Rice protein OsHIPP56 related to plant disease resistance as well as coding gene and application of rice protein OsHIPP56

Abstract

The invention discloses a rice protein OsHIPP56 related to plant disease resistance as well as a coding gene and application of the rice protein OsHIPP56. The invention also provides the application of the OsHIPP56 protein or the biological material related to the OsHIPP56 protein in regulation and control of plant disease resistance. According to the invention, the OsHIPP56 gene is cloned through PCR (Polymerase Chain Reaction); through overexpression of the OsHIPP56 gene in wild type rice, the overexpression of the OsHIPP56 gene can enhance the resistance of rice to rice blast and bacterial leaf blight, which suggests that the OsHIPP56 gene has good application potential and application value in improvement of crop disease resistance.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering, and specifically relates to a rice protein OsHIPP56 related to plant disease resistance and a coding gene and application thereof. Background Art

[0002] Rice is one of the main staple crops in my country. The safe production of rice is crucial to my country's food security. The occurrence of diseases is one of the important factors restricting the safe production of rice. Rice diseases such as rice blast occur all year round in my country and cause rice yield losses every year. Identifying plant disease resistance mechanisms and scientifically and rationally utilizing variety disease resistance are of great significance to controlling rice diseases.

[0003] Heavy metal associated domain (HMA) proteins are also called metal chaperones. This concept comes from the study of bacterial CopZ protein and yeast oxidoreductase (ATX1), and is named because it contains some similar Cys-XX-Cys metal binding motifs and the first loop of the ferroximate-like structural fold (βαββαβ) (Robinson and Winge, 2010). HMA protein is a soluble protein that can use its own structure to transport metal ions, including copper, cadmium, manganese, etc. (Haas et al., 2009; Li et al., 2022; Zhang et al., 2022). HMA proteins in plants are divided into two types according to their structures: one is plant proteins that only contain HMA structures (heavy metal-associated plant proteins, HPPs), and the other is plant proteins that contain both HMA structures and isoprenylation motifs (heavy metal-associated isoprenylated plant proteins, HIPPs) (Suzuki et al., 2002; Barth et al., 2009). The isoprenylation motif of HIPPs proteins is mainly responsible for modifying proteins or interacting with other proteins. At present, 22 HPPs and 45 HIPPs and 10 HPPs and 59 HIPPs have been identified in Arabidopsis and rice, respectively (de Abreu-Neto et al., 2013). HIPPs proteins are conserved in both animals and plants and are involved in plant growth, development, and responses to biotic and abiotic stresses (Tehseen et al., 2010; Freisinger, 2011; de Abreu-Neto et al., 2013; Khan et al., 2019; Zhao et al., 2022). Although some HIPPs genes have been found in plants, there are relatively few studies on the functional identification of HIPPs, and studies on the involvement of HIPPs proteins in plant immune pathways are even more limited. It is urgent to analyze HIPPs genes through genetic and biochemical methods, clarify their molecular functions, and determine how they participate in plant defense response pathways, so as to provide a basis for analyzing the mechanism of action of HIPPs genes in plant disease resistance. Summary of the invention

[0004] In order to solve the above technical problems, the purpose of the present invention is to provide a rice protein OsHIPP56 related to plant disease resistance and its encoding gene and application.

[0005] In a first aspect, the present invention provides the use of OsHIPP56 protein in regulating plant disease resistance;

[0006] The OsHIPP56 protein is a protein shown in any one of the following A1) or A2) or A3) or A4):

[0007] A1) a protein consisting of the amino acid sequence shown in Sequence 2 in the sequence listing;

[0008] A2) A fusion protein obtained by connecting a tag to the N-terminus or / and the C-terminus of the protein shown in Sequence 2 in the sequence list;

[0009] A3) a protein related to plant disease resistance in which one or more amino acid residues of the amino acid sequence shown in Sequence 2 in the sequence list are replaced and / or deleted and / or added;

[0010] A4) is a protein that has 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology with the amino acid sequence defined in any one of A1) to A3) and is associated with plant disease resistance.

[0011] Among them, sequence 2 consists of 336 amino acid residues.

[0012] In order to facilitate the purification of the protein in a), a tag as shown in Table 1 may be connected to the amino terminus or carboxyl terminus of the protein shown in Sequence 2 in the sequence listing.

