342 results about "Fluorescent stain" patented technology

The invention relates to the technical field of fluorescent dyes, in particular to a citric acid-based fluorescent dye for distinguishing dead cells from living cells as well as a preparation method and application of the citric acid-based fluorescent dye. The invention discloses a citric acid-based fluorescent dye for distinguishing dead cells from living cells. The citric acid-based fluorescent dye comprises at least one of a compound 1 and a compound 2, the citric acid-based fluorescent dye can specifically enter dead cells and specifically dye cytoplasm of the dead cells, so that the dead cells can be dyed or imaged. The citric acid-based fluorescent dye is difficult to dye living cells, so that dead cells and living cells can be quickly and accurately distinguished, and the citric acid-based fluorescent dye can be applied to the field of biological medicines.

The invention provides a detection method and application of miRNA and analogues thereof, and relates to the field of nucleic acid detection. According to the invention, a probe 1 and a probe 2 are designed for target miRNA and miRNA analogues; the probes are respectively combined with a part of miRNA, the probe 2 can be combined to a chip, a microsphere and other solid phase carriers, and the probe 1 modifies a fluorescent dye or biotin and other signal labeling materials; after the target miRNA or miRNA analogue is mixed with the probe 1 and the probe 2 and incubated, the probe 2 is not hybridized with the miRNA analogue and only hybridized with the miRNA analogue and captures the target miRNA by optimizing the hybridization temperature, so that the detection specificity is high.

The invention discloses an assay system with multiple detection modes and a related method. The measurement system with multiple detection modes comprises a sample stage; the optical module is used for scanning a sample to be detected and at least has a sequencing mode and a fluorescent staining mode; a driving circuit selectively coupled to mode parameters corresponding to an operation mode of the optical module, the mode parameters including at least a first mode control parameter corresponding to the sequencing mode and a second mode control parameter corresponding to the fluorescent staining mode; the mode switching circuit is coupled to the driving circuit so as to control the driving circuit based on the sample to be detected; and the mode switching circuit associates different mode parameters to the driving circuit based on the type of the sample to be detected. According to the invention, multi-mode switching of the detection system is realized, and multiple detection functions are realized on the same platform.

The invention belongs to the technical field of targeting peptides, and particularly relates to an EGFR targeting peptide, a fluorescent probe, a composition and application. The targeting peptide has an amino acid sequence as shown in SEQ ID NO: 1. Through verification, the targeting peptide has the capability of selective enrichment in tumor cells, and is beneficial to tumor recognition and treatment. The fluorescent probe coupled by the targeting peptide and the ICG fluorescent dye can specifically recognize and target an EGFR receptor, realizes effective aggregation and retention at a tumor part, is suitable for targeted diagnosis and treatment of tumors, can realize accurate imaging, has important clinical transformation potential, and becomes a molecular imaging probe with application prospects.

The invention relates to a bronchoalveolar lavage fluid rapid detection method based on a fluorescent staining technology and a corresponding detection device, and aims to improve the detection efficiency of alveolar lavage and sampling screening. The detection device comprises an endoscope assembly, a lavage fluid supply module, a recovery module and a control module. Wherein the recovery module is internally provided with an assembly used for adding a fluorescent coloring agent into the recovery liquid, the fluorescent coloring agent is injected into the recovery liquid in the recovery process of the lavage fluid according to needs, and an electromagnetic drive stirring mechanism is combined, so that dynamic and uniform mixing of the dyeing liquid and the lavage fluid is achieved. The control module automatically adjusts the injection amount, the mixing speed and the stirring duration of the coloring agent according to preset parameters or real-time detection data, and the dyeing reaction time in the operation process is remarkably saved.

