / cellsl0071655. PMID: 34359825; PMCID: PMC8307730) provide an overview of several CRISPR-based biosensing platforms that have been developed and successfully applied for ultrasensitive and specific miRNA detection.

[0013] Nguyen, et al. (in: Enhancement of trans-cleavage activity of Casl2a with engineered crRNA enables amplified nucleic acid detection. Nat Commun 11, 4906 (2020). https: / / doi.org / 10.1038 / s41467-020-18615-l) disclose a platform with engineered crRNAs and optimized conditions that enabled the detection of various clinically relevant nucleic acid targets with higher sensitivity, achieving a limit of detection in the femtomolar range without any target pre-amplification step. By extending the 3'- or 5 '-ends of the crRNA with different lengths of ssDNA, ssRNA, and phosphorothioate ssDNA, they discovered a self-catalytic behavior and an augmented rate of LbCasl2a-mediated collateral cleavage activity as high as 3.5-fold compared to the wild-type crRNA and with significant improvement in specificity for target recognition. Particularly, the 7-mer DNA extension to crRNA is determined to be universal and spacer-independent for enhancing the sensitivity and specificity of LbCasl2a-mediated nucleic acid detection. With isothermal amplification of SARS-CoV-2 RNA using RT-LAMP, the modified crRNAs are incorporated in a paper-based lateral flow assay that can detect the target with up to 23 -fold higher sensitivity within 40-60 min.

[0014] Rossetti et al. (in: Enhancement of CRISPR / Cas 12a trans-cleavage activity using hairpin DNA reporters. Nucleic Acids Res. 2022 Aug 12;50(14):8377-8391. doi: 10.1093 / nar / gkac578. PMID: 35822842; PMCID: PMC9371913) report on the enhancement of trans-cleavage activity of Cast 2a enzymes using hairpin DNA sequences as FRET -based reporters. They discovered faster rate of trans-cleavage activity of Casl2a due to its improved affinity (Km) for hairpin DNA structures, and provide mechanistic insights of their findings through Molecular Dynamics simulations. Using hairpin DNA probes they significantly enhanced FRET -based signal transduction compared to the widely used linear single stranded DNA reporters. The signal transduction enables faster detection of clinically relevant double stranded DNA targets with improved sensitivity and specificity either in the presence or in the absence of an upstream pre-amplification step.

[0015] US10337051B2, US10494664B2, US10266887B2, and US20180340219A1 disclose Casl3a (C2c2) as an RNA-targeting nuclease with collateral RNase activity, systems and methods for diagnostic use.

[0016] Cas9 has also been used for DNA or RNA detection. The DNA is detected electrochemically with a tethered nuclease. RNA is detected through an approach we developed called LEOPARD in which the RNA biomarker is converted into a guide RNA that directs Cas9 to cleave a provided DNA target. In both cases, multiplexing is achieved by either tethering Cas9 with different guide RNAs (DNA detection) or introducing multiple DNA targets that can be read out separately (RNA detection).

[0017] Cas9 was also recently shown to exhibit collateral cleavage activity against some T-rich and C-rich ssDNA sequences, which allowed the detection of RNA, ssDNA and dsDNA targets (Chen, J., Chen, Y., Huang, L. et al. Trans-nutAQ SQ activity of Cas9 activated by DNA or RNA target binding. Nat Biotechnol (2024). https: / / doi.org / 10.1038 / s41587-024-02255-7).

[0018] It is an object of the present invention to provide improved and specific substrates for Cas nucleases, in particular for use in the field of molecular diagnostics. Other objects and advantages will become apparent upon further studying the present specification with reference to the accompanying examples.

[0019] In a first aspect thereof, the object of the present invention is solved by providing an artificial RNA or DNA / RNA substrate for cleaving by a nuclease selected from Casl2a2, Casl2a3 and Casl2a4 or a nuclease having at least 90%, preferably at least 95% amino acid sequence identity to a nuclease selected from Casl2a2, Casl2a3 and Casl2a4 in the presence of at least one preselected guide RNA binding to at least one target RNA, wherein said artificial RNA or RNA / DNA substrate comprises the following sequence S-Z-L-X-NCCA-Z-S

[0020] wherein S is absent or represents at least one reporter moiety that is activated or inactivated by cleaving said substrate, wherein at least one S is present,

[0021] Z is absent or is selected from a sequence of one to 300 nucleotides,

[0022] N is absent or selected from A, C, T, and U, X is absent or selected from one to five nucleotides selected from A, C, T, and U, and

[0023] L is absent or a stemloop forming sequence selected from

[0024] YGGAGAAAACUCC (SEQ ID NO: 68), YGCGGAAAACCGC (SEQ ID NO: 69), YGUGGAAAACCAC (SEQ ID NO: 70), YGGAGAAAACUCC (SEQ ID NO: 71), UGGGAAAACCCA (SEQ ID NO: 72), GGACGAAAGUCC (SEQ ID NO: 73), GGACGAAAGUCC (SEQ ID NO: 74), and GGAGGAAACUCC (SEQ ID NO: 75), wherein Y is selected from A, U, or T.

[0025] CRISPR nucleases can be applied as nucleic-acid detection tools by linking the presence of a recognized RNA or DNA sequence to the collateral cleavage of reporter nucleic acids. The inventors found that a subset of these nucleases, called Casl2a3 and Casl2a4 collaterally cleave RNA but not ssDNA or dsDNA, with a strong preference for tRNAs. Furthermore, related nucleases called Casl2a2 recognize specific collateral substrate sequences. Building on these findings and follow-on substrate screening, the inventors created a unique set of collateral nucleic acid substrates that enhance nucleic acid detection with these nucleases and enable multiplexed nucleic acid detection when paired together or with other CRISPR nucleases. These collateral substrates facilitate the use of a recently discovered set of CRISPR nucleases for molecular diagnostics.

[0026] The collateral substrates are non-obvious given the limited substrate specificity commonly observed with other CRISPR nucleases and the initial indication that Casl2a2 cleaves all RNAs.

[0027] The present invention improves the use of Casl2a2 nucleases for nucleic-acid detection by generating collateral cleavage substrates that (1) are cleaved more efficiently than standard substrates, accelerating the time-to-result, and (2) allow multiplexing with multiple Casl2a2 Casl2a3 and Casl2a4 nucleases as well as with some Cast 3 nucleases that also collaterally cleave RNA substrates.

[0028] The enhanced substrates according to the present invention are based on the discovery that different Casl2a3 nucleases specifically recognize and cleave different parts of tRNAs. This discovery allowed the inventors to create synthetic RNA substrates selectively recognized by different Casl2a2, Casl2a3 and Casl2a4 nucleases that were not cleaved by some Casl3 nucleases. The original substrate used with Casl2a2 exhibits limited cleavage activity compared to the inventive enhanced substrates, and the original substrate is cleaved by Cast 3 nucleases, preventing multiplexing.

[0029] In a second aspect thereof, the object of the present invention is solved by providing a complex comprising the substrate according to the present invention, at least one of a Casl2a2, Casl2a3 and Casl2a4 nuclease enzyme or at least one nuclease having at least 90%, preferably at least 95% amino acid sequence identity to a nuclease selected from Casl2a2, Casl2a3 and Casl2a4 and at least one preselected guide RNA binding to at least one target RNA.

[0030] In a third aspect thereof, the object of the present invention is solved by providing a method for cleaving the artificial RNA or DNA / RNA substrate according to the present invention, comprising the steps of a) providing at least one CasQ nuclease enzyme selected from Casl2a2, Casl2a3 and Casl2a4 or at least one nuclease having at least 90%, preferably at least 95% amino acid sequence identity to a nuclease selected from Casl2a2, Casl2a3 and Casl2a4, b) providing at least one preselected guide RNA, c) forming a complex between the least one CasQ nuclease enzyme and the at least one preselected guide RNA, d) binding of the complex of c) to a target RNA based on the at least one preselected guide RNA, and e) cleaving, in particularly specifically cleaving, said artificial RNA or DNA / RNA substrate by the at least one CasQ nuclease enzyme.

[0031] In a fourth aspect thereof, the object of the present invention is solved by providing a method for detecting at least one target RNA in a cell, tissue, cellular nucleus, and / or sample, said method comprising: a) providing at least one artificial RNA or DNA / RNA substrate according to the present invention in said cell, tissue, cellular nucleus, and / or sample, b) contacting said cell, tissue, cellular nucleus, and / or sample with at least one complex between at least one CasQ nuclease enzyme selected from Casl2a2, Casl2a3 and Casl2a4 or at least one nuclease having at least 90%, preferably at least 95% amino acid sequence identity to a nuclease selected from Casl2a2, Casl2a3 and Casl2a4 and at least one preselected guide RNA, wherein said at least one preselected crRNA comprises a sequence that is at least 90% complementary to the target RNA, and c) detecting a cleaving, cutting and / or nicking of said at least one artificial RNA or DNA / RNA substrate according to the present invention, wherein detecting said cleaving the at least one substrate detects said at least one target RNA in said cell, tissue, cellular nucleus and / or sample.

[0032] Preferred is the method according to the present invention, wherein two, three or four or more Cas nuclease enzymes and their preferentially cleaved substrates are combined in step b), preferably comprising additional CRISPR nucleases, such as, for example LwaCasl3a, PsmCasl3b, CcaCasl3b, orLbCasl2a .

[0033] Further preferred is the method according to the present invention, wherein the at least one target RNA comprises a nucleic acid sequence that is specific for a disease state, such as, for example, for cells selected from the group consisting of cells exhibiting a genetic disorder, cells exhibiting a proliferative disorder, such as cancer cells, immune cells that produce autoantibodies, cells infected with bacterial or viral pathogens, bacterial pathogens, protozoan pathogens, cells of microbiota, contaminating bacteria or archaea.

[0034] In a fifth aspect thereof, the object of the present invention is solved by providing the use of the substrate according to the present invention or of the complex according to the present invention for detecting at least one target RNA in a cell, tissue, cellular nucleus, and / or sample, for specifically inactivating an undesired cell or virus, or for preventing and / or treating a disease comprising diseased cells.

[0035] In a sixth aspect thereof, the object of the present invention is solved by providing a kit, comprising the substrate according to the present invention and / or the complex according to the present invention together with other materials for detecting at least one target RNA in a cell, tissue, cellular nucleus, and / or sample. In a seventh aspect thereof, the object of the present invention is solved by providing the use of the kit according to the present invention for detecting at least one target RNA in a cell, tissue, cellular nucleus, and / or sample, or for specifically inactivating an undesired cell or virus, or for preventing and / or treating a disease comprising diseased cells as herein.

[0036] The present invention generally relates to the detection of one or more specific nucleic acids in a biological or environmental sample in any setting. CRISPR nucleases have emerged as powerful tools for nucleic-acid detection by linking the recognition of an RNA orDNA sequence (i.e., the biomarker) to activation of enzymatic collateral cleavage of compatible nucleic acids. Collateral cleavage of these substrates can produce a detectable signal, such as fluorescence due to the separation of a tethered fluorophore-quencher pair, or separation of two antigens dictating the binding location on a lateral flow strip.

[0037] As mentioned herein, the detection of at least one target RNA in a cell by Casl2a3 and Casl2a4 can also lead to cleavage of tRNAs. Cleavage would halt translation and prevent cell growth, offering means to suppress bacterial and eukaryotic cells expressing the target RNA. Such a programmable approach has remained difficult in eukaryotic cells such as cells from humans, animals, and plants, with one example with Cas9 that required cleaving a highly repetitive element (e.g. Smith CJ, et al. Enabling large-scale genome editing at repetitive elements by reducing DNA nicking. Nucleic Acids Res. 2020 May 21;48(9):5183-5195. doi: 10.1093 / nar / gkaa239. PMID: 32315033; PMCID: PMC7229841) and another with Cast 3 through collateral cleavage that only partially reduced growth with highly expressed transcripts (e.g. Shi, P., Murphy, M.R., Aparicio, A.O. etal. Collateral activity of the CRISPR / RfxCasl3d system in human cells. Commun Biol 6, 334 (2023). https: / / doi.org / 10.1038 / s42003-023-04708-2). The approach could be applied to selectively eliminate undesired cells. Of the many possible examples, this approach could be applied to enrich for cells with desired genome edits by targeting the transcript encoding the unedited locus or locus with undesired edits (e.g., indels when performing homology-directed repair (HDR)), eliminate cells with oncogenic mutations, or chronically infected cells. The approach could also be applied to clear RNA and DNA viruses (e.g., SARS-CoV-2, Dengue, HCV) by inactivating tRNAs used when translating viral proteins. By not collaterally cleaving DNA, the use of Casl2a3 and Casl2a4 could avoid problematic events such as chromosomal inversions or chronothrypsis.

[0038] Using these nucleases, collateral cleavage is faster and provides a quicker read-out for a diagnostic test.

[0039] Another problem is that the collateral cleavage is generally non-specific, with almost any nucleic-acid sequence serving as a substrate. This lack of specificity means that other RNAs, such as RNAs in the sample, can distract the activated nuclease from cleaving the intended collateral substrate, resulting in a slower time-to-result.

[0040] Furthermore, the inability to separate collateral substrates when using more than one nuclease means that multiplexing in a single reaction is extremely difficult. These problems in turn limit the applicability of CRISPR nucleases for molecular diagnostics.

[0041] The combination of, for example, two Cast 3 nucleases and a Cast 2a nuclease can provide multiplexing of up to three nucleic-acid biomarkers. However, doing so requires the presence of both DNA and RNA that would normally require upstream amplification and in vitro transcription that substantially add to the time-to-result and test complexity. The approaches with Cas9 can scale well. However, DNA detection absolutely requires electrochemical detection that limits the application field. RNA detection lacks inherent signal amplification and thus absolutely requires an amplification step, such as through upstream amplification and in vitro transcription even for somewhat abundant biomarkers.

[0042] The present invention speeds up the time-to-result when using Casl2a2, Casl2a3 and Casl2a4 nucleases and allows multiplexing in the same reaction without requiring both DNA and RNA. Therefore, with the present invention, multiplexing can be performed when detecting multiple RNA biomarkers without any upstream steps without the need for complex instrumentation (or possibly any instrumentation) or the creation of separate reactions. While Casl2 and Casl3 nucleases generally exhibit non-specific collateral cleavage against any ssDNA or ssRNA substrates, exceptions have emerged in which nuclease recognized specific sequences were recognized as collateral substrates. For instance, LwaCasl3a prefers to cleave RNA sequences comprising U, and a sequence lacking a U is cleaved less efficiently. Similarly, PsmCasl3b prefers to cleave RNA sequences comprising A. Apart from boosting collateral cleavage rates, taking these preferences into account also allowed multiplexed nucleic acid detection.

[0043] In one example as disclosed herein, combining the RNA sequence UUUUU (ssRNA, for LwaCasl3a), the RNA sequence AAAAA (ssRNA, for PsmCasl3b), and the ssDNA sequence TTATT (ssDNA, for LbCasl2a) conjugated to different fluor ophore / quencher pairs allowed the separate detection of two RNA sequence and one DNA sequence in the same reaction based on the fluorescent pattern. This capability in turn allows multiplexed molecular diagnostics that can detect multiple nucleic acid biomarkers in one test. Combining these nucleases has represented the limit of multiplexed detection and requires the presence of both DNA and RNA nucleic acids, such as through the inclusion of a pre-amplification step. Otherwise, multiplexing nucleic acid detection with these nucleases remains extremely difficult due to the strong overlap in recognized collateral substrates across these nucleases.