[0013] Table 1 shows the sequence of tags

[0014] Label Residue sequence Poly-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tag II 8 WSHQ c-myc 10 EQKLISEEDL

[0015] In the protein OsHIPP56 in c) above, the substitution and / or deletion and / or addition of one or several amino acid residues is a substitution and / or deletion and / or addition of no more than 10 amino acid residues.

[0016] The protein OsHIPP56 in the above c) can be artificially synthesized, or its encoding gene can be synthesized first and then expressed biologically.

[0017] The coding gene of the protein OsHIPP56 in the above c) can be obtained by deleting one or several codons of amino acid residues in the DNA sequence shown in SEQ ID NO: 1, and / or performing missense mutation of one or several base pairs, and / or connecting the coding sequence of the tag shown in Table 1 to its 5′ end and / or 3′ end.

[0018] In a second aspect, the present invention provides the use of biological materials related to OsHIPP56 protein in regulating plant disease resistance:

[0019] The biological material related to the OsHIPP56 protein is any one of the following B1) to B8):

[0020] B1) a nucleic acid molecule encoding an OsHIPP56 protein;

[0021] B2) an expression cassette containing the nucleic acid molecule described in B1);

[0022] B3) a recombinant vector containing the nucleic acid molecule described in B1);

[0023] B4) a recombinant vector containing the expression cassette described in B2);

[0024] B5) a recombinant microorganism containing the nucleic acid molecule described in B1);

[0025] B6) a recombinant microorganism containing the expression cassette described in B2);

[0026] B7) a recombinant microorganism containing the recombinant vector described in B3);

[0027] B8) A recombinant microorganism containing the recombinant vector described in B4).

[0028] In the above application, the nucleic acid molecule in B1) is the gene shown in 1) or 2) or 3) or 4) below:

[0029] 1) Its coding sequence is the DNA molecule shown in Sequence 1;

[0030] 2) a DNA molecule derived from rice that has more than 98% homology with the DNA sequence defined in 1) and encodes a protein related to plant disease resistance;

[0031] 3) a DNA molecule that hybridizes with the DNA sequence defined in 1) or 2) under stringent conditions and encodes a protein related to plant disease resistance;

[0032] 4) A DNA molecule that has more than 90% homology with the DNA sequence defined in 1) or 2) and encodes a protein related to plant disease resistance.

[0033] In the above application, the nucleic acid molecule in B1) is the gene shown in 1) or 2) or 3) or 4) below:

[0034] 1) Its coding sequence is the DNA molecule shown in Sequence 1;

[0035] 2) a DNA molecule derived from rice that has more than 98% homology with the DNA sequence defined in 1) and encodes a protein related to plant disease resistance;

[0036] 3) a DNA molecule that hybridizes with the DNA sequence defined in 1) or 2) under stringent conditions and encodes a protein related to plant disease resistance;

[0037] 4) A DNA molecule that has more than 90% homology with the DNA sequence defined in 1) or 2) and encodes a protein related to plant disease resistance.

[0038] In the above application, the nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA, etc. Among them, sequence 1 consists of 1011 nucleotides, and the entire sequence 1 is the coding sequence (ORF) of the OsHIPP56 gene, encoding the protein shown in sequence 2 in the sequence table.

[0039] Those skilled in the art can easily mutate the nucleotide sequence encoding OsHIPP56 of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or higher identity with the nucleotide sequence of OsHIPP56 isolated from the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode OsHIPP56 and have the same function.

[0040] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, or 85% or more, or 90% or more, or 95% or more identity to the nucleotide sequence of the protein composed of the amino acid sequence shown in the coding sequence 2 of the present invention. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0041] The aforementioned 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

[0042] In the above application, the expression cassette (OsHIPP56 gene expression cassette) containing the nucleic acid molecule encoding OsHIPP56 described in B2) refers to a DNA capable of expressing OsHIPP56 in a host cell, and the DNA may include not only a promoter for initiating transcription of OsHIPP56, but also a terminator for terminating transcription of OsHIPP56. Further, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters; tissue, organ and development-specific promoters and inducible promoters. Suitable transcription terminators include, but are not limited to, Agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and nopaline and octopine synthase terminators.

