199 results about "Fluorescent stain" patented technology

The utility model discloses spinning forming equipment based on colored noctilucent pre-oriented yarn, which relates to the technical field of spinning forming equipment and comprises a screw extruder, a stirring mechanism is arranged on the left side of the screw extruder, and a filtering mechanism is arranged between the screw extruder and the stirring mechanism and used for filtering melt. The filtering mechanism comprises a multi-stage filtering unit and a backwashing unit, the multi-stage filtering unit is arranged above the stirring mechanism and comprises a filtering barrel, the multi-stage gradient filtering unit is arranged, a nested filtering net structure is adopted in the filtering barrel, and the aperture of a first filtering net barrel is smaller than that of a second filtering net barrel, so that graded fine filtering of the melt is realized. Agglomerated particles and impurities formed by noctilucent pigment or fluorescent dye in melt can be effectively intercepted, and the blocking risk of the spinneret plate is remarkably reduced. Meanwhile, the filter screen cylinder is detachably installed through the first clamping groove and the second clamping groove, maintenance and replacement are convenient, and it is ensured that the filtering effect is continuous and stable.

The invention discloses a blended neutron / gamma discrimination polysiloxane scintillator and a preparation method thereof. The polysiloxane scintillator is composed of a matrix, a primary fluorescent dye, a secondary fluorescent dye and a cross-linking agent. A matrix of the scintillator is a copolymer of methyl phenyl polysiloxane and phenyl methyl siloxane, a main fluorescent dye is 2, 5-diphenyl oxazole (PPO), a secondary fluorescent dye is selected from 7-diethylamino-4-methylcoumarin (MDAC), and a cross-linking agent is 1, 3-divinyl-1, 3-diphenyl-1, 3-dimethyl siloxane. The obtained polysiloxane scintillator has good stability and can be used for neutron detection and neutron / gamma discrimination in a strong irradiation field environment.

The invention discloses a human-derived hysteromyoma targeting peptide and application thereof, the sequence of the targeting peptide is selected from SEQ ID NO: 1 to SEQ ID NO: 5, and the SEQ ID NO: 1 (VN12) is the most preferable. The fusion protein is obtained by screening through a phage display technology, and has high hysteromyoma targeting specificity and low immunogenicity. The targeting peptide can be coupled with nuclide or fluorescent dye, and is used for accurate PET imaging, fluorescent diagnosis and intraoperative navigation of hysteromyoma. Experiments prove that the molecular marker is specifically enriched in tumor tissues (the tumor / muscle ratio is 60), the biological safety is good, the problems of insufficient diagnosis sensitivity and large treatment wound in the prior art are solved, and the molecular marker has a great application prospect in diagnosis and treatment of hysteromyoma.

This invention belongs to the field of printing consumables technology, specifically relating to a thermally foamed anti-counterfeiting inkjet ink. The thermally foamed anti-counterfeiting inkjet ink comprises an organic fluorescent dye, a solvent, a humectant, a resin, and additives; the solvent includes at least one selected from ethanol, n-propanol, isopropanol, n-butanol, and dimethyl acetate; the humectant includes at least one selected from ethylene glycol, diethylene glycol, and glycerin; and the resin includes rosin resin or modified rosin resin. The thermally foamed anti-counterfeiting inkjet ink has advantages such as extremely low viscosity and surface tension, and good continuous printing performance.

The invention relates to a PCR (Polymerase Chain Reaction) reagent for detecting porphyromonas gingivalis. Comprising a specific primer pair, a KOD series high-fidelity DNA polymerase premix solution, SYBR Green I fluorescent dye and sterile nuclease-free water, the specific primer pair is composed of a forward primer and a reverse primer, the nucleotide sequence of the forward primer is CGTACTGAACTACGCTTATCTGGGCGATA, the nucleotide sequence of the reverse primer is GGTTGTCCCGCCTGCTAAGATACAA GCTA, the PCR reagent is a mixed solution with an optimized proportion in advance, the total volume is 40 [mu] L, the detection wavelength is 250nm, and the detection wavelength is 250nm. The invention discloses a porphyromonas gingivalis detection kit which comprises the following components in volume range: 20-30 mu L of KOD PCR mix, 1-1.5 mu L of upstream primer FW (10 mu M), 1-1.5 mu L of downstream primer RV (10 mu M), 0.5-1.5 mu L of SYBR Green I (20X stock solution) and the balance of sterile nuclease-free water, when porphyromonas gingivalis is detected, 4 mu L of PCR reagent needs to be taken out and put into a reaction tube, then template DNA to be detected is added, an integrated PCR reaction solution is formed by mixing, and the kit is used for detecting porphyromonas gingivalis. The technical problem that a mainstream P.g bacterium detection method in the prior art cannot meet clinical efficient and accurate detection requirements is solved.