[0044] Previously, the inventors identified Casl2a2, a Casl2a-related enzyme, as uniquely targeting RNA, thus simplifying the diagnostic process by eliminating the need for reverse transcription required by Casl2a or allowing the use of DNA collateral substrates that cannot be cleaved by Casl3a. Now, the inventors have discovered two additional subsets of the Casl2a2 family: Casl2a3 and Casl2a4. These new enzymes exhibit highly specific collateral cleavage preferences, and by understanding the rules governing this activity, the inventors could demonstrate that a Casl2a3 could be paired with two Cast 3a nucleases to achieve multiplexed RNA detection. Furthermore, multiple Casl2a2, Casl2a3, and Casl2a4 nucleases could be paired with matched collateral substrates to also achieve multiplexing. This represents a significant advancement in multiplexing and could further expand current multiplexing capabilities with CRISPR nucleases, such as four-plex detection with SHERLOCK v2 (1). The particular advantage of the present technology lies in diagnostics, particularly for applications like liquid biopsies and rapid viral detection.

[0045] Casl2a2 has been the center of only two publications in the past year, and two patent applications. The publications relate to its ability to target RNA and cleave ssRNA, ssDNA, or dsDNA as collateral targets (2), (3). The patents are two PCT applications WO 2022 / 253903A1 and WO 2023 / 240061 A2. WO 2023 / 240061 A2 discloses the use of functional variants of Casl2a2. Casl2a3 and Casl2a4 are not functional variants, but rather distinct enzymes that belong to the same family. US 2024-0218428A1 discloses a guided nuclease to detect DNA or RNA. Casl2a3 has been used in the past to insert large fragments of exogenous DNA and point mutations into the genome of Streptomyces strains with high GC contents (4).

[0046] The present invention particularly focuses on new sequences of collateral optimized substrates for Casl2a2, Casl2a3 and Casl2a4.

[0047] As mentioned above, in a first aspect thereof, the object of the present invention is solved by providing an artificial RNA or DNA / RNA substrate. This substrate is cleaved, cut and / or nicked by a nuclease selected from Casl2a2, Casl2a3 and Casl2a4 as described herein, or cleaved, cut and / or nicked by a nuclease having at least 90%, preferably at least 95% amino acid sequence identity to a nuclease selected from Casl2a2, Casl2a3 and Casl2a4 as described herein. As mentioned above, the inventors have discovered two additional sub-groups of the Casl2a2 family: Casl2a3 and Casl2a4. These new enzymes furthermore exhibit highly specific collateral cleavage preferences, and by understanding the rules governing this activity, the inventors have developed specific substrates that allow to detect up to four different RNA biomarkers in a single reaction.

[0048] The substrate is cleaved, cut and / or nicked by the nuclease(s) in the presence of at least one preselected guide RNA as described herein binding to at least one target RNA as also described herein.

[0049] The artificial RNA or RNA / DNA substrate (i.e. comprising RNA and optionally also DNA nucleotides) comprises the following general sequence S-Z-L-X-NCCA-Z-S (formula I), wherein S is absent or represents at least one reporter moiety that is activated or inactivated by cleaving said substrate, and wherein at least one S must be present. Z is absent or is selected from a sequence of one to 300 nucleotides, N is absent or selected from A, C, T, and U, X is absent or selected from one to five nucleotides selected from A, C, T, and U. L is absent or comprises or is a stemloop forming sequence selected from YGGAGAAAACUCC (SEQ ID NO: 68), YGCGGAAAACCGC (SEQ ID NO: 69), YGUGGAAAACCAC (SEQ ID NO: 70), YGGAGAAAACUCC (SEQ ID NO: 71), UGGGAAAACCCA (SEQ ID NO: 72), GGACGAAAGUCC (SEQ ID NO: 73), GGACGAAAGUCC (SEQ ID NO: 74), and GGAGGAAACUCC (SEQ ID NO: 75), wherein Y is absent or selected from A, U, or T. Preferred is the combination of the sequence “NCCA” and the stemloop, see, for example, Figure 14-16.

[0050] The inventors found that the subset of Casl2a3 and Casl2a4 selectively only cleave RNA and particularly tRNAs as collateral substrates. Furthermore, the nucleases Casl2a2 also recognize specific collateral substrate sequences. Building on these findings and follow-on substrate screening, the inventors created a unique set of collateral nucleic acid substrates that enhance nucleic acid detection with these nucleases and enable multiplexed nucleic acid detection when paired together or with other CRISPR nucleases.

[0051] Preferred is the substrate according to the present invention, wherein the substrate has a length of between about 5 and 500 nucleotides, preferably of between about 20 and 200, and more preferably of between about 70 and 100 nucleotides. tRNAs are the smallest of the three types of RNA, with a length between 75 and 95 nucleotides. Therefore, most preferred are substrates with a length of between about 75 and 95 nucleotides. Most preferred is the substrate according to the present invention, wherein said substrate is a modified tRNA molecule. This can comprise a part of a naturally occurring tRNA that has been modified to constitute the substrate as disclosed herein, for example by adding reporters and / or modified bases or a transcribed version lacking some or all RNA modifications.

[0052] Although smaller, also preferred is the substrate according to the present invention, selected from S-UGGAGAAAACUCCACCA-S (r49, SEQ ID NO: 76), S-UGCGGAAAACCGCUCCA-S (r51, SEQ ID NO: 77), S-UGUGGAAAACCACCCCA- S (r52, SEQ ID NO: 78), S-AGGAGAAAACUCCACCA-S (r53, SEQ ID NO: 79), S-UGGGAAAACCCAGCCA-S (r55, SEQ ID NO: 80), S-GGAGGAAACUCCACCA-S (r57, SEQ ID NO: 81), S-GGACGAAAGUCCCCCA-S (r60, SEQ ID NO: 82), and S-GGAGGAAACUCCCCCA-S (r63, SEQ ID NO: 83). These substrates were efficiently tested in the context of the present invention. Particularly preferred is the substrate according to the present invention, wherein at least the stemloop forming sequence comprises DNA and RNA nucleotides, see, for example, Figure 15, molecule r60.

[0053] In general, any suitable at least one reporter moiety that is activated or inactivated by cleaving, cutting or nicking of the substrate can be used. As mentioned above, at least one S moiety must be present, but the substrate may have more than two reporters. Preferred is the substrate according to any the present invention, wherein S is selected from a nanoparticle, an antigen binding group or a fluorescent group and a quencher and / or is an extension comprising another chemical modification, such as another fluorophore, antigen (e.g., DNP, FITC) or biotin, additional nucleic acid sequences, such as uncleavable tags with phosphorothioate or other backbone modifications, or DNA. In another preferred aspect, the position of the fluorophore and quencher is changed, as it was found that swapping locations (i.e. switching from 5’-F-xxx-Q-3’ to 5’-Q-xxx-F-3’ with F being the fluorophore, and Q being the quencher, and xxx denoting the sequence and cleavage site in between) allowed for increased cleavage by BalCasl2a3.

[0054] In another preferred aspect, the substrate according to the present invention has the reporter group(s) placed internally in the molecule, for example attached to bases or the phosphate backbone or the like, as long as the reporter moiety is active before and / or after cleaving, cutting or nicking of the substrate, for example when being positioned closely on opposite sides of the cleavage site of the substrate, in particular in the case of fluorescent group and quencher.

[0055] As also mentioned above, in a second aspect thereof, the object of the present invention is solved by providing a complex comprising the substrate according to the present invention, at least one of a Casl2a2, Casl2a3 and Casl2a4 nuclease enzyme or at least one nuclease having at least 90%, preferably at least 95% amino acid sequence identity to a nuclease selected from Casl2a2, Casl2a3 and Casl2a4 and at least one preselected guide RNA binding to at least one target RNA.

[0056] Therefore, the first part of the complex is the substrate according to the present invention as described above and herein. Furthermore, the complex comprises at least one Casl2a2, Casl2a3 and Casl2a4 nuclease enzyme or at least one nuclease having at least 90%, preferably at least 95% amino acid sequence identity to a nuclease selected from Casl2a2, Casl2a3 and Casl2a4.

[0057] Zetsche B, et al. (in: Cpfl is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell. 2015 Oct 22;163(3):759-71. doi: 10.1016 / j .cell.2015.09.038. Epub 2015 Sep 25. PMID: 26422227; PMCID: PMC4638220) report characterization of Cpfl, a putative class 2 CRISPR effector. They demonstrate that Cpfl mediates robust DNA interference with features distinct from Cas9. Cpfl is a single RNA-guided endonuclease lacking tracrRNA, and it utilizes a T-rich protospacer-adjacent motif. Moreover, Cpfl cleaves DNA via a staggered DNA double-stranded break. Out of 16 Cpfl -family proteins, they identified two candidate enzymes from Acidaminococcus and Lachnospiraceae with efficient genome-editing activity in human cells. A CasQ enzyme is disclosed from Sulfuricurvum_sp_PC08-66.

[0058] Begemann, M.B., et al. (in: Characterization and validation of a novel group of Type V, Class 2 nucleases for in vivo genome editing. 2017. bioRxiv, pp.1-9) present some evidence of enzymes and genome editing in plants. According to the results as produced in the context of the present inventors, it seems that the genomic deletions as observed were not due to DNA targeting, but rather resulted from the purifying selection in response to RNA targeting.

[0059] Makarova, K.S., et al. (in: Classification and Nomenclature of CRISPR-Cas Systems: Where from Here? 2018. The CRISPR journal, 1(5), pp.325-336) disclose a CasQ from the Sm clade (KFO67988.1) as a Casl2a variant, which was grouped with two other nucleases that seem not to be CasQ. Aliaga Goltsman, D.S. et al. (in: Novel Type V-A CRISPR Effectors Are Active Nucleases with Expanded Targeting Capabilities. 2020. The CRISPR journal, 3(6), pp.454-461) classified a number of CasQ nucleases from the Sm clade as Casl2a, namely Casl2a-M60-3, Casl2a-M60-l, Casl2a-M60-8, Casl2a-M60-9, Casl2a-M26-5, Casl2a-M26-14, and Casl2a-M26-15. However, none of these were experimentally characterized.

[0060] In the context of the present invention, the terms “Casl2a2 nuclease”, “Casl2a3 nuclease” or “Casl2a4 nuclease” or sometimes jointly designated as “Cas “ shall first include the enzymes according to SEQ ID NOs: 1 to 67 and 105 to 159 according to the following tables 1 and 2.

[0061] Table 1: Nuclease enzymes as used in the present invention

[0062]

[0063]

[0064]

[0065]

[0066]

[0067] Table 2 shows the names of the nucleases as disclosed herein

[0068]

[0069]

[0070]

[0071] The terms as above shall furthermore include functional fragments of these nucleases, in particular amino acid sequences that have N- and / or C-terminal deletions or constitute fusion proteins with other polypeptides. Alternatively, the Casl2a2, a3 or a4 polypeptide can be circularly permuted or truncated to remove domains that are not essential for the function of the protein, i.e., preferably the RNA-dependent nuclease activity. Fusion proteins are provided herein comprising a Casl2a2, a3 or a4 polypeptide, or a fragment or variant thereof, and an effector domain. The Casl2a2, a3 or a4 polypeptide can be directed to a target site by a guide RNA, at which site the effector domain can modify or affect the targeted nucleic acid sequence. The effector domain can be a cleavage domain, an RNA modifying domain, a translational activation domain, a translational repressor domain, a processing / splicing factor, a domain affecting RNA localization, or a domain that recruits proteins affecting any of these functions. The fusion protein can further comprise at least one additional domain chosen from a nuclear localization signal, nuclear export signal, plastid signal peptide, mitochondrial signal peptide, signal peptide capable of protein trafficking to multiple subcellular locations, a cell-penetrating domain, an affinity domain, or a marker domain, any of which can be located at the N-terminus, C-terminus, or an internal location of the fusion protein. The Casl2a2, a3 or a4 polypeptide can be located at the N-terminus, the C-terminus, or in an internal location of the fusion protein. The Casl2a2, a3 or a4 polypeptide can be directly fused to the effector domain or can be fused with a linker. In specific embodiments, the linker sequence fusing the Casl2a2, a3 or a4 polypeptide with the effector domain can be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, or 50 amino acids in length. For example, the linker can range from 1-5, 1-10, 1-20, 1-50, 2-3, 3-10, 3-20, 5-20, or 10-50 amino acids in length. The Casl2a2, a3 or a4 polypeptide can also recruit the effector through a binding domain.

[0072] In addition to the herein described more 90% or even more than 95% identity, the terms “Casl2a2 nuclease”, “Casl2a3 nuclease” or “Casl2a4 nuclease” or sometimes jointly designated as “Cas “ shall furthermore include nuclease enzymes having at least 50%, preferably at least 70, more preferably at least 80%, more preferably at least 90%, and more preferably at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs: 1 to 67 and having substrate specific RNA-dependent Casl2a2, a3 or a4 nuclease activity, i.e. exclusively, specifically and / or essentially cleaving the specific substrate or tRNAs as disclosed herein.

[0073] The nucleases may further comprise at least one of a nuclear localization signal (NLS), a purification tag or an affinity tag, like His tags, Connectase tags, or biotin.

[0074] The polypeptide of the Casl2a2, a3, or a4 nuclease can be provided depending on the use as intended, e.g., in vivo or in vitro, and is synthetically produced, generated by in vitro transcription, and / or cloned into a plasmid. The enzyme may be provided as purified or essentially purified isolated enzyme preparation. Complexes according to the present invention may also be prepared by a mixture of Casl2a2, a3, or a4 and even other nucleases, e.g., two or three or more nucleases or the fragments thereof as described.

[0075] The complex according to the present invention then comprises at least one preselected guide RNA designed for binding and / or binding, such as specifically binding, to at least one target RNA. The target RNA sequence is preferably flanked on the 3' end by a recognized PFS. PFS sequences can include A-rich sequences, where purines in positions 2 and 4 seem to be important, such as GAAAG, GAGAC, GAGAA, UGGAG, GGAGA, AGAAU, GAAUA, CCAGA, CAGAG, UGAGC, and GAGAG. Specific or preferred sequences can be readily determined through standard in vitro and in vivo approaches in the field. Successful binding and recognition of the target RNA provides the signal that then leads to cleaving, cutting or nicking the collateral substrate according to the present invention. Successful binding and recognition of the target RNA may also provide the signal that then leads to cleaving, cutting or nicking an undesired tRNA as described below.