The utility model discloses spinning forming equipment based on colored noctilucent pre-oriented yarn, which relates to the technical field of spinning forming equipment and comprises a screw extruder, a stirring mechanism is arranged on the left side of the screw extruder, and a filtering mechanism is arranged between the screw extruder and the stirring mechanism and used for filtering melt. The filtering mechanism comprises a multi-stage filtering unit and a backwashing unit, the multi-stage filtering unit is arranged above the stirring mechanism and comprises a filtering barrel, the multi-stage gradient filtering unit is arranged, a nested filtering net structure is adopted in the filtering barrel, and the aperture of a first filtering net barrel is smaller than that of a second filtering net barrel, so that graded fine filtering of the melt is realized. Agglomerated particles and impurities formed by noctilucent pigment or fluorescent dye in melt can be effectively intercepted, and the blocking risk of the spinneret plate is remarkably reduced. Meanwhile, the filter screen cylinder is detachably installed through the first clamping groove and the second clamping groove, maintenance and replacement are convenient, and it is ensured that the filtering effect is continuous and stable.

The present application relates to the field of fluorescent anti-counterfeiting detection technology, in particular to a fluorescent anti-counterfeiting super-hydrophobic composite film with multiple color changes and a preparation method thereof.The fluorescent anti-counterfeiting super-hydrophobic composite film with multiple color changes can realize the color change of the film surface by changing the excitation wavelength.The multiple color changes are realized by blending two different fluorescent dyes, encapsulating the fluorescent dyes to prepare a fluorescent anti-counterfeiting emulsion, and then spraying the emulsion on the surface of a polymer substrate to obtain the fluorescent composite film with super-hydrophobic characteristics and multiple color changes.The fluorescent anti-counterfeiting composite film prepared by the present application has the characteristics of multiple color changes, strong fluorescent signal and good fluorescent performance stability.

The structural formula of the oxygen-rhodamine near-infrared fluorescent dye is shown as a formula (a) or a formula (b), and R1 and R2 are respectively selected from hydrogen, alkyl or alkenyl; r3 and R4 are respectively selected from hydrogen, alkyl and alkenyl; r5-R9 are respectively selected from hydrogen, alkyl, methoxyl, ethyoxyl, halogen, carboxyl, sulfonic acid group, ethylene glycol group, hydroxyl or amino, and N is an integer greater than or equal to 0. The invention also discloses a preparation method and application of the fluorescent dye. The compound is novel in structure, excellent in performance, simple in preparation method and good in product application prospect.

The invention discloses a blended neutron / gamma discrimination polysiloxane scintillator and a preparation method thereof. The polysiloxane scintillator is composed of a matrix, a primary fluorescent dye, a secondary fluorescent dye and a cross-linking agent. A matrix of the scintillator is a copolymer of methyl phenyl polysiloxane and phenyl methyl siloxane, a main fluorescent dye is 2, 5-diphenyl oxazole (PPO), a secondary fluorescent dye is selected from 7-diethylamino-4-methylcoumarin (MDAC), and a cross-linking agent is 1, 3-divinyl-1, 3-diphenyl-1, 3-dimethyl siloxane. The obtained polysiloxane scintillator has good stability and can be used for neutron detection and neutron / gamma discrimination in a strong irradiation field environment.

The invention discloses a human-derived hysteromyoma targeting peptide and application thereof, the sequence of the targeting peptide is selected from SEQ ID NO: 1 to SEQ ID NO: 5, and the SEQ ID NO: 1 (VN12) is the most preferable. The fusion protein is obtained by screening through a phage display technology, and has high hysteromyoma targeting specificity and low immunogenicity. The targeting peptide can be coupled with nuclide or fluorescent dye, and is used for accurate PET imaging, fluorescent diagnosis and intraoperative navigation of hysteromyoma. Experiments prove that the molecular marker is specifically enriched in tumor tissues (the tumor / muscle ratio is 60), the biological safety is good, the problems of insufficient diagnosis sensitivity and large treatment wound in the prior art are solved, and the molecular marker has a great application prospect in diagnosis and treatment of hysteromyoma.

The present invention discloses a compound dye for fluorescent staining of cells in complex matrices. The compound dye comprises, based on a total volume of 100 mL, a buffer system having a pH of 6.0 to 8.0; a fluorescent dye, wherein the fluorescent dye is 2× to 40× Sybr Gold or 2 to 80 mg of propidium iodide; 0.1 to 10 mL of Triton X-100; 0 to 24 mL of glycerol; 0 to 800 mg of EDTA-disodium; and a polyamide-amine dendrimer. The two preferred compound fluorescent dye formulas of the present invention can both achieve efficient staining of cells in complex matrices and accurate counting of their number, and the dye has excellent fluorescence color development ability. Compared with other dyes, the compound dye has a fast staining rate (staining can be achieved within 30 seconds), stable staining, and is not prone to fluorescence quenching under long-term illumination.