The invention belongs to the technical field of biology, and discloses a preparation method of an intestinal plexus patch, which comprises the following steps: killing an intestinal tract donor, fixing intestinal tissue segments of duodenum, jejunum, ileum or colon by using paraformaldehyde, and dehydrating to obtain dehydrated intestinal tissue segments; washing the dehydrated intestinal tissue section and removing mesentery, fat and Pari's lymph nodes attached to the jejunum, cutting an intestinal mass of about 4-6mm perpendicular to the intestinal tissue section, flatly laying the intestinal mass on a glass slide, dropwise adding a PBS (Phosphate Buffer Solution) of Triton X-100, fixing the intestinal mass by using a smooth surface of a pair of tweezers, stripping muscle tissues along the annular muscle direction, and drying the intestinal mass in a drying oven. The intestinal slices with intermuscular nerve plexus are obtained; finally, the intestinal piece with the intermuscular nerve plexus is cleaned, then fluorescent staining and piece sealing are conducted, and the mouse intestinal nerve plexus patch is obtained. The preparation method of the mouse intestinal nerve plexus patch has the advantages of being convenient, rapid and the like.

The invention discloses a novel styrene-acrylonitrile neutron / gamma discrimination plastic scintillator and a preparation method and application thereof. The plastic scintillator is composed of a mixed matrix, a main fluorescent dye and a secondary fluorescent dye, the mixed matrix is styrene-acrylonitrile (ABN), the main fluorescent dye is 2, 5-diphenyl oxazole (PPO), and the secondary fluorescent dye is 9, 10-diphenyl anthracene (DPA). The prepared plastic scintillator uses the mixed matrix, the traditional scintillator usually focuses on the influence of the matching of primary and secondary fluorescent dyes on the plastic scintillator, which is only in the transfer direction of debugging matrix excitation energy, and the innovation of the double mixed matrix can explore another way and expand thinking for researching how to improve the light yield of the plastic scintillator. Meanwhile, the addition of acrylonitrile improves the transparency and hardness of the plastic scintillator, and the stability is also greatly improved.

The invention provides a method for loading a nucleic acid template before sequencing, a method for carrying out visual imaging analysis on the loaded nucleic acid template before sequencing and related applications of the nucleic acid template and the method. Specifically, the method for loading the nucleic acid template comprises the following steps: 1) loading the nucleic acid template to the surface of a solid support; 2) combining a fluorescent dye with the nucleic acid template; and (3) removing the uncombined fluorescent dye by adopting a cleaning reagent. Furthermore, the method also comprises the following steps: removing the fluorescent dye combined to the nucleic acid template by using a rinsing reagent; and carrying out sequencing pretreatment on the nucleic acid template by using a plurality of reagents after cleaning and before rinsing. Meanwhile, the invention also provides a method for analyzing the loaded nucleic acid template before sequencing based on the loading method, namely photographing and observing after the steps. By means of the analysis method, multiple steps of the sequencing pretreatment stage can be effectively monitored, quality inspection is conducted on all the stages, faults are confirmed in time, and then the one-time off-machine success rate is increased.

The invention discloses a xanthene nitroreductase-responsive fluorescent dye compound as well as a preparation method and application thereof, and belongs to the technical field of xanthene derivatives. The fluorescent dye compound can be used for quickly and specifically recognizing overexpressed nitroreductase in tumor cells; after the fluorescent probe acts with nitroreductase, the fluorescence intensity of the fluorescent probe at 718 nm is obviously enhanced, and the fluorescent probe has excellent targeting capability on mitochondria; meanwhile, under the excitation of illumination with the specific wavelength of 660 nm, an acting product of the fluorescent dye compound and nitroreductase can efficiently generate reactive oxygen species (ROS), and then the effect of specifically killing tumor cells is achieved. The xanthene nitroreductase response type fluorescent dye compound provided by the invention can achieve the goal of integration of diagnosis and treatment of solid tumors, and has important clinical application value.