[0076] Certain portions of the nucleic acid molecules as used in the substrate, complex and methods according to the present invention are found and / or designed to specifically hybridize with complementary portions in other molecules. As known to the person of skill, for this, the hybridization and washing conditions are critical. If the sequences are 100% complementary, then a high stringency hybridization may be carried out. Nevertheless, according to the invention, the portions that hybridize and / or specifically hybridize are complementary to at least 80%, preferably complementary to more than 90%, more preferably to more than 95%, and most preferably are 100% complementary. The stringency of hybridization is determined by the hybridization temperature and the salt concentration in the hybridization buffer, and high temperature and low salt is more stringent. A commonly used washing solution is SSC (Saline Sodium Citrate, a mixture of NaCitrate and NaCl). Hybridization may be carried out in solution or - more commonly - at least one component may be on a solid-phase support, e.g., nitrocellulose paper. Frequently used protocols employ a blocking reagent, such as casein from nonfat dried milk or bovine serum albumin, often in combination with denatured, fragmented salmon sperm DNA (or any other heterologous DNA of high complexity) and a detergent, such as SDS. Often a very high concentration of SDS is used as a blocking agent. Temperatures may be between 42 and 65 °C or higher, and buffers may be 3 * SSC, 25 mA / HEPES, pH 7.0, 0.25% SDS final.

[0077] Preferred is a complex according to the present invention, wherein said portion of the said preselected guide RNA designed for binding to at least one target RNA specifically hybridizes with the target RNA with 15 or more nucleotides, preferably with 18 and more nucleotides, and more preferred with about 20 nucleotides or more. Preferred ranges are between 15 and 30 nucleotides, more preferred 18 to 25 nucleotides, and most preferred 20 to 24 nucleotides. Extensions to the hybridizing portions in the complex (3' of the guide), are possible, and provide the advantage of a more stable formation of the complex.

[0078] Further preferred is a complex according to the present invention, wherein the target RNA comprises a PFS (see above). In a preferred embodiment of the complex according to the present invention, the Cas nuclease can be modified in order to recognize a broader panel of PFS sites, e.g., by replacing the key region in the PFS-interacting (PI) domain of Cas with the corresponding region in a panel of related Cas orthologs (see for example, for Cas9, Ma et al., Engineer chimeric Cas9 to expand PAM recognition based on evolutionary information. Nat Commun. 2019 Feb 4;10(l):560. doi: 10.1038 / s41467-019-08395-8). The PFS specificity can also be changed through rational engineering of the Cas nuclease or through mutagenesis and screening. This broadens the possible RNA targets in cells. Preferred is the complex according to the present invention, wherein said guide RNA comprises a sequence selected to be specific for a bacterium, a sequence selected to be specific for a virus, a sequence selected to be specific for a fungus, a sequence selected to be specific for a protozoan, a sequence selected to be specific for a genetic disorder, a sequence selected to be specific for a proliferative disorder, or a sequence connected to pharmacogenomics. Usually, said sequence is a complement or partial complement to the above target RNA.

[0079] The guide RNA can be further designed to detect individual mismatches such as singlenucleotide polymorphisms (SNPs) or single-nucleotide variations (SNVs) within the target RNA or PFS. The single mismatch may be sufficient to prevent suitable activation of the nuclease. The guide RNA sequence can also be modified to introduce one or more artificial mismatches between the guide and target, such that the additional mismatch present in the target RNA prevents suitable activation of the nuclease.

[0080] The guide RNA can be further modified, preferably in order to introduce enhanced or new functionalities. For example, the 5’ and / or 3’ end of the guide RNA can be extended to be perfectly complementary to the target RNA, creating a dsRNA that can be edited with RNA-modifying enzymes (e.g., ADARs). The structure of the conserved Casl2a handle motif 5’ to the guide motif can be modified in order to stabilize the recognized hairpin structure or to promote binding by Casl2a. The 5' and / or 3' end of the guide RNA can be extended to further incorporate aptamer sequences. These aptamers can then recognize peptide or protein ligands fused to effector domains as used. Aptamers and their applications are well known in the art (see, for example, Rabiee N, Ahmadi S, Arab Z, Bagherzadeh M, Safarkhani M, Nasseri B, Rabiee M, Tahriri M, Webster TJ, Tayebi L. Aptamer Hybrid Nanocomplexes as Targeting Components for Antibiotic / Gene Delivery Systems and Diagnostics: AReview. Int J Nanomedicine. 2020 Jun 17;15:4237-4256. doi: 10.2147 / IJN.S248736. PMID: 32606675; PMCID: PMC7314593).

[0081] Another aspect of the present invention then relates to a method for cleaving the artificial RNA or DNA / RNA substrate according to the present invention, comprising the steps of a) providing at least one CasQ nuclease enzyme selected from Casl2a2, Casl2a3 and Casl2a4 or at least one nuclease having at least 90%, preferably at least 95% amino acid sequence identity to a nuclease selected from Casl2a2, Casl2a3 and Casl2a4, b) providing at least one preselected guide RNA, c) forming a complex between the least one CasQ nuclease enzyme and the at least one preselected guide RNA, d) binding of the complex of c) to a target RNA based on the at least one preselected guide RNA, and e) cleaving, in particularly specifically cleaving, said artificial RNA or DNA / RNA substrate by the at least one CasQ nuclease enzyme. The components used in this method are generally the same as described above for both the substrate and the complex.

[0082] Another aspect of the present invention then relates to a method for detecting at least one target RNA in a cell, tissue, cellular nucleus, and / or sample, said method comprising: a) providing at least one artificial RNA or DNA / RNA collateral substrate according to the present invention in said cell, tissue, cellular nucleus, and / or sample,

[0083] b) contacting said cell, tissue, cellular nucleus, and / or sample with at least one complex between at least one CasQ nuclease enzyme selected from Casl2a2, Casl2a3 and Casl2a4 or at least one nuclease having at least 90%, preferably at least 95% amino acid sequence identity to a nuclease selected from Casl2a2, Casl2a3 and Casl2a4 and at least one preselected guide RNA, wherein said at least one preselected guide RNA comprises a sequence that is at least 90% complementary to the target RNA, and

[0084] c) detecting a cleaving, cutting and / or nicking of said at least one artificial RNA or DNA / RNA substrate according to the present invention, wherein detecting said cleaving the at least one substrate detects said at least one target RNA in said cell, tissue, cellular nucleus and / or sample. The components used in this method are also generally the same as described above for both the substrate and the complex.

[0085] Therefore, in the methods according to the present invention the complex as formed between the least one Casl2a2 a3 and / or a4 nuclease enzyme and the at least one preselected guide RNA as above is bound to the target RNA based on the sequence as designed for the preselected guide RNA as mentioned above. The CasQ enzymes bind target nucleic acid independently of their ability to cleave the substrate, and this flexibility is used in order to bind said at least one target RNA.

[0086] The guide RNA comprises at a minimum a repeat sequence and a downstream guide sequence. The repeat sequence is a full-length or partially or fully processed version of the native repeat associated with CRISPR arrays associated with Cast 2a, Casl2a2, Casl2a3, or Casl2a4 nucleases. The repeat sequence can be modified as long as the pseudoknot recognized by the nuclease can form. The guide sequence can be selected to be specific for a bacterium, a sequence selected to be specific for a virus, a sequence selected to be specific for a fungus, a sequence selected to be specific for a protozoan, a sequence selected to be specific for a genetic disorder, and a sequence selected to be specific for a proliferative disorder.

[0087] In the context of the present invention, a target RNA is any RNA of interest to be used as a trigger to cause cleaving and / or to be detected using the methods according to the present invention. Usually and preferably, the target RNA is a single-stranded RNA molecule, but also structured RNA molecules, such as a messenger RNA, ribosomal RNAs, transfer RNAs, small RNAs, antisense RNAs, small nucleolar RNAs, microRNAs, piwiRNAs, long non-coding RNAs, spliced introns, and circular RNAs. The RNA can be of natural origin or artificially produced. The single stranded sensed RNA can be from a human cell, an animal cell, a plant cell, a cancerous cell, an infected cell, or a diseased cell, and / or can be derived from a virus, a parasite, a helminth, a fungus, a protozoan, a bacterium, or a pathogenic bacterium. The target RNA comprises a sequence that specifically hybridizes with a portion of the (non-naturally occurring) guide RNA as generated and used in the methods of the present invention. The at least one target RNA may be a mutated target RNA comprising at least one mutation compared to a control target RNA.

[0088] The target RNA can also be an RNA that has been transcribed from a DNA before it is used in the methods according to the present invention, and therefore detecting this transcribed RNA ultimately detects the DNA that formed the template for the transcription. In this embodiment, therefore, the method “detects” an “original” target DNA.

[0089] The at least one Casl2a2, a3 or a4 nuclease enzyme is then cleaving (i.e., cutting, cleaving and / or nicking) the collateral substrate molecule, which then can be suitably detected, wherein detecting said cleaving the at least one substrate detects said at least one target RNA in said cell, tissue, cellular nucleus and / or sample. Detecting said cleaving, cutting and / or nicking of the at least one reporter nucleic acid may comprise detecting a change in the signal of the suitable reporter, such as a nanoparticle, antigen binder, dye, a fluorophore, change in electrical conductivity, change in size, and / or detecting the said cleaved at least one substrate fragment itself.

[0090] The 5' and 3' end of the cleaved substrate can be extended with other chemical modifications (e.g., other fhiorophores, antigens, biotin) and nucleic acid sequences (e.g., uncleavable tags with phosphorothioate or other backbone modifications or with DNA if not using Casl2a2). The uncleavable nucleic acid sequences allow detection through hybridization to complementary nucleic acids, such as on a lateral flow strip or with an electrochemical sensor. The extensions could also allow in vitro transcription when cleaved, which can produce the same RNA target or a separate RNA target recognized by other nucleases present in the reaction.

[0091] The cleaved collateral substrates can also activate accessory nucleases (e.g., Csm6, Cadi) that can collaterally cleave the same or other collateral substrates, thereby enhancing the output signal. The cleaved collateral substrates could also release a sequestered nucleic acid, such as a guide RNA used by another Cas nuclease or a target RNA or DNA sequence.

[0092] Collateral cleavage of these substrates can then be detected through different means, such as separation of a conjugated fluorophore and quencher, release of a methylene blue tag from a gold electrochemical sensor, and separation of two antigens that bind to antibodies on a test line and gold nanoparticles on a lateral flow strip, to name a few. Cleavage of these substrates can drive further signal amplification, such as allowing release or in vitro transcription of additional RNA targets or activating accessory proteins harboring their own collateral activities against nucleic acids and proteins. The nucleic acid target can also be amplified (e.g., by PCR, RPA, LAMP, NASBA) and converted between RNA and DNA using reverse transcriptases and / or in vitro transcription. In any of these scenarios, these Cas nucleases can achieve highly sensitive detection of specific nucleic acid sequences, with single-base discrimination in some cases. The methods according to the present invention can be performed in vivo or in vitro, for example in an organism, a cell, tissue, and / or part thereof, like a nucleus, or in an in vitro assay, like a diagnostic assay.

[0093] Another important aspect of the method according to the present invention is multiplexing, as described herein. Preferred is therefore the method according to the present invention, wherein two, three or four or more Cas nuclease enzymes and their preferentially cleaved substrates are combined in step b), preferably comprising additional Cas nucleases, such as, for example LwaCasl3a, PsmCasl3b, CcaCasl3b, or LbCasl2a.

[0094] Another important aspect of the present invention is the diagnostic use of the complex and methods of the present invention.

[0095] When applying the respective complementarity and assay conditions, the present method can be used in order to detect mutations in the target RNA, but also RNAs that are undesired, present at a higher level in the cell or sample, and / or are foreign, such as, for example, from a human cell, an animal cell, a plant cell, a cancerous cell, an infected cell, or a diseased cell, and / or can be derived from a virus, a parasite, a helminth, a fungus, a protozoan, a bacterium, a pathogenic bacterium, or a non-natural genetic modification.

[0096] In a preferred embodiment of the methods according to the present invention, said at least one target RNA, in particular a tRNA, is derived from a virus selected from Zika virus, human immunodeficiency virus (HIV), hepatitis B virus, hepatitis C virus, herpes virus, coronavirus, influenza, herpes simplex virus I, herpes simplex virus II, papillomavirus, rabies virus, cytomegalovirus, human serum parvo-like virus, respiratory syncytial virus, varicella-zoster virus, measles virus, adenovirus, human T-cell leukemia viruses, Epstein-Barr virus, murine leukemia virus, mumps virus, vesicular stomatitis virus, Sindbis virus, lymphocytic choriomeningitis virus, wart virus, blue tongue virus, Sendai virus, feline leukemia virus, reovirus, polio virus, simian virus 40, mouse mammary tumor virus, dengue virus, rubella virus, west Nile virus, coronavirus, yellow fever virus, and African swine fever virus. In a preferred embodiment of the methods according to the present invention, said at least one target RNA is derived from a pathogenic bacterium selected from Mycobacterium tuberculosis, Streptococcus agalactiae, methicillin-resistant Staphylococcus aureus, Legionella pneumophila, Streptococcus pyogenes, Escherichia coli, Neisseria gonorrhoeae, Neisseria meningitidis, Pneumococcus, Cryptococcus neoformans, Treponema pallidum, Lyme disease spirochetes, Pseudomonas aeruginosa, Mycobacterium leprae, and Brucella abortus.

[0097] Preferred is the method according to the present invention, wherein the at least one target RNA is a mutated target RNA comprising at least one mutation compared to a control target RNA. The mutation could encode a functional or physiological change, such as a pathogenic SNP, a mutation conferring antibiotic resistance or enhanced virulence, a viral variant, or a mutation altering an enzyme that affects drug activity.

[0098] In a preferred embodiment of the methods according to the present invention, the at least one target RNA is derived from a gene the transcription and / or expression thereof is modified in response to external factors, such as, for example, metabolic factors or signals, hormones, pathogens, toxins, drugs, ageing and / or biotic or abiotic stress.

[0099] In a preferred embodiment of the methods according to the present invention, the target RNAs are selected to be environment, species, strain, disease, cell- and / or tissue specific. In this aspect, the methods of the invention help to identify and / or to group cells or organisms based on the target RNAs as selected. The at least one target RNA, in particular a tRNA, is preferably related to a condition selected from a viral infection, such as, for example, coronavirus infection, infection with a pathogen, a metabolic disease, cancer, neurodegenerative diseases, ageing, a drug, and biotic or abiotic stress.

[0100] In a further preferred embodiment of the methods according to the present invention, the at least one target RNA can be added to said cell, tissue and / or sample prior to step a), and / or wherein said method further comprises at least one step selected from in vitro transcription of DNA into RNA, reverse transcription of RNA into DNA, and - optimally - subsequent in vitro transcription of said DNA into RNA. This can be done in order to provide suitable or desired signal amplification. Usually, the target RNA in said cell, tissue or sample is present in a range of from about 500 fM to about 1 uM, e.g., from about 500 fM to about 1 nM, preferably is present in a range of from about 1 pM to about 1 nM. Optimally, the method can detect a single molecule per cell, tissue and / or sample.

