Rice protein OsFBX388 related to plant disease resistance as well as coding gene and application of rice protein OsFBX388

Abstract

The invention discloses a rice protein OsFBX388 related to plant disease resistance as well as a coding gene and application of the rice protein OsFBX388. The invention provides an application of OsFBX388 protein or a related biological material thereof in regulation and control of plant disease resistance, and also provides a substance for reducing the content or activity of the OsFBX388 protein, or a substance for reducing or inhibiting expression of a coding nucleic acid molecule of the OsFBX388 protein, and any one of the following applications: 1) improving the plant disease resistance; 2) cultivating plants with improved disease resistance; and 3) plant breeding. The OsFBX388 gene has the advantages that the OsFBX388 gene is down-regulated in expression, so that rice can spontaneously generate disease-like spots, the resistance to rice blast and bacterial leaf blight is enhanced, and the OsFBX388 gene has good application potential and application value in improvement of crop disease resistance.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering, and specifically relates to a rice protein OsFBX388 related to plant disease resistance and a coding gene and application thereof. Background Art

[0002] The ubiquitin / 26S proteasome pathway regulates eukaryotic cell processes through post-translational modification of proteins, including plant growth and development (Hu et al. 2014, Vierstra 2009), and the influence of biological and abiotic factors (Kurepa et al. 2009, Zeng et al. 2004). The degradation of proteins by the ubiquitin / 26S proteasome includes three processes: recognition, modification and degradation of target proteins by ubiquitin molecules. The modification process of target proteins by the ubiquitin / 26S proteasome is jointly catalyzed by a cascade reaction mediated by three enzymes: ubiquitin-activating enzyme (E1), ubiquitin-conjugating enzyme (E2) and ubiquitin-ligating enzyme (E3). E3 ubiquitin ligase is mainly responsible for the specific recognition of target proteins and then ubiquitination modification of them. E3 ubiquitin ligases can be divided into multiple types according to the different subunits they consist of. The SCF (SKP1-Cullin1-F-box) complex is one of them, which is composed of SKP1, Cullin1 and F-box proteins (Sadanandom et al. 2012). F-box proteins usually have a conserved F-box motif, and highly conserved motifs are usually composed of a leucine-proline dipeptide and other hydrophobic amino acids, such as valine, isoleucine, and methionine. The motif consists of approximately 40-60 amino acid residues (Abd-Hamid et al. 2020). The protein structure of F-box consists of 3-4 α-helical structures. The N-terminus of the F-box protein domain binds to SKP1, and the C-terminus specifically binds to the target substrate. The diversity of F-box proteins determines the diversity of the SCF complex, and further determines the diversity of E3 ubiquitin ligases. It has been reported that F-box proteins are involved in various aspects of plant growth and development, including seed germination (Majee et al. 2018), root development (Manzano et al. 2012), leaf development (Cui et al. 2016), flowering (Gonzalez-Carranza et al. 2017), pollen recognition (Matsumoto and Tao 2019), light signaling and photoperiod (Song et al. 2014), etc.F-box proteins are also involved in regulating plant hormone synthesis and responses to external biotic or abiotic stresses, including the phenylpropanoid biosynthesis pathway (Yu et al. 2019), abiotic stress (Kepinski and Leyser 2005; Yan et al. 2011; Xu et al. 2014; Li et al. 2016), and biotic stress (Devoto et al. 2002; Cao et al. 2008; Gou et al. 2009; Gou et al. 2012). Although many F-box proteins have been found in plants and their functions are diverse, relatively few studies have been conducted on the involvement of F-box proteins in plant immunity pathways through the ubiquitin / 26S proteasome pathway. It is urgent to analyze F-box genes through genetic and biochemical methods, clarify their molecular functions, and determine how they participate in plant defense response pathways, so as to provide a basis for analyzing the mechanism of action of F-box genes in plant disease resistance. Summary of the invention

[0003] In order to solve the above technical problems, the purpose of the present invention is to provide a rice protein OsFBX388 related to plant disease resistance and its encoding gene and application.

[0004] In a first aspect, the present invention provides the use of OsFBX388 protein or biological materials related thereto in regulating plant disease resistance;

[0005] The OsFBX388 protein is any one of the proteins shown in A1)-A4) below:

[0006] A1) a protein consisting of the amino acid sequence shown in Sequence 2 in the sequence listing;

[0007] A2) A fusion protein obtained by connecting a tag to the N-terminus or / and the C-terminus of the protein shown in Sequence 2 in the sequence list;

[0008] A3) a protein related to plant disease resistance in which one or more amino acid residues of the amino acid sequence shown in Sequence 2 in the sequence list are replaced and / or deleted and / or added;

[0009] A4) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology with the amino acid sequence defined in any one of A1) to A3) and being associated with plant disease resistance;

[0010] Among them, sequence 2 consists of 679 amino acid residues.