The invention belongs to the field of detection, and discloses a method for detecting staphylococcus aureus in bulk ready-to-eat food through semi-quantitative developing, which comprises the following steps: designing a specific primer aiming at a tuf gene of staphylococcus aureus; dNA is extracted from a bulk instant food sample to be detected to serve as a template; s2, template DNA is added into an isothermal amplification reaction system for a recombinase-mediated isothermal nucleic acid amplification reaction, wherein the isothermal amplification reaction system comprises the specific primer in the step S1 and SYBR Green I fluorescent dye; after the amplification reaction is completed, a color change judgment result of a reaction system is observed: yellow green fluorescence is judged to be positive under an ultraviolet lamp, orange is judged to be negative under the ultraviolet lamp, and DNA amplification only needs 15 minutes; amplification and detection are completed in one tube and one step at the same time, and the detection result can be accurately, simply, conveniently and rapidly judged according to the presence or absence of an S-shaped curve and the change of the color of a reaction system.

The application provides a detection method and application of miRNA and analogs thereof, and relates to the field of nucleic acid detection. The application designs probe 1 and probe 2 aiming at target miRNA and miRNA analogs; the probes combine with a part of miRNA respectively, probe 2 can be combined to a solid phase carrier such as a chip or a microsphere, and probe 1 is modified with signal labeling materials such as a fluorescent dye or biotin; after the target miRNA or miRNA analog is mixed with probe 1 and probe 2 and incubated, the probe 2 can not be hybridized with the miRNA analog by optimizing the hybridization temperature, only the target miRNA is hybridized and captured, and the detection specificity is high.

The invention relates to the field of single-molecule gene sequencing, in particular to a composite nucleotide probe based on a nucleic acid nanostructure and application of the composite nucleotide probe. The structure of the composite fluorescent nucleotide probe provided by the invention is a multi-level structure, the multi-level structure respectively comprises a nano nucleic acid molecule, streptavidin and a biotin-nucleoside polyphosphate compound from inside to outside, and the nano nucleic acid molecule, the streptavidin and the biotin-nucleoside polyphosphate compound are connected through biotin. The nucleic acid chain, biotin modification and fluorescent dye molecule modification assembled into the nucleic acid nanostructure can be ordered and synthesized by commercial synthesis companies, the price is low, and synthesis is rapid and convenient; the three-dimensional branched connecting molecules can fully disperse the dendritic macromolecules with large volumes in a three-dimensional space. The planar branched connecting molecule is used for connecting the nucleoside polyphosphate and the polyethylene glycol dispersing element, so that the distance between the nucleoside polyphosphate and the polyethylene glycol is relatively short, the polyethylene glycol can conveniently separate and protect the nucleoside polyphosphate, and the diffusion effect of the nucleoside polyphosphate in an aqueous solution is improved.

The invention discloses an identification kit and an identification system for a pathogenic T cell subset of IgA nephropathy, and belongs to the technical field of nephropathy detection.According to the identification kit, the identification of the pathogenic T cell subset in peripheral blood of the IgA nephropathy is realized by adopting a fluorescent dye labeled antibody combination, and the antibody combination comprises a CD4 fluorescent antibody, a CD103 fluorescent antibody and an ITGB1 fluorescent antibody. The antibody combination designed by the invention can detect a pathogenic T cell subset in peripheral blood of IgA nephropathy, the T cell subset is in negative correlation with a renal function index eGFR, is in positive correlation with severity of E lesion and T lesion in IgA nephropathy kidney pathological injury oxford typing, and can be used as a significant predictive factor for reduction of eGFR and severity of E lesion and T lesion. The method has an important guiding value for real-time monitoring and prognosis prediction of the IgAN, and opens up a new view for clinical management of the IgAN.

The present invention relates to a measurement device for analyzing cells, the measurement device comprising: an electric measurement unit that electrically measures cells; a first optical measurement unit that optically measures cells; a second optical measurement unit that optically measures hemoglobin; a sample preparation unit that mixes a first fluorescent dye and a second fluorescent dye with a specimen to prepare a measurement sample; and an analysis unit that provides a measurement result of the measurement sample. The first optical measurement unit measures an optical signal including at least one of a first fluorescent signal generated from the first fluorescent dye and a second fluorescent signal generated from the second fluorescent dye. The analysis unit refers to the optical signal and classifies cells by executing an analysis based on differences in staining characteristics and fluorescence characteristics of the fluorescent dyes.