[0101] Given the broad applicability of sequence-specific RNA recognition triggering DNA degradation, Casl2a2 nucleases provide several advantages. The COVID-19 pandemic has highlighted the need for inexpensive and rapid diagnostics that can detect even singlenucleotide differences. Even after the pandemic subsides, society will be more aware of the benefits of diagnostics and accepting of their use in everyday settings (e.g., the airport). CasQ nucleases recognize a specific RNA target sequence, leading to degradation of the substrate as herein. The readout can be fluorescent (e.g., cleaving a reporter fused to a fhiorophore and a quencher) or colorimetric (e.g., release of a nanoparticle as part of a lateral flow assay). The sequence-specificity of CasQ nucleases can allow the diagnostic assay to differentiate even a single-nucleotide change, in a target RNA such as those associated with viral, in particular SARS-CoV-2, variants. Current CRISPR technologies based on Cast 2a or Cast 3 rely on recognition of dsDNA or ssRNA targets, triggering collateral cleavage of ssDNA or ssRNA reporters.

[0102] There are other standard diagnostic technologies, such as PCR and LAMP. Examples for preferred in vitro diagnostic formats for methods of the present invention are lateral flow assays. Lateral flow assays are known to the person of skill, and operate on the same principles as enzyme-linked immunosorbent assays (ELISA). In essence, these tests run the liquid sample along the surface of a pad with reactive molecules that show a visual positive or negative result.

[0103] In the context of the present invention, a sample shall mean any suitable biological sample that comprises or is suspected to comprise at least one target RNA to be detected as described herein. Liquid samples are preferred, such as samples derived from blood or plasma or derived from cells or tissues. In a preferred embodiment of the methods according to the present invention, said method is performed in vivo, for example in a cell, tissue or in a bacterium, fungus, plant or animal, or in vitro, in a sample. The sample can be a solid or liquid sample, and can be selected from a sample comprising cells, and an acellular in vitro sample. The cells are preferably plant cells or animal cells, such as mammalian cells, preferably human cells. The sample can be a biological sample, preferably obtained from a tissue sample, saliva, blood, plasma, sera, stool, urine, sputum, mucous, lymph, synovial fluid, cerebrospinal fluid, ascites, pleural effusion, seroma, pus, or swab of skin or a mucosal membrane surface. In one aspect, the cells, tissues and / or samples can be crude samples and / or wherein the one or more nucleic acid molecules are not purified or amplified from the sample prior to application of the methods. In another aspect, the cells, tissues and / or samples can be purified or partially purified (enriched) samples and / or the one or more nucleic acid molecules are purified or amplified from the sample prior to application of the methods. In another aspect, the cells can be part of an environmental sample such as air, a natural body of water (e.g., river, lake, ocean), wastewater, or soil.

[0104] The methods according to the present invention can be partially or fully automated, e.g., performed fully or in part by robots. The methods according to the present invention can involve the use of computers and respective databases for performing and / or analysis of the results as obtained.

[0105] In another aspect of the methods according to the present invention, said methods, at least in part, comprise a quantitative analysis. Preferred is therefore a step comprising detecting the amount of the nucleic acid as cleaved in said sample, tissue and / or cell. Preferably the amount per sample, tissue and / or cell is determined, when compared to a control. Quantification assays are known to the person of skill, and may include absorbance (e.g., UV, spectrophotometry) and / or fluorescence assays, and real-time PCR. The assays can quantify the amount(s) and / or ratios of the nucleic acid(s) as quantified as a single value (e.g., as the result or at the “end” of the assay as used) or can monitor changes over time in the nucleic acids, i.e., preferably further comprising detecting a change in the amount of said cleaved nucleic acid(s), in particular when compared to a control.

[0106] In yet another aspect of the methods according to the present invention, multiple labels and / or markers are used. Markers can be used both for the nucleic acid molecules that form part of the assays, as well as the protein components (e.g., nuclease and / or fusions). Labels and markers can be included into the components of the assays (in particular the nucleic acids and / or the proteins), as well as constitute moieties that are attached, either covalently or non-covalently.

[0107] Another aspect of the present invention relates to the use of the substrate according to the present invention or of the complex according to the present invention for detecting at least one target RNA in a cell, tissue, cellular nucleus, and / or sample, or, preferably without the substrate, for specifically inactivating an undesired cell or virus, or for preventing and / or treating a disease comprising diseased cells as described herein.

[0108] Preferred is the use according to the present invention, wherein said detection is in a multiplex format, preferably also using other CRISPR nucleases and their preferentially cleaved substrates, such as, for example LwaCasl3a, PsmCasl3b, CcaCasl3b, or LbCasl2a.

[0109] Another aspect of the present invention relates to the use of the Casl2a3 and Casl2a4 enzymes in biotechnology and medicine. As mentioned above, the inventors found that Casl2a3 and Casl2a4 collaterally cleave RNA, and Casl2a3 even selectively cleaves tRNAs as collateral substrates. These properties can be used in order to control and / or to inactivate tRNAs in vitro or in vivo, i.e. in a cell or tissue. As an example, Figure 5 illustrates the change in the size of total tRNA purified from E. coli in the presence of BalCasl2a3, Sm3Casl2a3, and ca23Casl2a3 proteins, target RNA, and complementary guide RNA. The tRNA was labeled with a fluorophore at the 5' end to allow detection of size changes during the degradation process. The change in migration patterns observed in gel electrophoresis demonstrates that these nucleases cleave the tRNA at a short sequence near the 3' end. Figures 9-13 further show that BalCasl2a3 can cleave multiple tRNAs at this general location. This cleavage event would release the attached amino group, preventing this tRNA from being used in translation. By cleaving upstream of the discriminator base, the tRNA could not be extended and restored by endogenous enzymes. By inactivating a sufficient pool of tRNAs, translation would be inhibited in the cell, preventing normal cellular function and growth. As support, Figure 20 shows that the tested Casl2a3 and Casl2a4 nuclease could halt cell growth, while Figure 23 shows that the SOS response indicative of dsDNA cleavage is not induced. Furthermore, Figure 21 shows that GFP is silenced by Sm3Casl2a3 and ApCasl2a4 when targeting a separate transcript, even though cleavage is specific to tRNAs and should not collaterally cleave the GFP transcript. These results all indicate that Casl2a3 and Casl2a4 halt cellular growth through the cleavage of RNAs essential for transcription or translation, with tRNAs as the primary target driving this cellular response. As eukaryotic cells similarly rely on tRNAs for translation and do not modify the acceptor stem, halting cellular growth in bacteria would be expected to be extended also to eukaryotic cells.

[0110] Therefore, the present invention further relates to a method for cleaving, in particular specifically cleaving, a tRNA molecule, comprising the steps of a) providing at least one Casl2a3 and / or Casl2a4 nuclease enzyme as described herein, b) providing at least one preselected guide RNA, c) forming a complex between the least one Casl2a2, Casl2a3 and Casl2a4 nuclease enzyme and the at least one preselected guide RNA, d) binding of the complex of c) to a target RNA sequence based on the at least one preselected guide RNA, and e) cleaving, in particular specifically cleaving, said tRNA by the at least one Casl2a3 and / or Casl2a4 nuclease enzyme.

[0111] According to the method according to the present invention the guide portion of the guide RNA is preselected / can be designed to target a target RNA sequence flanked by a PFS. Recognition of this target RNA is what activates collateral tRNA cleavage activity.

[0112] Because of the selectivity thereof, the use of the Casl2a3 nuclease enzyme as described is preferred in these methods.

[0113] The guide RNA comprises a sequence selected to be specific for an RNA in a bacterium, a sequence selected to be specific for an RNA in a virus, a sequence selected to be specific for an RNA in a fungus, a sequence selected to be specific for an RNA in a protozoan, a sequence selected to be specific for an RNA in a eukaryotic cell, a sequence selected to be specific for an RNA in an infected cell, a sequence selected to be specific for an RNA in a cancerous cell, a sequence selected to be specific for an RNA in a senescent cell, or sequences selected to be specific for cells selected from the group consisting of cells exhibiting a genetic disorder, cells exhibiting a proliferative disorder, such as cancer cells, immune cells that produce autoantibodies, cells infected with bacterial or viral pathogens, bacterial pathogens, protozoan pathogens, cells of microbiota, and contaminating bacteria or archaea, and the like.

[0114] Consequently, the target tRNA that is cleaved can be from a bacterial cell, a human cell, an animal cell, a plant cell, a cancerous cell, an infected cell, or a diseased cell, and / or can be derived from a virus, a parasite, a helminth, a fungus, a protozoan, a bacterium, or a pathogenic bacterium. The tRNA can also be a 1 Int tRNA mimic or a 26nt duplex tRNA mimic as described herein, or a modified (see above) derivative thereof.

[0115] Another aspect of the present invention relates to a method for specifically inactivating an undesired cell or virus, comprising contacting said cell or virus with a complex between the least one Casl2a2, Casl2a3 and Casl2a4 nuclease enzyme as described herein and at least one preselected guide RNA, binding of the complex to a target RNA based on the at least one preselected guide RNA, and collaterally cleaving at least one tRNA by at least one Casl2a2, Casl2a3 and Casl2a4 nuclease enzyme, wherein said guide RNA is preferably specifically selected for a target RNA that is specific for said undesired cell or virus to be inactivated.

[0116] Another aspect of the present invention relates to a method for preventing and / or treating a disease comprising diseased cells, such as for example, an infection and / or genetic disorder, such as a proliferative disorder, such as cancer, fungal, protozoan, bacterial and / or viral infections, an autoimmune disease, or disease-related senescent cells in a subject, comprising administering to the subject an effective amount of a complex between the least one Casl2a2, Casl2a3 and Casl2a4 nuclease enzyme as described herein and at least one preselected guide RNA wherein said guide RNA is specifically selected for an RNA of a virus, bacterium or diseased cell, the method preferably comprising collaterally cleaving at least one tRNA by at least one Casl2a2, Casl2a3 and Casl2a4 nuclease enzyme in the diseased cell or pathogen.

[0117] Another aspect of the present invention relates to an effective amount of a complex between the least one Casl2a2, Casl2a3 and Casl2a4 nuclease enzyme as described herein and at least one preselected guide RNA wherein said guide RNA is specifically selected for an RNA of said diseased cells for use in preventing and / or treating a disease comprising diseased cells, such as for example, an infection and / or genetic disorder, such as a proliferative disorder, such as cancer, fungal, protozoan, bacterial and / or viral infections, an autoimmune disease, or disease-related senescent cells in a subject, the method preferably comprising collaterally cleaving at least one tRNA by at least one Casl2a2, Casl2a3 and Casl2a4 nuclease enzyme in the diseased cell or pathogen.

[0118] The present invention can be used for sequence-specific cell killing through tRNA inactivation. There are numerous applications where killing a cell in a sequence-specific manner is desirable. Specific examples are selective killing of cancer cells, immune cells that produce autoantibodies, cells infected with bacterial or viral pathogens, bacterial pathogens, or contaminating bacteria or archaea in an industrial culture. Target RNA recognition in the nucleus (e.g., using Casl2a2, Casl2a3 and Casl2a4 fused to a nuclear localization signal in eukaryotes) or the cytoplasm (e.g., no localization fusion or a nuclear export signal) leads to tRNA cleavage, and slowing, shutdown and / or killing of the cell. If the target RNA is absent in the cell or sample, or contains mutations, then the cell is spared. This effect particularly applies to cancer cells, bacteria, fungi, infected cells, and archaea.

[0119] The inventive approach is also used to fight infectious diseases. Delivery of Casl2a2, Casl2a3 and Casl2a4 to eukaryotic cells infected with virus or bacteria aids the immune system by recognizing tRNA, and then destroying the cellular, viral or bacterial tRNA, killing the cells or the host cell. These treatments result in death of the infected host cell, which stops disease spread and activates the immune system further. Because Casl2a2, Casl2a3 and Casl2a4 are selective, in particular Casl2a3, delivery to non-infected cells not containing the complementary viral or bacterial tRNA causes an inert response.

[0120] The inventive approach is also used to treat / regulate / engineer microbial populations important for industry and medicine, for example, if a certain strain of bacteria within a mammalian, e.g., human, microflora is correlated with obesity, it is targeted for cell death without killing other in situ bacterial populations. Such treatments will also be able to provide avenues to combat antibiotic resistant strains of bacteria. In this aspect, the complex between the at least one Casl2a2, Casl2a3 and Casl2a4 nuclease as described herein and at least one preselected guide RNA wherein said guide RNA is specifically selected for a target RNA is used as the actual active ingredient in the prevention and / or treatment. Delivery of the complex to a patient, a cell, or a sample can be done in any suitable way, for example as a pharmaceutical composition comprising the isolated components of at least one complex (polypeptide and / or nucleic acid) according to the present invention together with suitable stabilizers or carriers. Another embodiment is the provision of the complex encoded on at least one nucleic acid vector to the patient, cell, tissue, sample or nucleus, such as through viral delivery (e.g., AAV, lentiviruses) or non-viral delivery (e.g., LNP delivery of an mRNA and a guide RNA, packaging of DNA or RNA constructs or RNPs in a virus-like particle). These pharmaceutical compositions and uses thereof constitute preferred embodiments of the present invention. This aspect also includes the step of monitoring a treatment.

[0121] Another aspect of the present invention relates to a kit, comprising the substrate according to the present invention and / or the complex according to the present invention or the complex between the least one Casl2a2, Casl2a3 and Casl2a4 nuclease enzyme as described herein and at least one preselected guide RNA wherein said guide RNA is specifically selected for a target RNA that drives collateral cleavage of at least one tRNA, together with other materials for detecting at least one target RNA in a cell, tissue, cellular nucleus, and / or sample, for specifically inactivating an undesired cell or virus, or for preventing and / or treating a disease comprising diseased cells. This aspect of the present invention provides the components, e.g., substrate, complex, nuclease enzymes and / or preselected guide RNA nucleic acid molecule as above for performing the methods according to the invention as a detection system, for example as a part of a diagnostic kit. The system may also be used in a therapeutic kit, or a pharmaceutical composition comprising the isolated components of at least one complex (polypeptide and / or nucleic acid) according to the present invention together with suitable stabilizers or carriers. Another embodiment is the provision of the complex encoded on at least one nucleic acid vector to the patient, cell, tissue, sample or nucleus.

[0122] Preferably, said system / kit is provided in one or more containers, and comprises suitable enzymes, buffers, and excipients, as well as instructions for use. The components can be - at least in part - immobilized on a substrate, wherein said substrate can be exposed to said cell, tissue and / or sample. The detection system can be applied to multiple discrete locations on said substrate, such as a flexible materials substrate, for example a chip. The flexible materials substrate can be a paper substrate, a fabric substrate, or a flexible polymer-based substrate.

[0123] Yet another aspect of the present invention the relates to the use of the kit according to the present invention as described herein kit according to the present invention for detecting at least one target RNA in a cell, tissue, cellular nucleus, and / or sample as described herein, or, preferably without the substrate, for specifically inactivating an undesired cell or virus, or for preventing and / or treating a disease comprising diseased cells as herein.

[0124] The embodiments described herein can be used for wide-ranging applications, such as diagnosing medical conditions to inform the course of treatment, identifying SNPs associated with health outcomes or disease, such as in acute sepsis, determining the identity of pathogen, virulence factors, resistance markers, SNPs, viral detection, i.e., the identity, and / or viral variants (see, for example, SARS CoV-2 as disclosed herein), cancer diagnostics, in cancer samples, such as biopsies, determining mutations, and / or SNPs, identifying microbial contaminants in potable water, identifying viral or microbial contaminants in fermentations or cell cultures, identifying plant or insect variants, or identifying key microbial members in mixed communities (e.g., in the gut, soil, water), such as analysis of microbiomes and / or microbial sentinels (i.e., commensal bacteria that serve as reporters for non-invasive measurements), in particular the identity, relative abundance, resistance markers, metabolic genes, phylum / genus / species / strain-specific genes, and the like, and the tracking of viral or bacterial spread in vivo, such as in whole organisms, or based on samples, for example taken from the environment (e.g., spread of viruses or resistant bacteria detected in waste water samples, etc.).