[0011] In order to facilitate the purification of the protein in a), a tag as shown in Table 1 may be connected to the amino terminus or carboxyl terminus of the protein shown in Sequence 2 in the sequence listing.

[0012] Table 1 shows the sequence of tags

[0013] Label Residue sequence Poly-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tag II 8 WSHQ c-myc 10 EQKLISEEDL

[0014] In the protein OsFBX388 in c) above, the substitution and / or deletion and / or addition of one or several amino acid residues is a substitution and / or deletion and / or addition of no more than 10 amino acid residues.

[0015] The protein OsFBX388 in the above c) can be artificially synthesized, or its encoding gene can be synthesized first and then expressed biologically.

[0016] The coding gene of the protein OsFBX388 in the above c) can be obtained by deleting one or several codons of amino acid residues in the DNA sequence shown in Sequence 1, and / or performing missense mutation of one or several base pairs, and / or connecting the coding sequence of the tag shown in Table 1 to its 5′ end and / or 3′ end.

[0017] The biological material related to the OsFBX388 protein is any one of the following B1) to B8):

[0018] B1) Nucleic acid molecule encoding OsFBX388 protein;

[0019] B2) an expression cassette containing the nucleic acid molecule described in B1);

[0020] B3) a recombinant vector containing the nucleic acid molecule described in B1);

[0021] B4) a recombinant vector containing the expression cassette described in B2);

[0022] B5) a recombinant microorganism containing the nucleic acid molecule described in B1);

[0023] B6) a recombinant microorganism containing the expression cassette described in B2);

[0024] B7) a recombinant microorganism containing the recombinant vector described in B3);

[0025] B8) A recombinant microorganism containing the recombinant vector described in B4).

[0026] In the above, the nucleic acid molecule described in B1) is the gene shown in 1) or 2) or 3) or 4) below:

[0027] 1) Its coding sequence is the DNA molecule shown in Sequence 1;

[0028] 2) a DNA molecule derived from rice that has more than 98% homology with the DNA sequence defined in 1) and encodes a protein related to plant disease resistance;

[0029] 3) a DNA molecule that hybridizes with the DNA sequence defined in 1) or 2) under stringent conditions and encodes a plant disease resistance-related protein;

[0030] 4) A DNA molecule that has more than 90% homology with the DNA sequence defined in 1) or 2) and encodes a protein related to plant disease resistance.

[0031] In the above application, the nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA, etc. Among them, sequence 1 consists of 2040 nucleotides, and the entire sequence 1 is the coding sequence (ORF) of the OsFBX388 gene, encoding the protein shown in sequence 2 in the sequence table.

[0032] Those skilled in the art can easily mutate the nucleotide sequence encoding OsFBX388 of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or higher identity with the nucleotide sequence of OsFBX388 isolated from the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode OsFBX388 and have the same function.

[0033] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, or 85% or more, or 90% or more, or 95% or more identity to the nucleotide sequence of the protein composed of the amino acid sequence shown in the coding sequence 2 of the present invention. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0034] The aforementioned 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

[0035] In the above application, the expression cassette containing the nucleic acid molecule encoding OsFBX388 (OsFBX388 gene expression cassette) described in B2) refers to a DNA capable of expressing OsFBX388 in a host cell, and the DNA may include not only a promoter for initiating transcription of OsFBX388, but also a terminator for terminating transcription of OsFBX388. Further, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters; tissue, organ and development-specific promoters and inducible promoters. Suitable transcription terminators include, but are not limited to, Agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and nopaline and octopine synthase terminators.