The invention discloses a label-free fluorescent aptamer sensor and a method for detecting beta-zearalenol by using the label-free fluorescent aptamer sensor. The label-free fluorescent aptamer sensor consists of a beta-zearalenol aptamer and a fluorescent dye, the nucleotide sequence of the beta-zearalenol aptamer is as shown in SEQ ID NO: 1; the beta-zearalenol aptamer can form a secondary structure which is specifically combined with the orange fluorescent dye in a free state, so that a fluorescence signal of the fluorescent dye is remarkably enhanced; when the beta-zearalenol aptamer is specifically combined with the target beta-zearalenol, the conformation of the beta-zearalenol aptamer is changed, so that the fluorescent dye is dissociated from the aptamer, and further the fluorescent signal of the beta-zearalenol aptamer is weakened or quenched. The quantitative analysis of beta-ZOL can be realized by detecting the change of the fluorescence signal, the detection is rapid, and the method is suitable for rapid screening of beta-ZOL in food, feed and agricultural products, and has a wide application prospect in the field of rapid detection of food safety.

The invention relates to the technical field of medical data processing, and discloses a blood cell analyzer for tumor cell recognition and a method thereof, and the method comprises the following steps: adding epithelial-mesenchymal transition phenotype specific fluorescent dye for double staining; focusing the dyed sample into a single-row liquid flow, and enabling the single-row liquid flow to sequentially pass through a detection area; synchronously collecting a multispectral photoacoustic signal, a laser scattering signal and an impedance signal of the cells in the liquid flow; carrying out fusion processing on the collected multi-dimensional signals, and extracting morphological characteristics, biochemical characteristics and acoustic characteristics of the cells; the extracted features are input into a pre-trained improved convolutional neural network model, a tumor cell recognition result and type judgment are output, and the types comprise an epithelial type, a mesenchymal type or a mixed type; and outputting a detection report. According to the invention, automatic, high-precision and rapid identification of tumor cells in a blood sample is realized, the detection cost is reduced, and a reliable basis is provided for early screening and diagnosis of tumors.

This invention belongs to the field of lipid content detection technology and discloses a rapid detection method for rubber latex lipid content based on fluorescent probe labeling. The method includes: pretreating and diluting latex samples; staining with a lipid fluorescent dye; collecting fluorescence signals from the stained latex samples using a multifunctional ELISA plate; selecting latex lipids of different masses as standard samples for lipid quantification and collecting fluorescence signals using the same parameters as the sample detection; performing linear fitting with latex lipid mass on the x-axis and fluorescence value on the y-axis to obtain a linear equation for latex lipids; and substituting the measured latex fluorescence signal into the linear equation to calculate the latex lipid content. This invention applies a fluorescence detection method to the detection of latex lipid content in natural rubber, an industrial raw material, demonstrating the feasibility of this method for latex lipid content detection and ensuring accurate and rapid detection of latex lipid content in natural rubber, an industrial raw material.

The invention relates to the technical field of fluorescent dye preparation, in particular to an organic fluorescent dye and a preparation method thereof.The preparation method comprises the following steps that m-diethylaminophenol and Meldrum's acid are catalyzed in an ethanol-water solvent through a supported catalyst and stirred to react in an oil bath, and an intermediate is obtained through acidification crystallization after cooling; and heating the intermediate, anhydrous potassium carbonate and ethyl iodoacetate in N, N-dimethylformamide under the protection of nitrogen to carry out alkylation reaction, and carrying out recrystallization, saponification hydrolysis and purification on the reaction liquid to obtain the organic fluorescent dye coumarin 343. The supported catalyst prepared by the invention shows good catalytic performance, stability and recoverability in the preparation reaction of the organic fluorescent dye.