This invention belongs to the field of printing consumables technology, specifically relating to a thermally foamed anti-counterfeiting inkjet ink. The thermally foamed anti-counterfeiting inkjet ink comprises an organic fluorescent dye, a solvent, a humectant, a resin, and additives; the solvent includes at least one selected from ethanol, n-propanol, isopropanol, n-butanol, and dimethyl acetate; the humectant includes at least one selected from ethylene glycol, diethylene glycol, and glycerin; and the resin includes rosin resin or modified rosin resin. The thermally foamed anti-counterfeiting inkjet ink has advantages such as extremely low viscosity and surface tension, and good continuous printing performance.

The present invention discloses a plant tissue section redyeing method, which relates to the field of biotechnology. The method comprises the following steps: (1) preparing plant tissue sections; (2) observing the plant tissue sections for lignin autofluorescence; (3) subjecting the plant tissue sections observed in step (2) to fluorescent staining for cellulose; and (4) staining the plant tissue sections observed in step (3) with a brightfield dye. The present invention rationally arranges the dyes for use based on whether they are washable. By staining the same sample multiple times, the method is simple and quick, while avoiding errors caused by sample differences.

The present application relates to the field of biological detection, and more particularly to compounds, probes, kits and their applications. The compounds provided by the present application include: modified rhodamine series fluorescent dyes and D-type amino acids, intermediate groups for regulating the luminescence properties of the dyes. Through the optimization of the dye part, we obtain a series of compounds that can be detected in different fluorescent color channels (400-820 nm).

The present invention relates to a pathogenic microorganism detection apparatus, and belongs to the technical field of microorganism detection, the pathogenic microorganism detection apparatus comprises a detector and a detection chamber arranged at the top of the detector, the detection chamber is internally provided with a detection groove, the detection groove is internally provided with a detection mechanism, and the apparatus further comprises: a separation mechanism; the lifting mechanism comprises a lifting ring capable of lifting in the detection groove; the clamping mechanism is used for clamping the test tube; a rotating mechanism; and a knocking mechanism. Through cooperative use of the lifting mechanism and the clamping mechanism, the clamping mechanism can clamp a test tube added with a sample reagent and a fluorescent dye, and in the detection process, the lifting mechanism can move up and down, and the clamping mechanism drives the test tube to move up and down, so that the detection accuracy is improved. The light emitted by the illuminator can respectively irradiate the upper middle layer and the lower middle layer of the reagent in the test tube, so that pathogenic microorganisms in the upper middle layer and the lower middle layer of the reagent in the test tube are respectively detected, the pathogenic microorganisms in the reagent in the test tube are detected twice, and the detection precision is improved.

The invention relates to a PCR (Polymerase Chain Reaction) reagent for detecting porphyromonas gingivalis. Comprising a specific primer pair, a KOD series high-fidelity DNA polymerase premix solution, SYBR Green I fluorescent dye and sterile nuclease-free water, the specific primer pair is composed of a forward primer and a reverse primer, the nucleotide sequence of the forward primer is CGTACTGAACTACGCTTATCTGGGCGATA, the nucleotide sequence of the reverse primer is GGTTGTCCCGCCTGCTAAGATACAA GCTA, the PCR reagent is a mixed solution with an optimized proportion in advance, the total volume is 40 [mu] L, the detection wavelength is 250nm, and the detection wavelength is 250nm. The invention discloses a porphyromonas gingivalis detection kit which comprises the following components in volume range: 20-30 mu L of KOD PCR mix, 1-1.5 mu L of upstream primer FW (10 mu M), 1-1.5 mu L of downstream primer RV (10 mu M), 0.5-1.5 mu L of SYBR Green I (20X stock solution) and the balance of sterile nuclease-free water, when porphyromonas gingivalis is detected, 4 mu L of PCR reagent needs to be taken out and put into a reaction tube, then template DNA to be detected is added, an integrated PCR reaction solution is formed by mixing, and the kit is used for detecting porphyromonas gingivalis. The technical problem that a mainstream P.g bacterium detection method in the prior art cannot meet clinical efficient and accurate detection requirements is solved.