[0036] The plant recombinant expression vector can be constructed with existing plant expression vectors. The plant expression vector includes a binary agrobacterium vector and a vector that can be used for microprojectile bombardment, such as pGreen0029, pCAMBIA3301, pCAMBIA1300, pCAMBIA1301, pBI121, pBin19, pCAMBIA2301, pCG1301 or other derived plant expression vectors. The plant expression vector can also include the 3' end non-translated region of the foreign gene, i.e., include polyadenylic acid signal and any other DNA fragments that participate in mRNA processing or gene expression. The polyadenylic acid signal can guide polyadenylic acid to join the 3' end of the mRNA precursor. When the gene is used to construct a recombinant expression vector, any enhanced, constitutive, tissue-specific or inducible promoter can be added before the transcription start nucleotide, such as the cauliflower mosaic virus (CaMV) 35S promoter, the ubiquitin gene Ubiquitin promoter (pUbi), the stress-induced promoter Rd29A, etc., which can be used alone or in combination with other plant promoters; in addition, when the gene of the present invention is used to construct a recombinant expression vector, an enhancer can also be used, including a translation enhancer or a transcription enhancer. These enhancer regions can be ATG start or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive, and can be natural or artificially synthesized. The translation start region can come from the transcription start region or the structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes, antibiotic markers with resistance, or chemical reagent resistance marker genes, etc. It is also possible to directly screen transformed plants by adversity without adding any selection marker genes.

[0037] In the above application, the vector may be a plasmid, a cosmid, a phage or a viral vector. In the present invention, the recombinant vector is specifically a pCas9-OsFBX388 vector obtained by inserting the OsFBX388 gene fragment into the pCas9 vector.

[0038] In the above application, the microorganism can be yeast, bacteria, algae or fungi, such as Agrobacterium. In the present invention, the Agrobacterium used is specifically EHA105.

[0039] In a second aspect, the present invention provides a substance that reduces the content or activity of the OsFBX388 protein described in the first aspect, or a substance that reduces or inhibits the expression of the nucleic acid molecule encoding the OsFBX388 protein described in the first aspect, for use in any of the following:

[0040] 1) Improve plant disease resistance;

[0041] 2) Cultivate plants with improved disease resistance;

[0042] 3) Plant breeding.

[0043] The purpose of the breeding is to develop disease-resistant plant varieties.

[0044] In the above, the substance that reduces or inhibits the expression of the nucleic acid molecule encoding the OsFBX388 protein in the first aspect is a substance that causes deletion mutation, insertion mutation or base substitution in the OsFBX388 protein encoding gene, or a CRISPR / Cas9 system that inhibits the translation of the OsFBX388 protein encoding nucleic acid.

[0045] Furthermore, the CRISPR / Cas9 system includes sgRNA targeting OsFBX388 and cas9 enzyme. In an embodiment of the present invention, the CRISPR / Cas9 system is a plasmid pCas9-OsFBX388 containing sgRNA targeting OsFBX388 and a cas9 enzyme encoding gene.

[0046] In the above, the regulation of plant disease resistance is reflected in: when the OsFBX388 protein content and / or activity in the plant increases or the expression level of the OsFBX388 gene increases, the disease resistance of the plant decreases; when the OsFBX388 protein content and / or activity in the plant decreases or the expression level of the OsFBX388 gene decreases, the disease resistance of the plant increases.

[0047] When the OsFBX388 protein content and / or activity in the plant is reduced or the expression level of the OsFBX388 gene is reduced, the disease resistance of the plant is improved as embodied in any one of the following m1)-m4):

[0048] m1) The plant spontaneously develops disease-like spots;

[0049] m2) Reactive oxygen and cell necrosis can be detected in the parts of the plant where lesions occur;

[0050] m3) after being inoculated with pathogens, the length of the plant lesions is reduced; the pathogens are rice blast fungus (such as rice blast fungus race P007) or bacterial leaf blight fungus (such as rice bacterial leaf blight strain PXO99);

[0051] m4) The expression level of the plant defense-related genes is increased; the defense-related genes are specifically genes PR1 and / or PR2 and / or PR3 and / or PR4 and / or PR5 and / or PR8 and / or PR10 and / or WRKY45.

[0052] In a third aspect, the present invention provides a method for cultivating a transgenic plant with improved disease resistance, comprising the following steps: reducing the content and / or activity of the OsFBX388 protein described in the first aspect in a recipient plant to obtain a transgenic plant; the transgenic plant has higher disease resistance than the recipient plant.

[0053] In a fourth aspect, the present invention provides a method for cultivating transgenic plants with improved disease resistance, comprising the following steps: reducing or inhibiting the expression of the nucleic acid molecule encoding the OsFBX388 protein described in the first aspect in a recipient plant to obtain a transgenic plant; the transgenic plant has higher disease resistance than the recipient plant.

[0054] In the above, the reducing or inhibiting the expression of the OsFBX388 protein encoding gene in the recipient plant is to reduce the expression level of the OsFBX388 protein encoding gene in the recipient plant or to cause a deletion mutation, insertion mutation or base substitution in the OsFBX388 protein encoding gene in the recipient plant.