The application belongs to the technical field of molecular imaging and nanobody of tumor diagnosis and treatment, and discloses a Trop2 targeted nanobody fluorescent probe and a preparation method and application thereof. The nanobody T4 or ABDT4 capable of specifically recognizing TROP2 is connected with near-infrared two-region fluorescent dye through a chemical coupling mode to obtain a nanobody fluorescent probe with TROP2 targeting capability. The application realizes selective recognition at a molecular level by introducing the nanobody capable of specifically recognizing TROP2, which is helpful to improve the fluorescent contrast between tumors and normal tissues. Stable probe products are obtained through a controllable coupling and purification process, which is beneficial to repeated preparation and subsequent popularization and application.

The invention provides a Motixazotide-nitrogen mustard conjugate and a preparation method and application of a fluorescent probe of the Motixazotide-nitrogen mustard conjugate, and belongs to the field of polypeptide preparation and biological medicine. According to the present invention, a solid phase polypeptide synthesis method is adopted to covalently link a DNA alkylation reagent nitrogen mustard and a CXCR4 targeting peptide Motixazotide, and further couple with a fluorescent dye so as to successfully prepare a series of novel conjugates and fluorescent probes thereof; experiments prove that the Motixazotide-nitrogen mustard conjugate and the fluorescent probe thereof prepared by the invention can be used for remarkably improving the anti-tumor activity of nitrogen mustard and the targeting property of the nitrogen mustard to tumor cells. Meanwhile, the rhodamine B labeled dinitrogen mustard conjugate BCCR has a specific targeting effect on a CXCR4 receptor and a dual targeting effect on a tumor cell nucleus. The conjugate realizes real-time tracing of the whole process of tumor targeting, cell delivery and nuclear localization, and provides a powerful tool for curative effect evaluation and mechanism research, so that the conjugate has good clinical transformation prospect and application value.

A fluorescent dye, as well as a preparation method and uses thereof, wherein the fluorescent dye is sensitive and specific to viscosity and has low background fluorescence; it can also be used as a fluorescent activated and lighted probe used for fluorescent labeling, quantification or monitoring of protein, enzymes or nucleic acid.

The application provides a rhodamine bacterial lipid droplet membrane fluorescent dye and synthesis and application thereof. The fluorescent dye is based on the affinity of a long carbon chain connected to a nitrogen atom of rhodamine to lipids, the affinity of a positively charged open-loop rhodamine to a negative potential lipid membrane, and the enhancement of a benzene ring to TICT to reduce the background of non-lipid droplet membrane sites. A dye (C4, C6, C8) capable of positioning on a bacterial lipid droplet membrane is designed and synthesized, and the structural formula is shown in formula (1), wherein n is 2, 4 or 6. The dye realizes the lipid droplet membrane imaging of Bacillus cereus, Rhodococcus opacus , Rhodococcus jostii RHA1.

The invention belongs to the technical field of microbiological detection, and particularly relates to a method for rapidly detecting the total number of microbial colonies, which comprises the following steps: (1) mixing a sample to be detected with a diluent to obtain a sample solution; (2) centrifuging the sample liquid to remove supernate, preparing a suspension by using a liquid culture medium for precipitation, adding a fluorescent dye, and uniformly mixing to obtain a mixed solution; (3) generating water-in-oil liquid drops from the mixed solution through a microfluidic liquid drop technology; (4) culturing the liquid drops in an incubator for a period of time; and (5) scanning the cultured liquid drops with exciting light, detecting the total number of the liquid drops and the fluorescence intensity of each liquid drop at the maximum emission wavelength, and then calculating the concentration of the viable bacteria through a Poisson distribution formula. Microorganisms in a sample are divided into single bacterium liquid drops by adopting a microdroplet generation technology, and the total number of the microorganisms is detected by adopting a fluorescence labeling technology principle and a fluorescence scanning counting technology, so that the total number of the microorganisms in the sample is rapidly and accurately detected.

This invention discloses a boron difluoride complex containing non-alternating conjugated ligands, its preparation method, and its applications. The boron difluoride complex is a compound of formula (I) or a salt thereof; wherein R is C 1～4 Alkyl, halogen, cyano, pinacol borate ester, formaldehyde, nitro, phenyl, C 1～4 Alkoxycarbonyl, C 1～4 Alkyloxy, C 1～3 One or more alkoxy groups. The fluorescent dye has a simple synthesis process, mild reaction conditions, low synthesis cost, high yield, and low toxicity, making it suitable for large-scale industrial production.