[0125] In the context of the present invention, unless explicitly mentioned otherwise, the term “about” shall mean a value as given + / - 10%. The inventors recently discovered a set of nucleases called Casl2a2 that recognize PFS-flanked RNA targets and exhibit collateral cleavage of ssRNA, ssDNA, and dsDNA. Building on this discovery, the inventors found two distinct clades of Casl2a2 orthologs called Casl2a3 and Casl2a4. Representative members of these clades also recognized PFS-flanked RNA targets. However, target recognition leads to distinct collateral cleavage activities that only cleave RNA and are particularly selective for tRNAs. Based on insights drawn from identifying which part of the tRNA was specifically recognized, the inventors designed and tested a series of collateral cleavage substrates.

[0126] These substrates allowed the identification of general rules for substrate design that can enhance collateral cleavage activity for each nuclease and also allow multiplexed nucleic acid detection in the same reaction. These collateral cleavage substrates are expected to broadly extend the use of CRISPR nucleases for molecular diagnostics for single and multiple nucleic acid biomarkers. They are also non-obvious given the limited substrate specificity commonly observed with other CRISPR nucleases and the initial indication that Casl2a2 cleaves all RNAs.

[0127] As stated herein, the present invention particularly relates to the following items.

[0128] Item 1. An artificial RNA or DNA / RNA substrate for cleaving by a nuclease selected from Casl2a2, Casl2a3 and Casl2a4 or a nuclease having at least 90%, preferably at least 95% amino acid sequence identity to a nuclease selected from Casl2a2, Casl2a3 and Casl2a4 in the presence of at least one preselected guide RNA binding to at least one target RNA, wherein said artificial RNA or RNA / DNA substrate comprises the following sequence

[0129] S-Z-L-X-NCCA-Z-S

[0130] wherein S is absent or represents at least one reporter moiety that is activated or inactivated by cleaving, cutting or nicking said substrate, wherein at least one S is present, Z is absent or is selected from a sequence of one to 300 nucleotides, N is absent or selected from A, C, T, and U, X is absent or selected from one to five nucleotides selected from A, C, T, and U, and

[0131] L is absent or a stemloop forming sequence selected from

[0132] YGGAGAAAACUCC (SEQ ID NO: 68), YGCGGAAAACCGC (SEQ ID NO: 69), YGUGGAAAACCAC (SEQ ID NO: 70), YGGAGAAAACUCC (SEQ ID NO: 71), UGGGAAAACCCA (SEQ ID NO: 72), GGACGAAAGUCC (SEQ ID NO: 73), GGACGAAAGUCC (SEQ ID NO: 74), and GGAGGAAACUCC (SEQ ID NO: 75), wherein Y is selected from A, U, or T.

[0133] Item 2. The substrate according to Item 1, wherein the substrate has a length of between 5 and 500 nucleotides, preferably of between 20 and 200, and more preferably of between 70 and 100 nucleotides.

[0134] Item 3. The substrate according to Item 1 or 2 selected from

[0135] S-UGGAGAAAACUCCACCA-S (r49, SEQ ID NO: 76),

[0136] S-UGCGGAAAACCGCUCCA-S (r51, SEQ ID NO: 77),

[0137] S-UGUGGAAAACCACCCCA-S (r52, SEQ ID NO: 78),

[0138] S-AGGAGAAAACUCCACCA-S (r53, SEQ ID NO: 79),

[0139] S-UGGGAAAACCCAGCCA-S (r55, SEQ ID NO: 80),

[0140] S-GGAGGAAACUCCACCA-S (r57, SEQ ID NO: 81),

[0141] S-GGACGAAAGUCCCCCA-S (r60, SEQ ID NO: 82), and

[0142] S-GGAGGAAACUCCCCCA-S (r63, SEQ ID NO: 83).

[0143] Item 4. The substrate according to any one of Items 1 or 3, wherein S is selected from a nanoparticle, an antigen binding group or a fluorescent group and a quencher and / or is an extension comprising another chemical modification, such as another fluorophore, antigen or biotin, additional nucleic acid sequences, such as uncleavable tags with phosphorothioate or other backbone modifications, or DNA.

[0144] Item 5. The substrate according to any one of Items 1 to 4, wherein at least the stemloop forming sequence comprises DNA and RNA nucleotides.

[0145] Item 6. The substrate according to any one of Items 1 to 5, wherein said substrate is a modified or truncated tRNA molecule.

[0146] Item 7. A complex comprising the substrate according to any one of Items 1 to 6, at least one of a Casl2a2, Casl2a3 and Casl2a4 nuclease enzyme or at least one nuclease having at least 90%, preferably at least 95% amino acid sequence identity to a nuclease selected from Casl2a2, Casl2a3 and Casl2a4 and at least one preselected guide RNA binding to at least one target RNA.

[0147] Item 8. The complex according to Item 7, further bound to a target RNA molecule comprising a sequence that is at least 90% complementary to said guide RNA, and wherein said target RNA is preferably flanked by at least one RNA protospacer-flanking sequence / protospacer-adjacent motif (PFS), preferably wherein said target RNA is a tRNA or a modified tRNA molecule.

[0148] Item 9. The complex according to Item 7 or 8, wherein said guide RNA comprises a sequence selected to be specific for a bacterium, a sequence selected to be specific for a virus, a sequence selected to be specific for a fungus, a sequence selected to be specific for a protozoan, a sequence selected to be specific for a genetic disorder, a sequence selected to be specific for a proliferative disorder, and a sequence selected to be specific for tRNA or a modified tRNA molecule.

[0149] Item 10. The complex according to any one of Items 7 to 9, wherein said nuclease comprises at least one of a nuclear localization signal, a purification tag or an affinity tag.

[0150] Item 11. A method for cleaving the artificial RNA or DNA / RNA substrate according to any one of Items 1 to 6, comprising the steps of a) providing at least one CasQ nuclease enzyme selected from Casl2a2, Casl2a3 and Casl2a4 or at least one nuclease having at least 90%, preferably at least 95% amino acid sequence identity to a nuclease selected from Casl2a2, Casl2a3 and Casl2a4, b) providing at least one preselected guide RNA, c) forming a complex between the least one CasQ nuclease enzyme and the at least one preselected guide RNA, d) binding of the complex of c) to a target RNA based on the at least one preselected guide RNA, and e) cleaving, in particularly specifically cleaving, said artificial RNA or DNA / RNA substrate by the at least one CasQ nuclease enzyme.

[0151] Item 12. A method for detecting at least one target RNA in a cell, tissue, cellular nucleus, and / or sample, said method comprising:

[0152] a) providing at least one artificial RNA or DNA / RNA substrate according to any one of Items 1 to 6 in said cell, tissue, cellular nucleus, and / or sample, b) contacting said cell, tissue, cellular nucleus, and / or sample with at least one complex between at least one CasQ nuclease enzyme selected from Casl2a2, Casl2a3 and Casl2a4 or at least one nuclease having at least 90%, preferably at least 95% amino acid sequence identity to a nuclease selected from Casl2a2, Casl2a3 and Casl2a4 and at least one preselected guide RNA, wherein said at least one preselected guide RNA comprises a sequence that is at least 90% complementary to the target RNA, and

[0153] c) detecting a cleaving, cutting and / or nicking of said at least one artificial RNA or DNA / RNA substrate according to any one of Items 1 to 6, wherein detecting said cleaving the at least one substrate detects said at least one target RNA in said cell, tissue, cellular nucleus and / or sample.

[0154] Item 13. The method according to Item 11 or 12, wherein two, three or four or more Cas nuclease enzymes and their preferentially cleaved substrates are combined in step b), preferably comprising additional CRISPR nucleases, such as, for example LwaCasl3a, PsmCasl3b, CcaCasl3b, orLbCasl2a.

[0155] Item 14. The method according to any one of Items 11 to 13, wherein detecting said cleaving, cutting and / or nicking of the at least one reporter nucleic acid comprises detecting a change in the signal of the suitable reporter, such as a nanoparticle, antigen binder, dye, a fluorophore, change in electrical conductivity, change in size, and / or detecting the said cleaved at least one substrate fragment itself.

[0156] Item 15. The method according to any one of Items 11 to 14, wherein the at least one target RNA is a mutated target RNA comprising at least one mutation compared to a control target RNA or a tRNA or a modified tRNA molecule.

[0157] Item 16. The method according to any one of Items 11 to 15, wherein the at least one target RNA comprises a nucleic acid sequence that is specific for a disease state, such as, for example, for cells selected from the group consisting of cells exhibiting a genetic disorder, cells exhibiting a proliferative disorder, such as cancer cells, immune cells that produce autoantibodies, cells infected with bacterial or viral pathogens, bacterial pathogens, protozoan pathogens, cells of microbiota, contaminating bacteria or archaea. Item 17. Use of the substrate according to any one of Items 1 to 6 or of the complex according to any one of Items 7 to 10 for detecting at least one target RNA in a cell, tissue, cellular nucleus, and / or sample.

[0158] Item 18. The use according to Item 17, wherein said detection is in a multiplex format, preferably also using other CRISPR nucleases and their preferentially cleaved substrates, such as, for example LwaCasl3a, PsmCasl3b, CcaCasl3b, or LbCasl2a.

[0159] Item 19. A kit, comprising the substrate according to any one of Items 1 to 6 and / or the complex according to any one of Items 7 to 10 together with other materials for detecting at least one target RNA in a cell, tissue, cellular nucleus, and / or sample.

[0160] Item 20. Use of the kit according to Item 19 for detecting at least one target RNA in a cell, tissue, cellular nucleus, and / or sample.

[0161] Item 21. A method for specifically inactivating an undesired cell or virus, comprising contacting said cell or virus with a complex between the least one Casl2a2, Casl2a3 and Casl2a4 nuclease enzyme according to any one of Items 7 to 10 and at least one preselected guide RNA, binding of the complex to a target RNA based on the at least one preselected guide RNA, and collaterally cleaving at least one tRNA by at least one Casl2a2, Casl2a3 and Casl2a4 nuclease enzyme, wherein said guide RNA is preferably specifically selected for a target RNA that is specific for said undesired cell or virus to be inactivated.

[0162] Item 22. A method for preventing and / or treating a disease comprising diseased cells, such as for example, an infection and / or genetic disorder, such as a proliferative disorder, such as cancer, fungal, protozoan, bacterial and / or viral infections, an autoimmune disease, or disease-related senescent cells in a subject, comprising administering to the subject an effective amount of a complex between the least one Casl2a2, Casl2a3 and Casl2a4 nuclease enzyme according to any one of Items 7 to 10 and at least one preselected guide RNA wherein said guide RNA is specifically selected for an RNA of a virus, bacterium or diseased cell, the method preferably comprising collaterally cleaving at least one tRNA by at least one Casl2a2, Casl2a3 and Casl2a4 nuclease enzyme in the diseased cell or pathogen.

[0163] The present invention will now be further described in the following examples with reference to the accompanying Figures, nevertheless, without wanting to be limited thereto. For the purposes of the present invention, all references as cited herein are incorporated by reference in their entireties. The present disclosure includes as sequence listing comprising SEQ ID Nos: 1 to 159 as part of the description, which is also incorporated by reference in its entirety.

[0164] Figure 1 shows a phylogenetic tree constructed based on amino acid sequence alignment and subsequent phylogenetic analysis using ClustalOmega and IQ-tree methods. The tree includes sequences from Casl2al (Cpfl), Casl2c, and three clades of Casl2a2, Casl2a3, and Casl2a4. These clades correspond to Su (Casl2a2), Sm (Casl2a3), and Unk40 (Casl2a4), as described in US 2022-0389418 Al and in US 2019-0048357. The phylogenetic analysis delineates the evolutionary relationships among these Cas protein groups.

[0165] Figure 2 demonstrates the activation of Casl2a3 and Casl2a4 nucleases through complementarity between CRISPR RNA (crRNA) and an RNA target sequence. This activation results in the degradation of collateral RNA, composed of a library of all possible permutations of 10 nucleotide-long sequences consisting of adenine (A), uracil (U), guanine (G), and cytosine (C). The collateral substrates were labeled with a fluorophore at one end and a quencher at the other end. Cleavage of these substrates by Casl2a3 and Casl2a4 leads to the release of the fluorophore, resulting in a measurable increase in fluorescence over time. The figure represents normalized fluorescence changes, with the reactions conducted using purified protein, crRNA, and complementary target RNA in a buffer solution containing magnesium ions and salts. The reaction composition included 500 nM of protein, 500 nM of crRNA, 50 nM of target RNA, 1000 nM of the fluorescence reporter sequence, 40 mM Tris-HCl (pH 7.5), 2 mM magnesium chloride, 50 mM sodium chloride, and 1 mM dithiothreitol (DTT). ACATTGCTGG is SEQ ID NO: 96, and NNNNNNNNNN is SEQ ID NO: 97 (RNA) or 98 (DNA). Figure 3 presents the comparative fluorescent signal intensities generated by Casl2a2 and Casl2a3 nucleases when exposed to the same 10 nucleotide-long A / U / G / C sequence library. The end-point fluorescence for Casl2a3 nuclease reactions is lower compared to Casl2a2, demonstrating that Casl2a3 selectively degrades a subset of the possible reporter sequences within the library. This selective degradation underscores a functional distinction between the Casl2a2 and Casl2a3 nucleases with respect to collateral RNA cleavage activity. The reaction composition included 125 nM of protein (MpCasl2a2) or 500 nM protein (BalCasl2a2), 125 nM (MpCasl2a2) or 500 nM guide RNA (BalCasl2a3), 50 nM of target RNA, 1000 nM of the fluorescence reporter sequence, 40 mM Tris-HCl (pH 7.5), 2 mM magnesium chloride, 50 mM sodium chloride, and 1 mM DTT. NNNNNNNNNN is SEQ ID NO: 97 (RNA) or 98 (DNA).

[0166] Figure 4 illustrates the change in the size of total tRNA purified from E. coli in the presence of BalCasl2a3 protein, target RNA, and complementary crRNA. The tRNA molecules were labeled with a fluorophore at the 5' end, enabling detection of size changes during the degradation process. More extensive degradation of total tRNA was observed in reactions involving Casl2a2 and Casl2a4 proteins, as compared to BalCasl2a3, under the same conditions. The difference in degradation patterns demonstrates that Casl2a3 cleaves the tRNA at a short sequence near the 3' end, distal to the fluorophore label at the 5' end. A non-complementary crRNA was included as a control to confirm specificity. The reaction composition included 100 nM of protein, 250 nM of crRNA, 10 nM of target RNA, 500 nM of the fluorescently-labeled tRNA in 40 mM Tris-HCl (pH 7.5), 2 mM magnesium chloride, 50 mM sodium chloride, and 1 mM DTT.