The invention belongs to the technical field of biology, and discloses a preparation method of an intestinal plexus patch, which comprises the following steps: killing an intestinal tract donor, fixing intestinal tissue segments of duodenum, jejunum, ileum or colon by using paraformaldehyde, and dehydrating to obtain dehydrated intestinal tissue segments; washing the dehydrated intestinal tissue section and removing mesentery, fat and Pari's lymph nodes attached to the jejunum, cutting an intestinal mass of about 4-6mm perpendicular to the intestinal tissue section, flatly laying the intestinal mass on a glass slide, dropwise adding a PBS (Phosphate Buffer Solution) of Triton X-100, fixing the intestinal mass by using a smooth surface of a pair of tweezers, stripping muscle tissues along the annular muscle direction, and drying the intestinal mass in a drying oven. The intestinal slices with intermuscular nerve plexus are obtained; finally, the intestinal piece with the intermuscular nerve plexus is cleaned, then fluorescent staining and piece sealing are conducted, and the mouse intestinal nerve plexus patch is obtained. The preparation method of the mouse intestinal nerve plexus patch has the advantages of being convenient, rapid and the like.

The invention belongs to the technical field of medical instruments, and particularly relates to a medical multifunctional operation pasting film which is characterized in that the medical multifunctional operation pasting film comprises a sterile basement film, an anatomical structure body surface projection layer is arranged on the surface of the sterile basement film, and the anatomical structure body surface projection layer comprises a nerve and blood vessel identification area, a tissue level identification area and an operation path guiding area; an anti-curling adhesive tape is arranged at the edge of the sterile base film, and release paper is fixedly connected to the back surface of the sterile base film. In the anatomical structure body surface projection layer, the nerve and blood vessel identification area is printed through vegetable dye, blood vessels and nerves are clearly distinguished through red fluorescent dye and blue fluorescent dye under ultraviolet light, and positioning errors caused by traditional hand drawing are avoided; protruding texture of the tissue level identification area assists a surgeon in judging the dissection depth through touch feedback, scale marks and an erasable coating of the operation path guiding area support accurate measurement and personalized marking in the operation, and the risk of important tissue damage is reduced.

The invention discloses a novel styrene-acrylonitrile neutron / gamma discrimination plastic scintillator and a preparation method and application thereof. The plastic scintillator is composed of a mixed matrix, a main fluorescent dye and a secondary fluorescent dye, the mixed matrix is styrene-acrylonitrile (ABN), the main fluorescent dye is 2, 5-diphenyl oxazole (PPO), and the secondary fluorescent dye is 9, 10-diphenyl anthracene (DPA). The prepared plastic scintillator uses the mixed matrix, the traditional scintillator usually focuses on the influence of the matching of primary and secondary fluorescent dyes on the plastic scintillator, which is only in the transfer direction of debugging matrix excitation energy, and the innovation of the double mixed matrix can explore another way and expand thinking for researching how to improve the light yield of the plastic scintillator. Meanwhile, the addition of acrylonitrile improves the transparency and hardness of the plastic scintillator, and the stability is also greatly improved.

The invention provides a method for loading a nucleic acid template before sequencing, a method for carrying out visual imaging analysis on the loaded nucleic acid template before sequencing and related applications of the nucleic acid template and the method. Specifically, the method for loading the nucleic acid template comprises the following steps: 1) loading the nucleic acid template to the surface of a solid support; 2) combining a fluorescent dye with the nucleic acid template; and (3) removing the uncombined fluorescent dye by adopting a cleaning reagent. Furthermore, the method also comprises the following steps: removing the fluorescent dye combined to the nucleic acid template by using a rinsing reagent; and carrying out sequencing pretreatment on the nucleic acid template by using a plurality of reagents after cleaning and before rinsing. Meanwhile, the invention also provides a method for analyzing the loaded nucleic acid template before sequencing based on the loading method, namely photographing and observing after the steps. By means of the analysis method, multiple steps of the sequencing pretreatment stage can be effectively monitored, quality inspection is conducted on all the stages, faults are confirmed in time, and then the one-time off-machine success rate is increased.