[0043] The plant recombinant expression vector can be constructed with existing plant expression vectors. The plant expression vector includes a binary agrobacterium vector and a vector that can be used for microprojectile bombardment, such as pGreen0029, pCAMBIA3301, pCAMBIA1300, pCAMBIA1301, pBI121, pBin19, pCAMBIA2301, pCG1301 or other derived plant expression vectors. The plant expression vector can also include the 3' end non-translated region of the foreign gene, i.e., include polyadenylic acid signal and any other DNA fragments that participate in mRNA processing or gene expression. The polyadenylic acid signal can guide polyadenylic acid to join the 3' end of the mRNA precursor. When the gene is used to construct a recombinant expression vector, any enhanced, constitutive, tissue-specific or inducible promoter can be added before the transcription start nucleotide, such as the cauliflower mosaic virus (CaMV) 35S promoter, the ubiquitin gene Ubiquitin promoter (pUbi), the stress-induced promoter Rd29A, etc., which can be used alone or in combination with other plant promoters; in addition, when the gene of the present invention is used to construct a recombinant expression vector, an enhancer can also be used, including a translation enhancer or a transcription enhancer. These enhancer regions can be ATG start or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive, and can be natural or artificially synthesized. The translation start region can come from the transcription start region or the structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes, antibiotic markers with resistance, or chemical reagent resistance marker genes, etc. It is also possible to directly screen transformed plants by adversity without adding any selection marker genes.

[0044] In the above application, the vector can be a plasmid, cosmid, phage or virus vector. In the present invention, the recombinant vector is specifically a vector obtained by inserting the ubiquitin promoter and OsHIPP56 gene between the Cla I restriction site and the Hind III restriction site of the pCAMBIA1301 vector.

[0045] In the above application, the microorganism can be yeast, bacteria, algae or fungi, such as Agrobacterium. In the present invention, the Agrobacterium used is specifically EHA105.

[0046] In a third aspect, the present invention provides the use of the OsHIPP56 protein described in the first aspect or the related biological material described in the second aspect in improving plant disease resistance;

[0047] Or, use of the OsHIPP56 protein described in the first aspect or the related biological material described in the second aspect in cultivating plants with high disease resistance;

[0048] Or, use of the OsHIPP56 protein described in the first aspect or the related biological material described in the second aspect in plant breeding. The purpose of the breeding is to cultivate disease-resistant plant varieties.

[0049] In the above application, the disease resistance is resistance to rice blast and / or resistance to rice bacterial leaf blight.

[0050] In the above application, the regulating plant disease resistance is to improve plant disease resistance. The disease resistance may be resistance to rice blast and / or resistance to rice bacterial blight.

[0051] The regulation of plant disease resistance is embodied in that: when the OsHIPP56 protein content and / or activity in the plant increases or the expression level of the OsHIPP56 gene increases, the disease resistance of the plant increases; when the OsHIPP56 protein content and / or activity in the plant decreases or the expression level of the OsHIPP56 gene decreases, the disease resistance of the plant decreases. When the OsHIPP56 protein content and / or activity in the plant increases or the expression level of the OsHIPP56 gene increases, the improvement of the plant's disease resistance is specifically embodied in the following m1) or m2):

[0052] m1) after being inoculated with pathogens, the length of the diseased spots on the plant is reduced; the pathogens are rice blast fungus (such as rice blast fungus race P007) or bacterial leaf blight fungus (such as rice bacterial leaf blight strain PXO99);

[0053] m2) increasing the expression level of plant defense-related genes, wherein the defense-related genes are specifically genes PR2 and / or PR8.

[0054] In a fourth aspect, the present invention provides a method for cultivating a transgenic plant with improved disease resistance, comprising the following steps: increasing the content and / or activity of the OsHIPP56 protein described in the first aspect in a recipient plant to obtain a transgenic plant; the disease resistance of the transgenic plant is higher than that of the recipient plant;

[0055] Alternatively, the present invention provides a method for cultivating transgenic plants with improved disease resistance, comprising the following steps: increasing the expression of the OsHIPP56 protein encoding gene described in the first aspect in a recipient plant to obtain a transgenic plant; the transgenic plant has higher disease resistance than the recipient plant.

[0056] In the above method, the method for increasing the content and / or activity of OsHIPP56 protein in the recipient plant is to increase the expression of the gene encoding the OsHIPP56 protein in the recipient plant.

[0057] In the above, the expression of the OsHIPP56 protein encoding gene in the recipient plant is increased by introducing the protein encoding gene into the recipient plant;

[0058] Alternatively, the nucleotide sequence of the gene encoding the protein is the DNA molecule shown in Sequence 1.