[0055] The method for causing deletion mutation, insertion mutation or base substitution of the OsFBX388 protein encoding gene in the recipient plant is to insert T-DNA into the genome of the recipient plant. In a specific embodiment of the present invention, the T-DNA insertion site is located 1509 bp upstream of the ATG start codon of the OsFBX388 gene.

[0056] In a fifth aspect, the present invention provides a method for cultivating transgenic plants with improved disease resistance, comprising the following steps: performing gene editing on the nucleic acid encoding the OsFBX388 protein described in the first aspect in a recipient plant to stop the translation of the OsFBX388 protein encoding gene, thereby obtaining a gene-edited plant; the disease resistance of the gene-edited plant is higher than that of the recipient plant.

[0057] In the method described above, the gene editing is performed using the CRISPR / Cas9 system, wherein the target site of the sgRNA is positions 39-58 of sequence 1.

[0058] In an embodiment of the present invention, the gene editing of the OsFBX388 protein encoding gene in the recipient plant is achieved by introducing a plasmid expressing the sgRNA into the recipient plant.

[0059] In the above aspects, the disease resistance is resistance to rice blast and / or resistance to rice bacterial blight.

[0060] In the above method, the disease resistance is resistance to rice blast and / or resistance to rice bacterial blight.

[0061] The disease resistance of the transgenic plant is higher than that of the recipient plant, which is embodied in any one of the following n1)-n4):

[0062] n1) the recipient plant does not produce disease-like spots, while the transgenic plant can spontaneously produce disease-like spots;

[0063] n2) the recipient plant does not produce disease-like spots, while the transgenic plant can spontaneously produce disease-like spots and active oxygen can be detected at the sites where the disease-like spots are produced;

[0064] n3) after inoculation with pathogens, the length of the lesions of the transgenic plants is smaller than that of the recipient plants;

[0065] n4) The expression level of defense-related genes in the transgenic plant is higher than that in the recipient plant.

[0066] Further, the pathogen is rice blast fungus (such as rice blast fungus race P007) or bacterial leaf blight fungus (such as rice bacterial leaf blight strain PXO99);

[0067] The defense-related genes are genes PR1 and / or PR2 and / or PR3 and / or PR4 and / or PR5 and / or PR8 and / or PR10 and / or WRKY45.

[0068] In a sixth aspect, the present invention provides any of the following substances:

[0069] 1) sgRNA, whose target is 39-58 of sequence 1;

[0070] 2) A plasmid expressing the sgRNA or a plasmid containing the sgRNA encoding gene.

[0071] In an embodiment of the present invention, the plasmid expressing the sgRNA or the plasmid containing the sgRNA encoding gene is a plasmid pCas9-OsFBX388 containing an sgRNA targeting OsFBX388 and a cas9 enzyme encoding gene.

[0072] In the above application or method, the recipient plant is a monocot or a dicot; the monocot can be rice, corn, wheat, etc. In the present invention, the plant is a monocot, the monocot is rice, and the rice variety can be Aichi Asahi.

[0073] The present invention utilizes a rice recessive lesion-like mutant spla, uses SiteFinding-PCR technology to clone the OsFBX388 gene and conducts functional analysis. In the mutant spla, T-DNA is inserted into the promoter region of the OsFBX388 gene, resulting in decreased expression of OsFBX388, showing a lesion-like phenotype, and enhancing resistance to rice blast fungus compared with the wild type. Further, the OsFBX388 gene is driven by a pCas9 vector to be knocked out in wild-type rice. Compared with the wild type, the knockout plant phenotype is consistent with the mutant spla. Knocking out the OsFBX388 gene can increase its disease resistance to rice blast fungus, and has application prospects in increasing plant yield. The present invention provides a basis for using genetic engineering methods to carry out molecular breeding to increase crop yield or enhance plant disease resistance, and has potential application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] Figure 1 Figure 2 shows the growth phenotypes of the mutant spla and the wild type (WT) and the detection of reactive oxygen species and cell necrosis in their leaves; A is the phenotype under field (Beijing) planting conditions; the white box represents 10 cm; B is the accumulation result of cell necrosis around lesions detected by trypan blue staining; C is the accumulation result of reactive oxygen species around lesions detected by DAB staining; D is the accumulation result of reactive oxygen species around lesions detected by NBT staining; WT is the wild type, and spla is the mutant spla.