The utility model belongs to the technical field of fluorescent dye detection, and particularly relates to fluorescent dye molecular synthesis detection equipment which comprises an equipment main body, a control panel is fixedly connected to the top of the equipment main body, U-shaped groove plates are fixedly connected to the two sides of the inner wall of the equipment main body, T-shaped plates are slidably connected to the inner walls of the U-shaped groove plates, and the T-shaped plates are fixedly connected to the top of the equipment main body. A placement cavity is formed in the top of the T-shaped plate, a handle is fixedly connected to the face, away from the equipment body, of the T-shaped plate, a molecule detector is fixedly connected to the top of the inner wall of the equipment body, and two telescopic devices are fixedly connected to the top of the inner wall of the equipment body. The fluorescent dye molecule synthesis detection equipment solves the problems that when the fluorescent dye molecule synthesis detection equipment is cleaned, fluorescent dye is attached to the inner wall of the placing cavity, so that the cleaning is not comprehensive, the next analysis results are inconsistent, and the accuracy of the detection result is influenced, so that the cleaning effect of the inner wall of the placing cavity is improved.

The invention discloses an application of a vinyl quinoline fluorescent dye in preparation of a reagent or a kit for detecting mitochondria or lysosome. The fluorescent dye does not need to be washed, the probe is used for dyeing mitochondria when the mitochondrial membrane potential is normal, and the probe targets lysosome when the mitochondrial membrane potential is reduced, so that the probe can also be used for observing the mitochondrial membrane potential, the influence of washing on the mitochondrial membrane potential and the damage to cells can be avoided, and the applicability is wider.

The invention discloses a large-tonnage insulating pull rod joint adhesive and a preparation method thereof, belongs to the technical field of high-voltage insulating materials, and aims to solve the technical problems that an existing large-tonnage insulating pull rod joint adhesive easily generates microcracks and interface layering under long-term electromechanical coupling stress and is difficult to early warn and self-repair. The preparation method comprises the following steps: firstly, synthesizing a polyurea microcapsule containing fluorescent dye tetraphenyl ethylene (TPE), and accurately controlling the wall thickness of the microcapsule through an interfacial polymerization technology to ensure that the microcapsule is broken under specified stress; then, the microcapsules are compounded with bisphenol A epoxy resin, nano montmorillonite and a silane coupling agent, and a curing agent is added to prepare an adhesive; when the adhesive joint is subjected to critical stress, the microcapsule is broken and the fluorescent dye is released, so that damage self-diagnosis is realized; the damage detection sensitivity, the mechanical property and the high temperature resistance of the adhesive are remarkably improved, and a reliable guarantee is provided for hot-line work of ultra-high voltage transmission lines.

The invention discloses a xanthene nitroreductase-responsive fluorescent dye compound as well as a preparation method and application thereof, and belongs to the technical field of xanthene derivatives. The fluorescent dye compound can be used for quickly and specifically recognizing overexpressed nitroreductase in tumor cells; after the fluorescent probe acts with nitroreductase, the fluorescence intensity of the fluorescent probe at 718 nm is obviously enhanced, and the fluorescent probe has excellent targeting capability on mitochondria; meanwhile, under the excitation of illumination with the specific wavelength of 660 nm, an acting product of the fluorescent dye compound and nitroreductase can efficiently generate reactive oxygen species (ROS), and then the effect of specifically killing tumor cells is achieved. The xanthene nitroreductase response type fluorescent dye compound provided by the invention can achieve the goal of integration of diagnosis and treatment of solid tumors, and has important clinical application value.