[0059] In the above method, the introduction of the gene encoding the OsHIPP56 protein into the recipient plant is to introduce a recombinant vector carrying the gene encoding the OsHIPP56 protein into the recipient plant, specifically, the recipient plant tissue or cell can be transformed using conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated, and the like, and the transformed plant tissue is cultivated into a plant. The recombinant vector can be a vector obtained by inserting the ubiquitin promoter and the OsHIPP56 gene between the Cla I restriction site and the Hind III restriction site of the pCAMBIA1301 vector.

[0060] In the above method, the transgenic plant is understood to include not only the first generation transgenic plant obtained by transforming the OsHIPP56 gene into a recipient plant, but also its progeny. For transgenic plants, the gene can be propagated in the species, or the gene can be transferred into other varieties of the same species, especially commercial varieties, using conventional breeding techniques. The transgenic plant includes seeds, callus, whole plants and cells.

[0061] In the above, the disease resistance is resistance to rice blast and / or resistance to rice bacterial blight.

[0062] The disease resistance of the transgenic plant is higher than that of the recipient plant, which is embodied in the following n1) or n2):

[0063] n1) after inoculation with pathogens, the length of the lesions of the transgenic plants is smaller than that of the recipient plants;

[0064] n2) The expression level of defense-related genes in the transgenic plant is higher than that in the recipient plant.

[0065] Further, the pathogen is rice blast fungus (such as rice blast fungus race P007) or bacterial leaf blight fungus (such as rice bacterial leaf blight strain PXO99);

[0066] The defense-related genes are genes PR2 and / or PR8.

[0067] In the above application or method, the recipient plant is a monocot or a dicot; the monocot can be rice, corn, wheat, etc. In the present invention, the plant is a monocot, the monocot is rice, and the rice variety can be Aichi Asahi.

[0068] In a fifth aspect, the present invention provides the recombinant vector described in the second aspect.

[0069] The present invention clones the OsHIPP56 gene using PCR technology and performs functional analysis. The expression of the OsHIPP56 gene in the OsHIPP56 overexpressing plant is upregulated, and the disease resistance to rice blast and bacterial blight is enhanced compared with the wild type without affecting the agronomic traits of rice. The OsHIPP56 overexpressing plant has increased disease resistance to rice blast and bacterial blight, and has application prospects in increasing plant yield. The present invention provides a basis for using genetic engineering means to carry out molecular breeding to increase crop yield or enhance plant disease resistance, and has potential application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] Figure 1 The growth phenotypes of OsHIPP56 overexpression (OsHIPP56-OE) plants and wild type (WT); A is the phenotype under field (Beijing) planting conditions; the white box represents 10 cm; B is the relative expression level of OsHIPP56 gene in OsHIPP56-OE and wild type (WT) detected by real-time quantitative PCR (**: P < 0.01, Student's t test); WT is the wild type.

[0071] Figure 2 are the phenotypes of OsHIPP56-OE and wild type (WT) inoculated with pathogens; A is the disease result of spray inoculation with rice blast race P007; B is the number of spores in the lesions measured after spray inoculation with rice blast race P007 (the data are the average of 6 lesion areas, **: P<0.01, Student's t test); C is the disease result of inoculation with rice bacterial leaf blight pathogen PXO99; D is the lesion length measured after inoculation with rice bacterial leaf blight pathogen PXO99 (the data are the average of 6 lesion lengths, **: P<0.01, Student's t test).

[0072] Figure 3 The relative expression results of two defense genes in OsHIPP56-OE and wild type (WT) were detected by real-time quantitative PCR (**: P<0.01, Student's t test).

[0073] Figure 4 Comparison results of yield traits between OsHIPP56-OE and wild type (WT); A is the number of tillers; B is the thousand-grain weight; C is the number of grains per ear (ns: P ≥ 0.05, Student's t test).

[0074] Figure 5 The results show the subcellular localization of OsHIPP56; VirD2NLS is a nuclear marker, and PIP2A is a plasma membrane marker. DETAILED DESCRIPTION

[0075] The following examples are provided for a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified. The quantitative tests in the following examples were repeated three times, and the results were averaged.