This invention relates to improved methods for identifying carbohydrate composition and determining compositional patterns of carbohydrate mixtures. Based on advanced internal standards, it utilizes novel fluorescent dyes combined with highly efficient separation techniques to determine accurate and highly reproducible migration and retention time indices. The highly efficient separation techniques include highly sensitive capillary (gel) electrophoresis or (ultra) high-performance liquid chromatography. It also relates to automated analytical methods for determining and / or identifying compositional patterns of carbohydrates and / or carbohydrate mixtures, using at least first and second fluorescent labels to respectively label migration / retention time aligned standards and samples or different samples, wherein at least one fluorescent dye is a compound as defined herein. This invention also relates to kits or systems for determining and / or identifying compositional patterns of carbohydrate mixtures, providing carbohydrate dye conjugates comprising dyes as defined herein for use in the methods of this invention, the dye having the following formula A or B:

The present invention provides for water-soluble mono- and dicationic fluorescent dyes with the latter exhibiting stable fluorescence at elevated temperatures. The present invention also provides for methods for the production of the fluorescent dyes and for using these dyes in biological assays such as multiplexing qPCR and tissue staining.

The application discloses a kind of steam ablation real-time evaluation device based on fluorescent 2D imaging, comprising: steam ablation module, fluorescent camera and mobile terminal;With the high-temperature-resistant characteristic fluorescent dye is dissolved in the water for ablation according to specific proportion, then this contains fluorescent dye and is injected into the steam ablation module inside ablation water;Then, using mobile terminal to set the key parameters of steam ablation module, when steam is acted on target tissue by steam ablation needle, fluorescent camera can capture the diffusion range and distribution of steam containing fluorescent dye in tissue in real time, the data obtained will be quickly transmitted to mobile terminal;Finally, on mobile terminal device, these data will be further processed to reconstruct actual coagulation area image, fusion image, color scale image and binary image in steam ablation process, so as to realize the visualization 2D real-time curative effect evaluation in steam ablation operation process.The application determines ablation tissue boundary by obtaining steam radiation fluorescent image with fluorescent dye, and accurately evaluates ablation effect.

The invention discloses a multiple PCR screening method for CYP2C19 genotyping. The multiple PCR screening method comprises the following steps: DNA extraction: extracting a target DNA sample from blood through a lysis method; pCR amplification: mixing the DNA sample, a primer, nuclease, a reaction buffer solution, dNTPs, a fluorescent dye and a fluorescence labeling probe, carrying out PCR amplification, and carrying out electrophoresis detection; s2, putting the PCR reaction solution detected in S2 into a reaction tube, then putting the reaction tube into a fluorescent quantitative PCR instrument, and collecting a fluorescent signal at 75 DEG C; and judging a result. According to the scheme, the detection method is adopted for detection, the obtained detection result is high in stability, and the drug agency conditions corresponding to CYP2C19 genotypes in different human bodies can be rapidly and accurately judged, so that subsequent treatment is facilitated. Through setting of PCR amplification parameters in the scheme, the detection accuracy can be improved, meanwhile, an amplification result test is carried out after amplification, it is guaranteed that all products entering a tester are successfully amplified, and the experiment efficiency and accuracy are improved.

The present application belongs to the technical field of intelligent coating, and relates to a composite coating material with fluorescent self-indication function for micro stress detection and a preparation method and application thereof. The present application realizes high sensitivity detection of micro cracks by adding fluorescently labeled microcapsules capable of breaking at the crack and releasing fluorescent dyes at the fixed point, and effectively avoids the adverse effects of microcapsule introduction on the transparency and flexibility of the coating through refractive index matching, particle size optimization and film thickness design, thereby being suitable for early warning of corrosion risk of various substrates, providing sufficient window period for equipment maintenance and coating repair, and significantly improving the safety and reliability of the protective coating.

The invention provides a nucleic acid molecule capable of being combined with oxytetracycline in a high-affinity mode. The nucleic acid molecule can detect the oxytetracycline with high sensitivity after being labeled with a fluorescent dye. Nucleic acid molecules (SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5) capable of specifically recognizing oxytetracycline are used as affinity ligands, and sensitive detection of oxytetracycline is realized by using nucleic acid molecules marked with fluorescent dye. According to the detection method disclosed by the invention, the detection limit of oxytetracycline reaches nM level, and the sensitivity is high.