[0167] Figure 5 illustrates the change in the size of total tRNA purified from E. coli in the presence of BalCasl2a3, Sm3Casl2a3, and ca23Casl2a3 proteins, target RNA, and complementary crRNA. The tRNA was labeled with a fluorophore at the 5' end to allow detection of size changes during the degradation process. The change in migration patterns observed in gel electrophoresis demonstrates that these nucleases cleave the tRNA at a short sequence near the 3' end. A non-complementary crRNA was used as a control to verify the specificity of the cleavage. The reaction composition included 750 nM of protein, 750 nM of crRNA, 750 nM of target RNA, and 1500 nM of fluorescently-labeled tRNA under the same buffer conditions.

[0168] Figure 6 demonstrates the cleavage of in vitro transcribed tRNAs by BalCasl2a3 protein in the presence of target RNA and complementary crRNA. The tested tRNA included Ala, Ser, Tyr, and Lys, labeled with a fluorophore at the 3' end. The observed loss of fluorescence during gel electrophoresis is consistent with the cleavage occurring near the 3' end of the tRNA molecules. A non-complementary crRNA was used as a control, showing no significant change in fluorescence, thus confirming the specificity of the cleavage reaction. The reaction composition included 750 nM of BalCasl2a3 protein, 750 nM of crRNA, 750 nM of target RNA, and 1500 nM of fluorescently-labeled tRNA in a buffer containing 40 mM Tris-HCl (pH 7.5), 2 mM magnesium chloride, 50 mM sodium chloride, and 1 mM DTT.

[0169] Figure 7 demonstrates the cleavage of in vitro transcribed tRNAs by Sm3Casl2a3 protein in the presence of target RNA and complementary crRNA. The tested tRNA included Ala, Ser, Tyr, and Lys, labeled with a fluorophore at the 3' end. The observed loss of fluorescence during gel electrophoresis is consistent with the cleavage occurring near the 3' end of the tRNA molecules. A non-complementary crRNA was used as a control, showing no significant change in fluorescence, thus confirming the specificity of the cleavage reaction. The reaction composition included 750 nM of BalCasl2a3 protein, 750 nM of crRNA, 750 nM of target RNA, and 1500 nM of fluorescently-labeled tRNA in a buffer containing 40 mM Tris-HCl (pH 7.5), 2 mM magnesium chloride, 50 mM sodium chloride, and 1 mM DTT.

[0170] Figure 8 demonstrates the cleavage of in vitro transcribed tRNAs by ca23Casl2a3 protein in the presence of target RNA and complementary crRNA. The tested tRNA included Ala, Ser, Tyr, and Lys, labeled with a fluorophore at the 3' end. The observed loss of fluorescence during gel electrophoresis is consistent with the cleavage occurring near the 3' end of the tRNA molecules. A non-complementary crRNA was used as a control, showing no significant change in fluorescence, thus confirming the specificity of the cleavage reaction. The reaction composition included 750 nM of BalCasl2a3 protein, 750 nM of crRNA, 750 nM of target RNA, and 1500 nM of fluorescently-labeled tRNA in a buffer containing 40 mM Tris-HCl (pH 7.5), 2 mM magnesium chloride, 50 mM sodium chloride, and 1 mM DTT.

[0171] Figure 9 shows depletion scores for alanine (Ala) tRNA (SEQ ID NO: 100) nucleotide sequence, calculated as the ratio of nucleotide counts at each position under non-target and target conditions, normalized to the total number of sequencing reads in each condition. Sequencing was performed using Nanopore direct RNA sequencing in a cell-free transcription-translation reaction (myTXTL, Arbor Biosciences). Error bars represent standard deviations across three biological replicates, and colors indicate z-scores (standard deviations from the mean). Higher depletion scores signify nucleotide loss under target conditions, likely due to cleavage by BalCasl2a3, which is activated by complementarity between crRNA and target RNA. The predicted alanine tRNA structure parallels the z-scores from the depletion bar graph, with sequencing revealing the absence of 1 to 4 nucleotides at the 3’ end, including the ACC A sequence, in the presence of BalCasl2a3, target RNA, and complementary crRNA, compared to the non-target control. The terminal adenine could not be determined due to RNA polyadenylation before sequencing. Reactions were conducted with 250 nM protein, 250 nM crRNA, and 250 nM target RNA, with non-complementary crRNA serving as a control. After 4 hours of incubation at 29°C, reactions were treated with Proteinase K (P8107), and small RNA was purified using the miRNeasy Tissue / Cells Advanced Micro Kit (Qiagen). The tRNAs were deacylated with 100 mM Tris-HCl (pH 9.0) at 37°C for 30 minutes, followed by RNA purification, polyadenylation, and sequencing using the Nanopore Direct RNA Sequencing Kit (SQK-RNA004) on PromethlON Flow Cell Packs (RNA) FLO-PR0004RA.

[0172] Figure 10 shows depletion scores for glycine (Gly) tRNA (SEQ ID NO: 102) nucleotide sequences determined by Nanopore direct RNA sequencing from a cell-free transcriptiontranslation reaction (myTXTL, Arbor Biosciences). The sequencing reveals the absence of primarily 1 to 4 nucleotides at the 3 ’ end of the tRNA, including UCCA, in the presence of BalCasl2a3, target RNA, and complementary crRNA, compared to the non-target control. These sequences were derived from the same samples as those used in Figure 9. Figure 11 shows depletion scores for glutamate (Glu) tRNA (SEQ ID NO: 103) nucleotide sequences determined by Nanopore direct RNA sequencing from a cell-free transcription-translation reaction (myTXTL, Arbor Biosciences). The sequencing reveals the absence of primarily 1 to 4 nucleotides at the 3’ end of the tRNA, including GCCA in the presence of BalCasl2a3, target RNA, and complementary crRNA, compared to the non-target control. These sequences were derived from the same samples as those used in Figure 9.

[0173] Figure 12 shows depletion scores for arginine (Arg) tRNA (SEQ ID NO: 101) nucleotide sequences determined by Nanopore direct RNA sequencing from a cell-free transcriptiontranslation reaction (myTXTL, Arbor Biosciences). The sequencing reveals the absence of primarily 1 to 4 nucleotides at the 3 ' end of the tRNA, including GCCA in the presence of BalCasl2a3, target RNA, and complementary crRNA, compared to the non-target control. These sequences were derived from the same samples as those used in Figure 9.

[0174] Figure 13 shows the alignment of histidine (His) (SEQ ID NO: 104) tRNA nucleotide sequences determined by Nanopore direct RNA sequencing of total purified tRNA. The sequencing reveals the absence of primarily 3 nucleotides at the 3’ end of the tRNA, including the CCA sequence, in the presence of BalCasl2a3, target RNA, and complementary crRNA, compared to the non-target control. These sequences were derived from a sample processed similarly to those in Figure 9, except the reaction was conducted in a buffer containing 40 mM Tris-HCl (pH 7.5), 2 mM magnesium chloride, 50 mM sodium chloride, and 1 mM DTT instead of in myTXTL.

[0175] Figure 14 shows normalized fluorescence changes of fluorescently labeled RNA collateral reporter sequences, which contain a fluorophore on one end and a quencher on the other. The sequences represent different variations on the 3’ end of tRNA. Unless specified otherwise, the fluorophore was typically located on the 5’ end and the quencher on the 3’ end. The figure represents normalized fluorescence changes, with reactions conducted using purified protein, crRNA, and complementary target RNA in a buffer solution. The reaction composition included 125 nM of BalCasl2a3 or MpCasl2a2, 500 nM of Sm3Casl2a2 or ApCasl2a4, or 1000 nM of ca23Casl2a2 protein and 125 nM of BalCasl2a3 or MpCasl2a2, 500 nM of Sm3Casl2a2 or ApCasl2a4, or 1000 nM of ca23Casl2a2 crRNA. The inventors used 50 nM of target RNA and 1000 nM of fluorescently-labeled reporters in a buffer containing 40 mM Tris-HCl (pH 7.5), 2 mM magnesium chloride, 50 mM sodium chloride, and 1 mM DTT.

[0176] Figure 15 presents comparative fluorescent signal intensities generated by BalCasl2a3 acting on different fluorescently labeled RNA and DNA-RNA collateral reporter sequences, each containing a fluorophore on one end and a quencher on the other. The sequences represent different variations on the 3' end of tRNA. Although there are differences in the rates of fluorescence and the fluorescent endpoint values generated due to reporter cleavage, all of these sequences can serve as reporters for target recognition by BalCasl2a3 in the presence of complementary crRNA. A non-complementary crRNA was used as a control. The reaction composition included 125 nM of BalCasl2a3, 125 nM of crRNA, 50 nM of target RNA, and 1000 nM of fluorescently-labeled reporters in a buffer containing 40 mM Tris-HCl (pH 7.5), 2 mM magnesium chloride, 50 mM sodium chloride, and 1 mM DTT.

[0177] Figure 16 shows normalized fluorescence changes of fluorescently labeled RNA collateral reporter sequences degraded by BalCasl2a3, LwaCasl3a, and PsmCasl3b. The data demonstrate that BalCasl2a3 primarily degrades its specific reporter, such as r63, but not RNA reporters AAAAA and UUUUU. In contrast, LwaCasl3a primarily degrades the UUUUU reporter but not AAAAA or r63, while PsmCasl3b predominantly degrades the AAAAA reporter, leaving UUUUU and r63 largely unaffected. This figure illustrates that BalCasl2a3, along with specific reporters like r63, can be multiplexed with other CRISPR nuclease systems, such as LwaCasl3a and PsmCasl3b, to detect RNA complementary to their crRNAs. The reaction composition included 125 nM of BalCasl2a3, 250 nM of PsmCasl3b, or 10 nM of LwaCasl3a, and 125 nM of BalCasl2a3 or 250 nM of PsmCasl3b crRNA. The reactions also contained 50 nM of target RNA and 1000 nM of fluorescently-labeled reporters in a buffer composed of 40 mM Tris-HCl (pH 7.5), 2 mM magnesium chloride, 50 mM sodium chloride, and 1 mM DTT.

[0178] Figure 17 shows the unique collateral cleavage of FAM labeled substrates (RNA, ssDNA, and dsDNA) of the Casl2a2 homologs MpCasl2a2, BalCasl2a3, ApCasl2a4 and Sm3Casl2a3. MpCasl2a2 shows the most similarity to the already characterized SuCasl2a2, as it cleaves RNA, ssDNA and dsDNA in the presence of a guide and target RNA and shows no activity when the guide-complementary target RNA is absent. BalCasl2a3 only showed partial cleavage of the FAM RNA collateral substrate when the guide and target RNA were present, with no cleavage being observed without the guide-complementary target RNA. ApCasl2a4 showed complete degradation of the FAM RNA collateral substrate when the guide and target RNA were present, with no apparent cleavage of the ssDNA or dsDNA collateral substrates. SmCasl2a3 behaved similarly to BaCasl2a3, collaterally cleaving only the collateral RNA when the guide and target RNA were present, without any apparent cleavage of either the ssDNA or dsDNA.

[0179] Figure 18 illustrates seven different strategically designed short FAM labeled ala-tRNA mimic substrates used to understand the important collateral substrate features needed for ApCasl2a4, BalCasl2a3 and Sm3Casl2a3 RNA cleavage. BalCasl2a3 collateral cleaves the tRNA mimics containing the 3' ACCA sequence (substrates: linear, duplex, duplex complement, and tetra loop), this is observed regardless of the presence of a duplex region or the sequence of the duplex region. When the 3' ACCA sequence is replaced with the complement UGGU sequence the cleavage activity is impaired. In addition, when the 3’ end of the tRNA mimics were phosphorothioate, no cleavage activity was observed. Sm3Casl2a3 shows similar substrate preference as BalCasl2a2, with 3' ACCA containing tRNA mimics showing more cleavage, with the phosphorothioate substrate lacking cleavage. However, Sm3Casl2a3 seems to cleave duplexed substrates more completely, compared to single stranded tRNA mimic (as seen between the linear and duplex / tetra loop substrates). As shown here, ApCasl2a4 shows more complete cleavage for the tRNA mimics containing a looped region, with most complete cleavage for the canonical alanine tRNA anticodon loop. Notably, ApCasl2a4 shows cleavage of the tRNA mimic containing 3' phosphorothioate nucleotides.

[0180] Figure 19 shows the cleavage by BalCasl2a3 and Sm3Casl2a3 of the normally used non-target collateral RNA, lint tRNA mimic and the 26nt duplex tRNA mimic under two different buffer conditions (DTT / Low salt containing: 40 mM Tris-HCl (pH 7.5), 2 mM magnesium chloride, 50 mM sodium chloride, and 1 mM DTT, and NEB 3.1 buffer containing: 100 mM NaCl, 50 mM Tris-HCl, 10 mM MgC12, 100 pg / ml BSA, pH 7.9). Figure 20 shows the results of a plasmid clearance assay in which Casl2al (Cpfl), Casl2a2, Casl2a3, and Casl2a4 nucleases were introduced on a plasmid into E. coli (carrying kanamycin resistance), alongside another plasmid encoding a target RNA sequence, crRNA, and a chloramphenicol resistance gene. Non-targeting crRNA was used as a control. Bacteria containing these plasmids were grown on plates either with two antibiotics (kanamycin and chloramphenicol) or with kanamycin alone (selecting only for the nuclease-encoding plasmid). The transformation fold reduction was calculated as the ratio of colonies containing the non-target plasmid to colonies containing the target plasmid, both in the presence of the respective nuclease plasmid. The presence of Casl2a2, Casl2a3, and Casl2a4 nuclease-encoding plasmids led to a significant reduction in colonies compared to the non-target condition, even without antibiotic selection for the target plasmid, suggesting that these nucleases induce general toxicity in the cells. In contrast, Casl2al (Cpfl) only showed a reduction in colonies under target conditions when both antibiotics were present.

[0181] Figure 21 demonstrates the effects of Casl2a2, Casl2a3, and Casl2a4 nucleases on GFP fluorescence in a cell-free transcription-translation system (TXTL). When expressed from plasmids in TXTL along with crRNA complementary to GFP mRNA, the nucleases significantly reduce GFP fluorescence, indicating effective RNA targeting. The nucleases also reduce GFP fluorescence when expressed with crRNA complementary to an alternative transcript in TXTL. When no promoter is placed in front of the alternative target, no GFP fluorescence reduction is observed, consistent with RNA-dependent targeting. The reduction in GFP fluorescence when targeting a non-GFP transcript suggests general toxicity of the nucleases, likely due to collateral activity, with Casl2a3 potentially cleaving tRNA in the reaction mixture.

[0182] Figure 22 demonstrates PFS preferences of Casl2a2, Casl2a3 and Casl2a4 nucleases in relationship to the protospacer-flanking sequence (PFS) preferences of DNA-targeting Casl2al. The data show that Casl2a2, Casl2a3, Casl2a4 generally prefer T / U, G, and C at position 1 and A at positions 2, 3, and 4. The experiment was done using a library of 1024 possible 5nt-long sequences at the 3’ end of the target sequences determined by complementarity to crRNA. The target sequence was placed under a constitutive promoter. Nuclease-encoding, target-encoding, and library-encoding plasmids were transformed into E. coli that was next grown under antibiotics selection for all three plasmids. Next, the library-plasmid was extracted, the library-containing region was PCR-amplified and sequences with Illumina. The PFS sequences were inferred from the sequences that were depleted in the library under targeting conditions compared to the non-targeting control.