[0076] The rice blast fungus race P007 in the following examples is recorded in the document "Physiological races of rice blast fungus and their toxicity (Fan Jinghua, Zhou Huiping, Wang Honghai, et al. Physiological races of rice blast fungus and their toxicity [J]. Plant Protection, 2005, 31(6): 29-31.)", which is available to the public from China Agricultural University. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0077] The rice bacterial blight strain PXO99 in the following example is recorded in the document “Identification and preliminary positioning of a new gene for resistance to bacterial blight in small-grain wild rice (Guo Sibin, Zhang Duanpin, Lin Xinghua. Identification and preliminary positioning of a new gene for resistance to bacterial blight in small-grain wild rice [J]. Chinese Agricultural Science, 2010, 43(13): 2611-2618.)” and is available to the public from China Agricultural University. The biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0078] Example 1. Obtaining OsHIPP56 gene overexpression (OE) plants and identifying their phenotypes

[0079] The gene involved in this embodiment is the OsHIPP56 gene in the rice variety Aichi Asahi, whose nucleotide sequence is Sequence 1 in the sequence table, encoding the protein (OsHIPP56) shown in Sequence 2 in the sequence table. Sequence 1 consists of 1011 nucleotides, and Sequence 2 consists of 336 amino acids.

[0080] 1. Acquisition and identification of OsHIPP56-OE plants

[0081] 1. Construction of recombinant expression vector pCAMBIA1301-Ubi-OsHIPP56

[0082] (1) Using the PCR method, primer 5'-ata gagctc GTGCAGCGTGACCCGGT-3' (the underlined part is the Sac I site) and 5'-ata ggatccAAGTAACACCAAACAACAGGGT-3' (the underlined part is the Bam HI site), using the binary vector pUbiGUSPlus (Purudin Biotechnology (Beijing) Co., Ltd.) as a template, amplify the ubiquitin promoter region. After the 1992bp amplification product is recovered, it is connected to the pMD18-T simple (TaKaRa) vector and sequenced. The plasmid that is verified to be correct by sequencing is double-digested with Sac I and Bam HI, and the digestion product is recovered and connected to the Sac I and Bam HI double-digestion site of the pCAMBIA1301 vector (Purudin Biotechnology (Beijing) Co., Ltd.) to obtain pCAMBIA1301-Ubi.

[0083] (2) Using the PCR method, primers OE-HIPP56-F (5'-ATA atcgat ATGGCCTCCGGCTCAGA-3', the underlined part is the Cla I site) and OE-HIPP56-R (5'-TAT aagctt CATCACACTGCAAGAATTAG-3', the underlined part is the Hind III site), and the 1008bp open reading frame sequence (SEQ ID NO: 1) of the OsHIPP56 gene was amplified from the cDNA of the rice variety Aichi Asahi (obtained by reverse transcription of leaf RNA). The 1008bp PCR product was recovered and connected to the pMD-18T vector (TaKaRa). After the sequencing was correct, it was double-digested with Cla I and Hind III, and the digested product was connected to the plant expression vector pCAMBIA1301-Ubi in step (1), thus obtaining the recombinant expression vector pCAMBIA1301-Ubi-OsHIPP56 containing the OsHIPP56 gene.

[0084] The above-mentioned recombinant expression vector pCAMBIA1301-Ubi-OsHIPP56 is a vector obtained by inserting a fragment containing the ubiquitin promoter and the OsHIPP56 gene between the Cla I and Hind III restriction sites of the pCAMBIA1301 vector. In the recombinant expression vector pCAMBIA1301-Ubi-OsHIPP56, the ubiquitin promoter drives the expression of the OsHIPP56 gene.

[0085] In the process of constructing the recombinant expression vector pCAMBIA1301-Ubi-OsHIPP56, the OsHIPP56 gene shown in sequence 1 in the artificially synthesized sequence table can also be used as a template.

[0086] 2. Obtaining OsHIPP56 gene overexpression rice

[0087] The recombinant expression vector pCAMBIA1301-Ubi-OsHIPP56 constructed in the above step 1 was introduced into embryonic callus of rice variety Oryza sativa L. cv. Aichi asahi (hereinafter referred to as wild-type rice) through Agrobacterium EHA105 (Prudin Biotechnology (Beijing) Co., Ltd.) to obtain transgenic rice in the T0 generation transformed with pCAMBIA1301-Ubi-OsHIPP56. For embryonic callus and specific transformation methods, see the article "Yi Zili, Cao Shouyun, Wang Li, Chu Chengcai, Li Xiang, He Shijie, Tang Zuoshun, Zhou Puhua, Tian Wenzhong, Study on Improving the Frequency of Agrobacterium Transformation of Rice, Acta Genetica Sinica, 2001, 28(4): 352-358".