[0075] Figure 2 Figure 2 is the phenotype of the mutant spla and the wild type (WT) inoculated with pathogens; A is the disease result of scratch inoculation with rice blast race P007; B is the lesion length measured after scratch inoculation with rice blast race P007 (the data are the average of 12 lesion lengths, **: P<0.01, Student's t test); C is the disease result of inoculation with rice bacterial leaf blight pathogen PXO99; D is the lesion length measured after inoculation with rice bacterial leaf blight pathogen PXO99 (the data are the average of 10 lesion lengths, **: P<0.01, Student's t test).

[0076] Figure 3 The relative expression results of 8 defense genes between the mutant spla and the wild type (WT) were detected by real-time quantitative PCR (**: P<0.01, Student's t test).

[0077] Figure 4The results of cloning the rice OsFBX388 gene using SiteFinding-PCR; A is the insertion position of T-DNA in the OsFBX388 gene; B is the result of PCR identification of the T-DNA insertion site; C is the result of real-time quantitative PCR detection of the relative expression level of the OsFBX388 gene in the mutant spla and the wild type (WT) (**: P<0.01, Student's t test).

[0078] Figure 5 The results show the subcellular localization of OsFBX388; VirD2NLS is a nuclear marker.

[0079] Figure 6 The OsFBX388 knockout (KN) lines were obtained and phenotypic analysis was performed; A is the field phenotype of the wild type, mutant spla and OsFBX388-KN transgenic lines; the white box represents 15 cm; B is the CRISPR target site map of the OsFBX388 gene in the OsFBX388-KN transgenic lines; the changed bases are indicated in the box. A "T" base was inserted in KN-7, while an "A" base was inserted in KN-9. This resulted in frame switching and premature termination of translation. PAM, protospacer adjacent motif sequence. C is the disease result of scratch inoculation with rice blast fungus race P007; D is the lesion length measured after scratch inoculation with rice blast fungus race P007 (the data are the average of 12 lesion lengths, **: P<0.01, Student's t test). DETAILED DESCRIPTION

[0080] The following examples are provided for a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified. The quantitative tests in the following examples were repeated three times, and the results were averaged.

[0081] The rice blast fungus race P007 in the following examples is recorded in the document "Physiological races of rice blast fungus and their toxicity (Fan Jinghua, Zhou Huiping, Wang Honghai, et al. Physiological races of rice blast fungus and their toxicity [J]. Plant Protection, 2005, 31(6): 29-31.)", which is available to the public from China Agricultural University. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0082] The rice bacterial blight strain PXO99 in the following example is recorded in the document “Identification and preliminary positioning of a new gene for resistance to bacterial blight in small-grain wild rice (Guo Sibin, Zhang Duanpin, Lin Xinghua. Identification and preliminary positioning of a new gene for resistance to bacterial blight in small-grain wild rice [J]. Chinese Agricultural Science, 2010, 43(13): 2611-2618.)” and is available to the public from China Agricultural University. The biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0083] Example 1. Obtaining Rice OsFBX388 Protein and Its Encoding Gene

[0084] 1. Obtaining and phenotypic identification of the rice disease-like mutant spla

[0085] 1. Obtaining and phenotypic identification of the rice disease-like mutant spla

[0086] The mutant spla was screened from the progeny of the T-DNA transformed rice variety Aichi Asahi (hereinafter also referred to as wild-type rice).

[0087] The phenotypes of the mutant spla and wild-type Aichi Asahi are compared as follows Figure 1 As shown in A, it can be seen that in the field, the mutant spla showed dwarfing of the plant and obvious disease-like symptoms on the 125th day of planting. Different leaves of the mutant spla showed disease-like spots.

[0088] 2. Detection of leaf reactive oxygen species and cell necrosis

[0089] The mutant spla and wild-type rice Aichixu leaves were stained with trypan blue, 3'3'-diaminobenzidine (DAB) and nitro blue tetrazolium (NBT), respectively. The specific steps were carried out according to the method in the literature "Qiao Y, Jiang W, Lee JH, et al. SPL28 encodes a clathrin-associated adaptor protein complex 1, medium subunit μ1 (AP1M1) and is responsible for spotted leaf and early senescence in rice (Oryza sativa). New Phytologist, 2010, 185 (1): 258-274."

[0090] The results are as follows Figure 1 As shown in B-1D, reactive oxygen burst and cell necrosis were clearly detected at the site of lesion formation in the spla mutant, but not in the wild-type rice.