[0183] Figure 23 shows GFP expression due to recA -dependent SOS response activation in E. coli following 5 hours of plasmid-targeting by SuCasl2a2, MpCasl2a2, Sm3Casl2a3, and ApCasl2a4. recA activation is attributed to dsDNA cleavage by SuCasl2a2 and MpCasl2a2 but not by Sm3Casl2a3 and ApCasl2a4. Data are shown as the mean + SD of four biological replicates. To detect and quantify the SOS response, E. coli BL21-AI cells were transformed with GFP transcriptional reporter, nuclease, and guide RNA plasmids. Cells were induced with L-arabinose and IPTG in a 96-well plate, and GFP fluorescence was measured every 3 minutes in a plate reader. The results show that Casl2a3 and Casl2a4 do not induce an SOS response, and support the lack of collateral activity against dsDNA.

[0184] SEQ ID NOs: 1 to 67 and 105 to 155 show the amino acid sequences of preferred and exemplary Casl2a2, a3, and a4 nucleases as used in the present invention.

[0185] SEQ ID NOs: 68 to 83 show the nucleotide sequences of the preferred substrates according to the present invention.

[0186] Additional substrates and constructs as used in the present invention are:

[0187] Linear 11 nt substrate: 5’-UAGCUCCACCA-3’ (SEQ ID NO: 84)

[0188] Duplex 26 nt substrate: 5’-GGGGCUACUUUGCACUAGCUCCACCA-3’ (SEQ ID NO: 85)

[0189] Reverse complement 26nt: 5’-CCCCGAUGAAACGUGAUCGAGGUGGU-3’ (SEQ ID NO: 86) Duplex complement (with 3’ACCA): 5’-CCUCGAUAAACGUGAUCGAGGACCA-3’ (SEQ ID NO: 87)

[0190] UGGU overhang: 5’-GGGGCUAUUUGCACUAGCUCCUGGU-3’ (SEQ ID NO: 88)

[0191] Tetra loop 22nt: 5’-GGGGCUAGAAAUAGCUCCACCA-3’ (SEQ ID NO: 89)

[0192] Phoshorothioated 25nt (optionally phosphothiolated nucleotides underlined):

[0193] 5 ’ -GGGGCUAUUUGC ACUAGCUCC ACC A-3 ’ (SEQ ID NO: 90)

[0194] CAO1 guide RNA:

[0195] 5 ’ -AAUUUCUACUAUUGUAGAUUGGAGC AAC ACCUGAAGGAAGGCU-3 ’ (SEQ ID NO: 91)

[0196] CAO1 Target RNA:

[0197] 5’- UCUUUGCUGCCGCACUUGCUCAUCAAGCCUUCCUUCAGGUGUUGCUCCAG AAAGGUGAGUUCUUCUUGUUGUU-3’ (SEQ ID NO: 92)

[0198] 5 ’FAM collateral dsDNA

[0199] 5’- AACTGATATGACAATTGCGCGTAGCACGACGACGATATGACACTTGCGCAT AACGACGACGATACAATGAT-3’ (SEQ ID NO: 93)

[0200] 5 ’FAM collateral dsDNA:

[0201] 5’- AACTGATATGACAATTGCGCGTAGCACGACGACGATATGACACTTGCGCAT AACGACGACGATACAATGAT-3’ (SEQ ID NO: 94)

[0202] 5 ’FAM collateral dsDNA:

[0203] 5’- CAGAGAUAAGUGACGCGCGGCGAGUGGCGCGCCACGUCGGAAAUCUAGA GGCG-3’ (SEQ ID NO: 95) Ala tRNA (E.coli):

[0204] GGGGCUAUAGCUCAGCUGGGAGAGCGCUUGCAUGGCAUGCAAGAGGUCA GCGGUUCGAUCCCGCUUAGCUCCACCA (SEQ ID NO: 100)

[0205] Arg tRNA (E.coli):

[0206] GCGCCCUUAGCUCAGUUGGAUAGAGCAACGACCUUCUAAGUCGUGGGCCG CAGGUUCGAAUCCUGCAGGGCGCGCCA (SEQ ID NO: 101)

[0207] Gly tRNA (E.coli):

[0208] GCGGGCGUAGUUCAAUGGUAGAACGAGAGCUUCCCAAGCUCUAUACGAG GGUUCGAUUCCCUUCGCCCGCUCCA (SEQ ID NO: 102)

[0209] Glu tRNA (E.coli):

[0210] GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUUUCACGGCGGUAACAG GGGUUCGAAUCCCCUAGGGGACGCCA (SEQ ID NO: 103)

[0211] His tRNA (E.coli):

[0212] GUGGCUAUAGCUCAGUUGGUAGAGCCCUGGAUUGUGAUUCCAGUUGUCG UGGGUUCGAAUCCCAUUAGCCACCCCA (SEQ ID NO: 104)

[0213] EXAMPLES

[0214] Overview over preferred embodiments

[0215] The inventors combined Casl2a2 nucleases or Casl2a2 and Cast 3 nuclease, guide RNAs, and collateral RNA substrates. Each guide RNA was paired with a different Cas nuclease, and the collateral RNA substrates were only collateral cleaved by a given Casl2a2 or Casl3 nuclease when it was activated. This mixture was applied to an RNA sample, detecting the respiratory RNA viruses RSV, Influenza, Flu A and Flu B. One Casl2a2 / Casl3-guide RNA-collateral RNA substrate was matched to a unique sequence in one of the viruses. This combination was then applied to a nasopharyngeal swab treated to release viral RNAs. The presence of any of the viruses in the sample leads to enzymatic cleavage of the corresponding collateral RNA substrate. The collateral RNA substrate tethers a specific fluorophore and quencher, then the different detected viruses were read out based on the fluorescence pattern. This entire reaction was conducted in a single reaction, allowing for one-pot detection without complex conditions or enzyme mixes.

[0216] METHODS

[0217] Activation and collateral RNA degradation assays

[0218] Purified MpCasl2al, MpCasl2a2, BalCasl2a3, and ApCasl2a4 proteins were used in the assays. The proteins were incubated with complementary crRNA specific to the target RNA, ssDNA, or dsDNA in a buffer solution containing 40 mM Tris-HCl (pH 7.5), 2 mM magnesium chloride (10 mM for MpCasl2al), 50 mM sodium chloride, and 1 mM DTT. Collateral degradation of RNA, ssDNA, and dsDNA was monitored by incubating Casl2al, Casl2a2, Casl2a3 or Casl2a4 proteins with a library of all possible permutations of 10 nt long A / U / G / C RNA sequences, 10 nt long A / T / G / C ssDNA, and ACATTGCTGG (SEQ ID NO: 96) dsDNA sequences labeled with a fluorophore on one end, and a quencher on the other. Reactions were initiated by adding target RNA, ssDNA, or dsDNA complementary to the crRNA. Fluorescence changes due to cleavage of the collateral substrates were recorded over time. Control reactions included non-complementary crRNA to verify specificity. The fluorescence signal was normalized to reflect changes in RNA cleavage over time, indicating activation of the nucleases.

[0219] Fluorescent tRNA cleavage assays

[0220] Total commercially available tRNA purified from E. coli (Roche) was fluorescently labeled at the 5' end. In vitro-transcribed tRNAs, including Ala, Ser, Tyr, and Lys, were synthesized using the NEB HiScribe kit and fluorescently labeled at the 3’ end. Purified BalCasl2a3, Sm3Casl2a3, ca23Casl2a3, MpCasl2a2, and ApCasl2a4 proteins were incubated with the labeled tRNA substrates in the presence of complementary crRNA and target RNA. Reactions were carried out in a buffer containing 40 mM Tris-HCl (pH 7.5), 2 mM MgC12, 50 mM NaCl, and 1 mM DTT. Reaction compositions included 100 nM to 750 nM of Casl2a2, Casl2a3, and Casl2a4 proteins, 250 nM to 750 nM of crRNA, and 10 nM to 750 nM of target RNA. The size changes of the tRNA molecules were visualized using denaturing polyacrylamide gel electrophoresis (PAGE). Fluorescent bands were detected to observe the cleavage of tRNA, with control reactions using non-complementary crRNA to confirm the specificity of the cleavage activity. Nanopore sequencing of tRNA cleavage products

[0221] BalCasl2a3, along with target RNA and either complementary crRNA or control non-complementary crRNA, was introduced into a cell-free transcription-translation reaction (myTXTL, Arbor Biosciences). Reactions were conducted with 250 nM of BalCasl2a3, 250 nM of crRNA, and 250 nM of target RNA. After 4 hours of incubation at 29°C, Proteinase K was used to degrade proteins. RNA was purified using the miRNeasy Tissue / Cells Advanced Micro Kit (Qiagen). The tRNAs were deacylated by incubation in 100 mM Tris-HCl (pH 9.0) at 37°C for 30 minutes, followed by polyadenylation. Nanopore direct RNA sequencing was then performed using the SQK-RNA004 kit on PromethlON Flow Cells (RNA) FLO-PRO004RA.

[0222] Fluorescence-based collateral reporter assays

[0223] Purified LwaCasl3a, PsmCasl3b, MpCasl2a2, Sm3Casl2a3, BalCasl2a3, ca23Casl2a3, and ApCasl2a4 proteins were tested for collateral cleavage activity using fluorescently labeled RNA collateral reporter sequences. These reporters contained a fluorophore on one end and a quencher on the other, with sequences representing different RNA variations, including AAAAA, UUUUU, r63, and others. Reactions were conducted in a buffer containing 40 mM Tris-HCl (pH 7.5), 2 mM magnesium chloride, 50 mM sodium chloride, and 1 mM DTT, with 125 nM of BalCasl2a3 or MpCasl2a2, 500 nM of Sm3Casl2a2 or ApCasl2a4, or 1000 nM of ca23Casl2a2 protein, and 250 nM of PsmCasl3b, or 10 nM of LwaCasl3a protein, and matching concentrations of crRNA. Target RNA was included at 50 nM and fluorescently labeled reporter sequences at 1000 nM. Fluorescence changes due to reporter cleavage were measured over time, showing distinct activity profiles for each nuclease. Non-complementary crRNA was used as a control to confirm cleavage specificity.

[0224] Collateral Substrate Cleavage and tRNA minimal substrates analysis

[0225] Purified 250nM MpCasl2a2, BalCasl2a3, ApCasl2a4, or Sm3Casl2a3 was incubated with 300nM CAO1 guide RNA and 250 nM target RNA, and lOOnM FAM labeled RNA, ssDNA, or dsDNA in a buffer containing 40 mM Tris-HCl (pH 7.5), 2 mM magnesium chloride, 50 mM sodium chloride, and 1 mM DTT. The reaction tubes were incubated at 37°C for 1 h before being quenched with phenol. The fluorescently labeled nucleic acid was purified by phenol -chloroform extraction and analyzed using 12% ureaPAGE electrophoresis and visualized using fluorescein fluorescence.

[0226] Plasmid clearance assay

[0227] E. coli cells were co-transformed with two plasmids: one encoding Casl2al (Cpfl), Casl2a2, Casl2a3, or Casl2a4 nucleases, along with a kanamycin resistance gene, and the other encoding a target RNA sequence, complementary crRNA, and a chloramphenicol resistance gene. Non-targeting crRNA plasmids were used as controls. After transformation, bacteria were plated on LB agar plates containing either kanamycin alone (selecting for the nuclease-encoding plasmid) or both kanamycin and chloramphenicol (selecting for both the nuclease-encoding and target RNA-encoding plasmids). After incubation, colonies were counted, and the transformation fold reduction was calculated as the ratio of colonies containing the non-target plasmid to colonies containing the target plasmid. Experiments were performed in triplicate to ensure accuracy and reproducibility.

[0228] Cell-free transcription-translation (TXTL) assay for GFP fluorescence reduction A TXTL reaction was set up using the Sigma 70 my TXTL mix (Arbor Biosciences) to assess the impact of Casl2a2, Casl2a3, and Casl2a4 nucleases on GFP fluorescence. Plasmids encoding the nucleases were introduced at 1.75 nM, while guide RNA (crRNA) plasmids were added at 2 nM. The GFP plasmid, used as a reporter, was introduced at 0.5 nM, and a T7 RNA polymerase (RNAP) plasmid for the T7 promoter controlling nuclease expression was added at 0.33 nM. IPTG was added to the reaction at a final concentration of 0.67 mM to induce nuclease expression. Reactions were incubated at 29°C, and GFP fluorescence was monitored over time to evaluate the effects of RNA targeting by the nucleases. Control reactions included non-targeting crRNA or the absence of a promoter for the alternative target to confirm specificity. Fluorescence reduction was measured and compared across reactions to assess RNA-targeting efficiency and potential collateral effects.

[0229] Protospacer-Flanking Sequence (PFS) Preference Assay

[0230] To determine the PFS preferences of Casl2a2, Casl2a3, and Casl2a4, a library-based assay was performed. A library of 1024 possible 5-nucleotide (nt) sequences at the 3’ end of target sequences complementary to crRNA was created. The target sequence was placed under a constitutive promoter. Plasmids encoding the nucleases (Casl2a2, Casl2a3, and Casl2a4), the target sequence, and the PFS library were co-transformed into E. coli. The bacteria were grown under antibiotic selection to maintain all three plasmids. Following incubation, the library plasmids were extracted, and the library region was PCR-amplified. Amplified products were sequenced using Illumina sequencing. PFS preferences were inferred by identifying sequences depleted in the library under targeting conditions compared to a non-targeting control, revealing nucleotide preferences at specific positions flanking the protospacer.

[0231] RecA-dependent GFP induction

[0232] E. coli BL21-AI cells were co-transformed with the reporter PrecA-GFP / noGFP plasmids (pOD574 / pOD704), nuclease plasmids, and target-guide plasmids. Cells were grown overnight in LB medium with 100 pg / ml carbenicillin, 50 pg / ml kanamycin, 25 pg / ml chloramphenicol, and 0.2% glucose. Cultures were diluted to OD600 of 0.1 in fresh LB medium and spiked with 0.22% L-arabinose and 0.11 mM IPTG in a 96-well plate, achieving a final OD600 of 0.01. Cells were incubated in a BioTek Synergy Hl plate reader at 37°C with shaking, with OD600 and GFP fluorescence (excitation 485 / 20, emission 528 / 20) recorded every 3 minutes.

[0233] Results

[0234] The phylogenetic analysis of Casl2al (Cpfl), Casl2c, and Casl2a2, Casl2a3, and Casl2a4 highlights the divergence of Casl2a2, Casl2a3, and Casl2a4 proteins (Su, Sm, and Unk40 clades), suggesting functional differentiation among them (Figure 1). Amino acid residue comparisons identified that a key region from SuCasl2a2, responsible for the recognition and cleavage of collateral nucleic acids (ssDNA, dsDNA, and RNA), is not conserved inCasl2a3 and Cast 2a4. For example, residues Y1069, Y1080, and Fl 092 were absent in Casl2a3 and Casl2a4 proteins, indicating potentially distinct collateral substrate cleavage activities.