[0088] 3. Identification of OsHIPP56 gene overexpressing rice

[0089] (1) Preliminary identification by PCR

[0090] Extract genomic DNA from the T0 generation transgenic rice transformed with pCAMBIA1301-Ubi-OsHIPP56 obtained in step 2, and use primers 5'-GCTGCGCCGATGGTTTCTACAA-3' and 5'-CACGGCCTCCAGAAGAAGATGTTG-3' to detect the neomycin phosphotransferase gene (HPTII) fragment in the transgenic rice. The transgenic positive rice plant is the one with a 514 bp PCR amplification product.

[0091] After the above PCR identification, the three transgenic positive rice lines transformed with pCAMBIA1301-Ubi-OsHIPP56 were respectively named T0 generation OsHIPP56-transformed rice lines OE-1, OE-7 and OE-9.

[0092] (2) Phenotypic identification of rice OsHIPP56-OE plants

[0093] Seeds were collected from the T0 generation OsHIPP56 transgenic rice lines OE-1, OE-7 and OE-9, sown and continuously cultured to obtain T2 generation OsHIPP56 transgenic rice lines, i.e., homozygous OsHIPP56-OE plants.

[0094] The phenotypes of homozygous OsHIPP56-OE plants and wild-type Aichi Asahi are shown in Figure 1 As shown in A, in the field, OsHIPP56-OE showed normal plant growth on the 125th day after planting, which was no different from the wild type phenotype.

[0095] (3) Transcription level analysis (RNA expression)

[0096] Fluorescence quantitative PCR analysis was performed using the T0 generation OsHIPP56 transgenic rice lines OE-1, OE-7, OE-9 and wild-type rice Aichi Asahi obtained above as materials. The expression of the OsHIPP56 gene in OsHIPP56-OE and wild-type rice Aichi Asahi was analyzed by fluorescence quantitative PCR. The primers for amplifying the OsHIPP56 gene were qRT-OsHIPP56-F and qRT-OsHIPP56-R in Table 1; the ACTIN1 gene was used as an internal reference, and the amplification primers were qRT-OsRAc1-F and qRT-OsRAc1-R in Table 1. The specific steps are as follows: Take fully expanded leaves from the same part of OsHIPP56-OE and wild-type rice Aichi Asahi, extract total RNA using Trizol reagent method (Invitrogen), use MMLV reverse transcriptase (TaKaRa) and refer to the corresponding usage method for reverse transcription, and then use real-time fluorescence quantitative PCR technology. According to the usage method provided by the manufacturer (TaKaRa), add SYBR green I fluorescent dye to the PCR system, and use a fluorescence quantitative PCR instrument (ABI 7500, USA) to detect the expression of the OsHIPP56 gene. The primer sequences are shown in Table 2. The experiment was repeated three times. The comparative Ct method was used for data processing, that is, the Ct value is the number of cycles experienced when the fluorescence signal in the PCR tube reaches the set threshold, ΔCt = Ct (test gene) - Ct (ACTIN1), with 2 -ΔCt The values ​​were used to measure the gene transcription levels, and a comparative analysis was performed between the measured genes in OsHIPP56-OE and wild-type rice.

[0097] Table 2 shows the primer sequences of ACTIN1 and OsHIPP56 genes

[0098] Gene name Locus ID Primer name Sequence of items ACTIN1 LOC_Os03g50885 qRT-OsRAc1-F ATCACTGCCTTGGCTCCTA qRT-OsRAc1-R CATCTGCTGGAATGTGCTG OsHIPP56 LOC_Os01g70710 qRT-OsHIPP56-F CTTGTGCTGAGGGTGTCCAT qRT-OsHIPP56-R GGCCGTGACTATGACCTTGT

[0099] The real-time fluorescence quantitative PCR results of OsHIPP56 gene in each test material are as follows: Figure 1 As shown in B, it can be seen from the figure that compared with the non-transgenic wild-type rice Aichi Asahi, the transcription levels of the OsHIPP56 gene in the T0 generation OsHIPP56 transgenic rice lines OE-1, OE-7 and OE-9 obtained by the present invention are significantly improved.

[0100] 4. Inoculation test

[0101] (1) OsHIPP56-OE and wild-type rice Aichixu leaves were in vitro spray-inoculated with rice blast fungus race P007. The specific steps were carried out according to the method in the literature "Fang, W., Liu, C., Zhang, H. et al. Selection of differential isolates of Magnaporthe oryzae for postulation of blast resistance genes. Phytopathology, 2018, 108: 878-884."

[0102] The results are as follows Figure 2 As shown in A and 2B, it can be seen that 120 hours after spray inoculation, the lesion area of ​​OsHIPP56-OE was significantly smaller than that of the wild type, indicating that the resistance of OsHIPP56-OE to rice blast fungus was significantly enhanced.