The application discloses an application of a light-cured material in safety indication or metal flaw detection and a safety indication and metal flaw detection method, and the light-cured material is prepared by uniformly mixing raw materials including an organic fluorescent dye and a light-cured glue; the organic fluorescent dye is a mixture of one or more of quinacridone, acridine yellow, acridine yellow G, acridine yellow hydrochloride, sulfuric acid proflavine, acridine orange, acridone, ethidium bromide and 9-aminoacridine; the light-cured glue is a mixture of one or more of UV drop glue D-606, ultraviolet curing adhesive 3491, ultraviolet curing adhesive YY1181, V3218 and ultraviolet curing adhesive 3492; or, the organic fluorescent dye is a mixture of one or more of acridine yellow, sulfuric acid proflavine, acridine orange and 9-aminoacridine, and the light-cured glue is V3018. The light-cured material can emit afterglow under white light excitation after curing, and can be applied to large-area safety indication and metal flaw detection.

Disclosed herein include systems, devices, and methods for cytometric bead array (CBA) analysis. After receiving user selections of a reporter fluorescent dye and clustering fluorescent dyes, gates for CBA event data corresponding to analytes in samples and standard curves for the analytes can be determined. Concentrations of the analytes in the samples can be determined using the standard curves.

A surgical instrument wrap having at least one or a plurality of fibrous layers that cooperate with at least one agent or dye layer that is generally not visible until the at least one or plurality of fibrous layers is damaged or disrupted. The at least one diffusible agent or dye layer diffuses or wicks into the disrupted or damaged area. A fluorescent dye, a reactive dye, a conjugant dye or an absorption wavelength of approximately 200-400 nanometers in one embodiment and an emission wavelength in the visible spectrum so that when the surgical wrap is damage or disrupted and then exposed to, for example, a fluorescent or ultraviolet light source, the agent or dye fluoresces to provide an indication to the user that damage to the wrap has occurred. The user can presume that the items or instruments in the surgical tray may be contaminated.

The utility model discloses an AIE vaginal secretion dual fluorescent staining solution preparation sampling tube, which relates to the field of gynecological pathogen detection, and comprises a sampling tube body, pressing holes are arranged below two sides of the sampling tube body, and shielding components are arranged on two sides inside the sampling tube body. By arranging the shielding assembly, when the negative pressure ball needs to be pressed through the pressing hole, a worker pulls a pull rope through a pull ring, the pull rope pulls a sliding block to move upwards, the sliding block moves upwards to extrude a spring, so that the spring is stressed and compressed, meanwhile, a baffle is driven to move upwards, the baffle moves into the containing cavity, and at the moment, the baffle does not shield the pressing hole any more; a worker can press the negative pressure ball through the pressing hole, when the negative pressure ball does not need to be pressed, the pull ring is loosened, the spring is stretched to push the sliding block to move downwards to reset, the baffle is driven to move to reset, the baffle shields the pressing hole, and the situation that the sealing plug is moved out of the suction pipe when the negative pressure ball is pressed by fingers in the sampling pipe taking process is avoided.

The invention discloses a method and device for identifying helicobacter pylori based on artificial intelligence fluorescence imaging, and relates to the technical field of artificial intelligence medical detection. Comprising the following steps: S1, carrying out slide preparation treatment on a cytological sample or a tissue slice sample, and processing the slide preparation through an immunofluorescent staining reagent to obtain a helicobacter pylori fluorescent staining picture; s2, outputting and obtaining a helicobacter pylori picture with a rectangular frame identifier through a helicobacter pylori identifier neural network model; and S3, according to the coordinate information of the rectangular frame, obtaining the coordinate information of the helicobacter pylori in the fluorescent staining picture, and splicing the helicobacter pylori pictures to obtain a spliced picture. According to the method, the helicobacter pylori is marked automatically through the helicobacter pylori identification neural network model, the problems of subjectivity and time consumption of traditional manual microscopic examination are avoided, meanwhile, the positions of thalli are accurately marked, positive probability data are output, and then the detection efficiency is improved.

The invention discloses a label-free ratio fluorescence sensor and a method for detecting fentanyl substances, and belongs to the field of analysis and detection.The sensor comprises a recognition element, the recognition element comprises six kinds of guanine-rich DNA aptamers and a signal conversion element, and the signal conversion element comprises a fluorescent dye. According to the invention, a plurality of fentanyl analogues can be rapidly detected.