[0235] The present cleavage activity assays demonstrated that Casl2a3 and Casl2a4 proteins are activated by complementarity between crRNA and target RNA, leading to the degradation of collateral RNA substrates (Figure 17), including a library of 10 nucleotide- long RNA sequences (SEQ ID NOs: 96, and Figure 2). While MpCasl2a2, similar to SuCasl2a2, exhibited more extensive cleavage of the RNA sequences in the library, Casl2a3 selectively degraded only a subset of the reporter sequences (Figures 3). As Casl2a3 and Casl2a4 could drive cell dormancy in the absence of antibiotic selection (Figure 20) and could silence GFP in trans in a cell-free system with all components for transcription and translation (Figure 21), the inventors reasoned that the activated nucleases cleaved a specific collateral substrate shared between both systems-either a rRNA or tRNAs. As rRNAs are sequestered within ribosomes, tRNAs were the likely target. Accordingly, analyses of in vitro tRNA degradation, visible through changes in migration patterns on denaturing polyacrylamide gels, revealed that Casl2a3 clade proteins, such as BalCasl2a3, Sm3Casl2a3, and ca23Casl2a3, cleave tRNA sequence near the 3' end (Figures 4-8). Control reactions with a non-complementary crRNA confirmed that cleavage occurs only with an activated nuclease. Nanopore direct RNA sequencing further elucidated the cleavage sites in tRNAs such as Ala, Gly, Glu, and His. A common feature of these cleaved sequences at the 3’ end is the presence of the NCCA motif, where N represents any ribonucleotide, chosen from A, U, C, or G (Figures 9-13).

[0236] Using sequences containing the NCCA motif, the inventors developed molecular beacons / reporters that are preferentially cleaved by activated Casl2a3 proteins but not by LwaCasl3a or PsmCasl3b. This was demonstrated in fluorescence-based assays, where the beacons contained a fluorophore and a quencher on opposite ends and were made of RNA or RNA-DNA sequences that included the NCCA motif. Cleavage of these beacons led to an increase in fluorescence, which was measured using a spectrophotometer (Figures 14-16).

[0237] Short tRNA mimic substrates were used to investigate the features recognized by the Casl2a3 and Casl2a4 nucleases (Figure 18). The feature for BalCasl2a3 cleavage appears to be the presence of a 3’ ACCA sequence as substrates lacking this feature showed little to no cleavage, while 3’ ACCA containing substrates showed significant cleavage. Sm3Casl2a3 primarily cleaves substrates containing both the 3’ ACCA sequence and a duplex region. ApCasl2a4 primarily cleaves substrates containing the anti-codon loop region, as replacing the loop with a compact GAA tetraloop reduced cleavage while mutating the acceptor stem did not affect cleavage (Figure 18). Different buffers allowed cleavage, including NEB 3.1 as well as a DTT / low-salt buffer, with the latter suggesting enhanced cleavage (Figure 19).

[0238] These data demonstrate that Casl2a3 and Casl2a4 proteins exhibit distinct recognition and cleavage of RNA or RNA-DNA substrates containing the NCCA sequence or a loop. This property provides a robust platform for RNA detection applications, with multiplexing potential using other CRISPR nucleases.

[0239] Multiplexed detection of RNA sequences using Casl2a3 and other CRISPR nucleases

[0240] Based on the data present in Figure 16 an example is designed where BalCasl2a3, LwaCasl3a, and PsmCasl3b are used in a multiplex assay to detect distinct RNA targets within a biological sample. Each protein is provided with protein specific crRNA targeting distinct RNA sequences to be detected. Also provided are specific reporter sequences (r63 for BalCasl2a3, 5’-UUUUU-3’ for LwaCasl3a, and 5’-AAAAA-3’ for PsmCasl3b). This approach allows simultaneous detection of multiple RNA sequences in the same reaction. In case of Casl2a3, an RNA or an RNA-DNA reporter can be used, as shown in Figure 15. Multiple Casl2a2, Casl2a3 and / or Casl2a4 nucleases are combined along with designed collateral substrates in order to further expand the ability to multiplex nucleic acid detection.

[0241] Casl2a3-triggered release for lateral flow detection

[0242] BalCasl2a3 is activated by complementary crRNA and the presence of a specific RNA target (e.g., viral RNA or disease-related mRNA). Upon activation, Casl2a3 cleaves a specially designed RNA or DNA-RNA linker sequence, which is based on BalCasl2a3 sequence specificity as demonstrated in Figures 4-16. This RNA linker holds nanoparticles or antibodies in a bound, inactive state. Once this sequence is cleaved by BalCasl2a3, in the presence of the complementary target RNA, the nanoparticles or antibodies are released, enabling their detection on a lateral flow strip or other diagnostic platforms. Importantly, BalCasl2a3’s multi -turnover collateral cleavage activity amplifies the signal by continuously cleaving multiple reporter molecules in the presence of only a few copies of the target RNA. Direct recognition of RNA further eliminates the need for reverse transcription of RNA to be detected into DNA. Minimal substrates and further chemical modifications

[0243] Collateral substrates with different lengths of and compositions of the stem, loop, location of the fluorophore and quencher are tested. Furthermore, chemical modifications are introduced with the collateral substrate, such as DNA bases and modified backbones. It is expected that the nucleases tolerate deviations, as long as they preserve the general structure and sequence mimicking the tRNA acceptor stem.

[0244] Further refined stem-loop sequences for Casl2a4 nucleases

[0245] Other substrates for ApCasl2a4 and other Casl2a4 nucleases are tested, including the tRNA anti-codon loop and tRNA arms, using the in vitro cleavage assays with substrates resolved by gel electrophoresis or based on separation of a fluorophore and quencher. The anti-codon loop structure is important in the recognition, lending to collateral substrates with similar loop structures.

[0246] Eukaryotic cell elimination with Casl2a3 and Casl2a4 via tRNA cleavage Representative Casl2a3 and Casl2a4 nucleases are tested in eukaryotic cells (e.g., yeast, HEK293T, HeLa) by transforming or transiently transfecting plasmid constructs encoding the nuclease and gRNA or electroporating a ribonucleoprotein complex of the nuclease and gRNA. The gRNA is designed to target a PFS-flanked sequence within a chromosomally expressed transcript. The expectation is that these cells with the targeting but not the non-targeting gRNA will exhibit reduced growth or even be eliminated from the culture.

Claims

Claims1. An artificial RNA or DNA / RNA substrate for cleaving by a nuclease selected from Casl2a2, Casl2a3 and Casl2a4 or a nuclease having at least 90%, preferably at least 95% amino acid sequence identity to a nuclease selected from Casl2a2, Casl2a3 and Casl2a4 in the presence of at least one preselected guide RNA binding to at least one target RNA, wherein said artificial RNA or RNA / DNA substrate comprises the following sequence S-Z-L-X-NCCA-Z-Swherein S is absent or represents at least one reporter moiety that is activated or inactivated by cleaving, cutting or nicking said substrate, wherein at least one S is present, Z is absent or is selected from a sequence of one to 300 nucleotides, N is absent or selected from A, C, T, and U, X is absent or selected from one to five nucleotides selected from A, C, T, and U, andL is absent or a stemloop forming sequence selected fromYGGAGAAAACUCC (SEQ ID NO: 68), YGCGGAAAACCGC (SEQ ID NO: 69), YGUGGAAAACCAC (SEQ ID NO: 70), YGGAGAAAACUCC (SEQ ID NO: 71), UGGGAAAACCCA (SEQ ID NO: 72), GGACGAAAGUCC (SEQ ID NO: 73), GGACGAAAGUCC (SEQ ID NO: 74), and GGAGGAAACUCC (SEQ ID NO: 75), wherein Y is selected from A, U, or T.

2. The substrate according to claim 1, wherein the substrate has a length of between 5 and 500 nucleotides, preferably of between 20 and 200, and more preferably of between 70 and 100 nucleotides.

3. The substrate according to claim 1 or 2 selected fromS-UGGAGAAAACUCCACCA-S (r49, SEQ ID NO: 76),S-UGCGGAAAACCGCUCCA-S (r51, SEQ ID NO: 77),S-UGUGGAAAACCACCCCA-S (r52, SEQ ID NO: 78),S-AGGAGAAAACUCCACCA-S (r53, SEQ ID NO: 79),S-UGGGAAAACCCAGCCA-S (r55, SEQ ID NO: 80),S-GGAGGAAACUCCACCA-S (r57, SEQ ID NO: 81),S-GGACGAAAGUCCCCCA-S (r60, SEQ ID NO: 82), andS-GGAGGAAACUCCCCCA-S (r63, SEQ ID NO: 83).

4. The substrate according to any one of claims 1 or 3, wherein S is selected from a nanoparticle, an antigen binding group or a fluorescent group and a quencher and / or is an extension comprising another chemical modification, such as another fluorophore, antigen or biotin, additional nucleic acid sequences, such as uncleavable tags with phosphorothioate or other backbone modifications, or DNA.

5. The substrate according to any one of claims 1 to 4, wherein at least the stemloop forming sequence comprises DNA and RNA nucleotides.

6. The substrate according to any one of claims 1 to 5, wherein said substrate is a modified or truncated tRNA molecule.

7. A complex comprising the substrate according to any one of claims 1 to 6, at least one of a Casl2a2, Casl2a3 and Casl2a4 nuclease enzyme or at least one nuclease having at least 90%, preferably at least 95% amino acid sequence identity to a nuclease selected from Casl2a2, Casl2a3 and Casl2a4 and at least one preselected guide RNA binding to at least one target RNA.

8. The complex according to claim 7, further bound to a target RNA molecule comprising a sequence that is at least 90% complementary to said guide RNA, and wherein said target RNA is preferably flanked by at least one RNA protospacer-flanking sequence / protospacer-adjacent motif (PFS).

9. The complex according to claim 7 or 8, wherein said guide RNA comprises a sequence selected to be specific for a bacterium, a sequence selected to be specific for a virus, a sequence selected to be specific for a fungus, a sequence selected to be specific for a protozoan, a sequence selected to be specific for a genetic disorder, a sequence selected to be specific for a proliferative disorder.

10. The complex according to any one of claims 7 to 9, wherein said nuclease comprises at least one of a nuclear localization signal, a purification tag or an affinity tag.

11. A method for cleaving the artificial RNA or DNA / RNA substrate according to any one of claims 1 to 6, comprising the steps of a) providing at least one CasQ nuclease enzyme selected from Casl2a2, Casl2a3 and Casl2a4 or at least one nuclease having at least 90%, preferably at least 95% amino acid sequence identity to a nuclease selected from Casl2a2, Casl2a3 and Casl2a4, b) providing at least one preselected guide RNA, c) forming a complex between the least one CasQ nuclease enzyme and the at least one preselected guide RNA, d) binding of the complex of c) to a target RNA based on the at least one preselected guide RNA, and e) cleaving, in particularly specifically cleaving, said artificial RNA or DNA / RNA substrate by the at least one CasQ nuclease enzyme.

12. A method for detecting at least one target RNA in a cell, tissue, cellular nucleus, and / or sample, said method comprising:a) providing at least one artificial RNA or DNA / RNA substrate according to any one of claims 1 to 6 in said cell, tissue, cellular nucleus, and / or sample,b) contacting said cell, tissue, cellular nucleus, and / or sample with at least one complex between at least one CasQ nuclease enzyme selected from Casl2a2, Casl2a3 and Casl2a4 or at least one nuclease having at least 90%, preferably at least 95% amino acid sequence identity to a nuclease selected from Casl2a2, Casl2a3 and Casl2a4 and at least one preselected guide RNA, wherein said at least one preselected guide RNA comprises a sequence that is at least 90% complementary to the target RNA, andc) detecting a cleaving, cutting and / or nicking of said at least one artificial RNA or DNA / RNA substrate according to any one of claims 1 to 6, wherein detecting said cleaving the at least one substrate detects said at least one target RNA in said cell, tissue, cellular nucleus and / or sample.

13. The method according to claim 11 or 12, wherein two, three or four or more Cas nuclease enzymes and their preferentially cleaved substrates are combined in step b), preferably comprising additional CRISPR nucleases, such as, for example LwaCasl3a, PsmCasl3b, CcaCasl3b, orLbCasl2a.

14. The method according to any one of claims 11 to 13, wherein detecting said cleaving, cutting and / or nicking of the at least one reporter nucleic acid comprises detecting achange in the signal of the suitable reporter, such as a nanoparticle, antigen binder, dye, a fluorophore, change in electrical conductivity, change in size, and / or detecting the said cleaved at least one substrate fragment itself.

15. The method according to any one of claims 11 to 14, wherein the at least one target RNA is a mutated target RNA comprising at least one mutation compared to a reference target RNA.

16. The method according to any one of claims 11 to 15, wherein the at least one target RNA comprises a nucleic acid sequence that is specific for a disease state, such as, for example, for cells selected from the group consisting of cells exhibiting a genetic disorder, cells exhibiting a proliferative disorder, such as cancer cells, immune cells that produce autoantibodies, cells infected with bacterial or viral pathogens, bacterial pathogens, protozoan pathogens, cells of microbiota, or contaminating bacteria or archaea.

17. Use of the substrate according to any one of claims 1 to 6 or of the complex according to any one of claims 7 to 10 for detecting at least one target RNA in a cell, tissue, cellular nucleus, and / or sample.

18. The use according to claim 17, wherein said detection is in a multiplex format, preferably also using other CRISPR nucleases and their preferentially cleaved substrates, such as, for example LwaCasl3a, PsmCasl3b, CcaCasl3b, or LbCasl2a.

19. A kit, comprising the substrate according to any one of claims 1 to 6 and / or the complex according to any one of claims 7 to 10 together with other materials for detecting at least one target RNA in a cell, tissue, cellular nucleus, and / or sample.

20. Use of the kit according to claim 19 for detecting at least one target RNA in a cell, tissue, cellular nucleus, and / or sample.

21. A method for specifically inactivating an undesired cell or virus, comprising contacting said cell or virus with a complex between at least one Casl2a2, Casl2a3 andCasl2a4 nuclease enzyme and at least one preselected guide RNA, binding of the complex to a target RNA based on the at least one preselected guide RNA, and collaterally cleaving at least one tRNA by at least one Casl2a2, Casl2a3 and Casl2a4 nuclease enzyme, wherein said guide RNA is preferably specifically selected for a target RNA that is specific for said undesired cell or virus to be inactivated.

22. A method for preventing and / or treating a disease comprising diseased cells, such as for example, an infection and / or genetic disorder, such as a proliferative disorder, such as cancer, fungal, protozoan, bacterial and / or viral infections, an autoimmune disease, or disease-related senescent cells in a subject, comprising administering to the subject an effective amount of a complex between at least one Casl2a2, Casl2a3 and Casl2a4 nuclease enzyme and at least one preselected guide RNA, wherein said guide RNA is specifically selected for an RNA of a virus, bacterium or diseased cell, the method preferably comprising collaterally cleaving at least one tRNA by at least one Casl2a2, Casl2a3 and Casl2a4 nuclease enzyme in the diseased cell or pathogen.

Images