[0103] (2) OsHIPP56-OE and wild-type rice Aichi Asahi leaves were inoculated with the rice bacterial blight strain PXO99. The specific steps were carried out according to the method in the literature "Zhao, XS; Qiu, TC; Feng, HJ et al. A novel glycine-rich domain protein, GRDP1, functions as a critical feedback regulator for controlling cell death and disease resistance in rice. Journal of Experimental Botany, 2021, 72, 608-622."

[0104] The results are as follows Figure 2 As shown in C and 2D, it can be seen that 2 weeks after inoculation, the lesion length of OsHIPP56-OE was significantly smaller than that of the wild type, indicating that the resistance of OsHIPP56-OE to bacterial blight pathogen was significantly enhanced.

[0105] 5. Detection of defense gene expression

[0106] The expression of defense-related genes PR2 and PR8 in OsHIPP56-OE and wild-type rice Aichi Asahi was analyzed by fluorescence quantitative PCR, with rice ACTIN1 gene as internal reference. The primer sequences are shown in Table 3. The detection method and data processing are the same as 3 in step 1 of Example 1.

[0107] Table 3 shows the primer sequences of ACTIN1 and defense genes

[0108] Gene name Locus ID Primer name Sequence of items ACTIN1 LOC_Os03g50885 qRT-OsRAc1-F ATCACTGCCTTGGCTCCTA qRT-OsRAc1-R CATCTGCTGGAATGTGCTG PR2 LOC_Os01g71340 qRT-PR2-F CTGGCATTGGTCCTTGGAGTT qRT-PR2-R CGATGCCGTTGGACTTGTAG PR8 LOC_Os10g28080 qRT-PR8-F TTCATCTGGTCAGCGGATAGC qRT-PR8-R TATCACGACCGTTCGATGGA

[0109] The results are as follows Figure 3 As shown, A is the defense gene PR2, and B is the defense gene PR8; the defense genes PR2 and PR8 in OsHIPP56-OE both showed significant up-regulated expression.

[0110] 2. Identification of Yield Traits of Rice OsHIPP56-OE Plants

[0111] Seeds of T2 transgenic OsHIPP56 rice lines (homozygous OsHIPP56-OE plants) OE-1, OE-7 and OE-9 were sown in the field. After 160 days of growth, the materials with consistent growth and good growth status were counted in the field, including the number of tillers, thousand-grain weight, and the number of full grains per panicle. Each statistics was repeated three times. Wild-type rice (WT) was used as the control.

[0112] The results are as follows Figure 4 As shown, it can be seen that the yield traits of OsHIPP56-OE plants (denoted as OsHIPP56-OE 1, OsHIPP56-OE 7, and OsHIPP56-OE 9 in the figure) are not significantly different from those of wild-type rice Aichi Asahi, indicating that the OsHIPP56 rice overexpression lines OE-1, OE-7, and OE-9 obtained by the present invention have enhanced disease resistance without affecting their own yields.

[0113] Example 2: Subcellular localization of OsHIPP56 protein

[0114] 1. Using PCR method, HIPP56-GFP-F (5'-ata ggtacc ATGGCCTCCGGCTCAGA-3', the underlined part is the Kpn I site) as the forward primer, and HIPP56-GFP-R (5'-aat tctaga ATCACACTGCAAGAATTAG-3', the underlined part is the Xba I site) was used as the reverse primer to amplify the partial open reading frame sequence of the OsHIPP56 gene from the cDNA of the rice variety Aichi Asahi.

[0115] 2. After the PCR product obtained in step 1 is recovered, it is connected to the pMD-18T vector (TaKaRa). After the sequencing is correct, it is double-digested with Kpn I and Xba I, and the digested product is connected to the plant subcellular localization expression vector pCG1301 (Prudin Biotechnology (Beijing) Co., Ltd.), and the recombinant expression vector pCG1301-OsHIPP56-GFP containing the OsHIPP56 gene is obtained. The structure of the recombinant expression vector pCG1301-OsHIPP56-GFP is described as follows: the DNA molecule shown in the sequence 1 at positions 1-1008 in the sequence table is inserted between the multiple cloning sites Kpn I and Xba I of the pCG1301 vector. In the recombinant expression vector pCG1301-OsHIPP56-GFP, the promoter driving the expression of the OsHIPP56 gene is the 35S promoter.

[0116] 3. According to the method in the literature "Li, X., 2011, Infiltration of Nicotiana benthamiana Protocol for Transient Expression via Agrobacterium. Bio-protocol Bio101: e95. DOI: 10.21769 / BioProtoc.95" and the literature "Wang, K., Liu, Y. and Li, S., 2013, Bimolecular Fluorescence Complementation (BIFC) Protocol for Rice Protoplast Transformation. Bio-protocol 3(22): e979. DOI: 10.21769 / BioProtoc.979.", the recombinant expression vector pCG1301-OsHIPP56-GFP (denoted as OsHIPP56-GFP in the figure) was transferred into Aichi Asahi rice protoplasts, and the localization of OsHIPP56 protein was observed under a laser confocal microscope.

[0117] The results are as follows Figure 5 As shown in the figure, it can be seen that OsHIPP56 protein is localized in the nucleus and cytoplasm in rice protoplasts.

[0118] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the technical principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of OsHIPP56 protein in regulating plant disease resistance; The OsHIPP56 protein is a protein shown in any one of the following A1) or A2) or A3) or A4): A1) a protein consisting of the amino acid sequence shown in Sequence 2 in the sequence listing; A2) A fusion protein obtained by connecting a tag to the N-terminus or / and the C-terminus of the protein shown in Sequence 2 in the sequence list; A3) a protein related to plant disease resistance in which one or more amino acid residues of the amino acid sequence shown in Sequence 2 in the sequence list are replaced and / or deleted and / or added; A4) is a protein that has 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology with the amino acid sequence defined in any one of A1) to A3) and is associated with plant disease resistance.

2. Application of OsHIPP56 protein-related biomaterials in regulating plant disease resistance: The biological material related to the OsHIPP56 protein is any one of the following B1) to B8): B1) a nucleic acid molecule encoding an OsHIPP56 protein; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1); B4) a recombinant vector containing the expression cassette described in B2); B5) a recombinant microorganism containing the nucleic acid molecule described in B1); B6) a recombinant microorganism containing the expression cassette described in B2); B7) a recombinant microorganism containing the recombinant vector described in B3); B8) A recombinant microorganism containing the recombinant vector described in B4).

3. The use according to claim 2, characterized in that: B1) The nucleic acid molecule is the gene shown in 1) or 2) or 3) or 4) below: 1) Its coding sequence is the DNA molecule shown in Sequence 1; 2) a DNA molecule derived from rice that has more than 98% homology with the DNA sequence defined in 1) and encodes a protein related to plant disease resistance; 3) a DNA molecule that hybridizes with the DNA sequence defined in 1) or 2) under stringent conditions and encodes a plant disease resistance-related protein; 4) A DNA molecule that has more than 90% homology with the DNA sequence defined in 1) or 2) and encodes a protein related to plant disease resistance.

4. Use of the OsHIPP56 protein of claim 1 or the related biological material of claim 2 or 3 in improving plant disease resistance; Or, use of the OsHIPP56 protein described in claim 1 or the related biological material described in claim 2 or 3 in cultivating plants with high disease resistance; Or, use of the OsHIPP56 protein described in claim 1 or the related biological material described in claim 2 or 3 in plant breeding.

5. The use according to any one of claims 1 to 4, characterized in that: The disease resistance is resistance to rice blast and / or resistance to rice bacterial leaf blight.

6. A method for cultivating a transgenic plant with improved disease resistance, comprising the following steps: increasing the content and / or activity of the OsHIPP56 protein of claim 1 in a recipient plant to obtain a transgenic plant; the disease resistance of the transgenic plant is higher than that of the recipient plant; Or, a method for cultivating transgenic plants with improved disease resistance, comprising the following steps: increasing the expression of the OsHIPP56 protein encoding gene of claim 1 in a recipient plant to obtain a transgenic plant; the transgenic plant has higher disease resistance than the recipient plant.

7. The method according to claim 6, characterized in that: The method for increasing the content and / or activity of OsHIPP56 protein in the recipient plant is to increase the expression of the gene encoding the OsHIPP56 protein in the recipient plant.

8. The method according to claim 6 or 7, characterized in that: The disease resistance is resistance to rice blast and / or resistance to rice bacterial blight.

9. The use according to any one of claims 1 to 5 or the method according to any one of claims 6 to 8, characterized in that: The recipient plant is a monocotyledonous plant or a dicotyledonous plant.

10. The recombinant vector according to claim 2.

Images