[0091] 3. Inoculation test

[0092] (1) The mutant spla and wild-type rice Aichixu leaves were inoculated in vitro with rice blast fungus race P007. The specific steps were carried out according to the method in the literature "Fang, W., Liu, C., Zhang, H. et al. Selection of differential isolates of Magnaporthe oryzae for postulation of blast resistance genes. Phytopathology, 2018, 108: 878-884."

[0093] The results are as follows Figure 2 As shown in A and 2B, 120 hours after scratch inoculation, the lesion length of the mutant spla was significantly shorter than that of the wild type, indicating that the resistance of the mutant spla to rice blast fungus was significantly enhanced.

[0094] (2) The rice bacterial blight strain PXO99 was used to inoculate the mutant spla and wild-type rice Aichi Asahi leaves. The specific steps were carried out according to the method in the literature "Zhao, XS; Qiu, TC; Feng, HJ et al. A novel glycine-rich domain protein, GRDP1, functions as a critical feedback regulator for controlling cell death and disease resistance in rice. Journal of Experimental Botany, 2021, 72, 608-622."

[0095] The results are as follows Figure 2 As shown in C and 2D, 2 weeks after inoculation, the lesion length of the mutant spla was significantly smaller than that of the wild type, indicating that the resistance of the mutant spla to bacterial blight pathogen was significantly enhanced.

[0096] 4. Detection of defense gene expression

[0097] The expression of defense-related genes PR1, PR2, PR3, PR4, PR5, PR8, PR10, and WRKY45 in the mutant spla and wild-type rice Aichixu was analyzed by fluorescence quantitative PCR, with rice ACTIN1 gene as internal reference. The specific steps are as follows: take the fully expanded leaves of the mutant spla and wild-type rice Aichixu at the same position, extract the total RNA by Trizol reagent method (Invitrogen), use MMLV reverse transcriptase (TaKaRa) and refer to the corresponding method for reverse transcription, and then use real-time fluorescence quantitative PCR technology, according to the method provided by the manufacturer (TaKaRa), add SYBR green I fluorescent dye to the PCR system, and detect the expression of defense-related genes PR1, PR2, PR3, PR4, PR5, PR8, PR10, and WRKY45 in a fluorescence quantitative PCR instrument (ABI 7500, USA), and the primer sequences are shown in Table 2. The experiment was repeated three times. The comparative Ct method was used for data processing, that is, the Ct value was the number of cycles experienced when the fluorescence signal in the PCR tube reached the set threshold, ΔCt = Ct (test gene) - Ct (ACTIN1), with 2 -ΔCt The values ​​were used to measure gene transcription levels, and a comparative analysis was performed on the measured genes in the spla mutant and wild-type rice.

[0098] Table 2 shows the primer sequences of ACTIN1 and defense genes

[0099] Gene name Locus ID Primer name Sequence of items ACTIN1 LOC_Os03g50885 qRT-OsRAc1-F ATCACTGCCTTGGCTCCTA qRT-OsRAc1-R CATCTGCTGGAATGTGCTG PR1 LOC_Os07g03710 qRT-PR1b-F TCGTATGCTATGCTACGTGTTT qRT-PR1b-R CACTAAGCAAATACGGCTGACA PR2 LOC_Os01g71340 qRT-PR2-F CTGGCATTGGTCCTTGGAGTT qRT-PR2-R CGATGCCGTTGGACTTGTAG PR3 LOC_Os10g39680 qRT-PR3-F CCTATTGCATGATCGTTCGAT qRT-PR3-R GCCTGTAGCAGTTAAAGCAATTG PR4 LOC_Os11g37970 qRT-PR4-F TTGGCGCCAGAAGTATGGAT qRT-PR4-R TTGGCGCCAGAAGTATGGAT PR5 LOC_Os12g43380 qRT-PR5-F CCACGTGTGCAATTGTTTAATC qRT-PR5-R ACTCGGACGCTTTCATTTGA PR8 LOC_Os10g28080 qRT-PR8-F TTCATCTGGTCAGCGGATAGC qRT-PR8-R TATCACGACCGTTCGATGGA PR10 LOC_Os12g36880 qRT-PR10-F CCTGCCGAATACGCCTAAGA qRT-PR10-R CTCAAACGCCACGAGAATTT WRKY45 LOC_Os05g25770 qRT-WRKY45-F TGAAGGATGGGTACCAATGGA qRT-WRKY45-R CACATCTTTGGAGCTTCTTCTTGA

[0100] The results are as follows Figure 3 As shown, compared with wild-type rice (WT), the defense genes PR1, PR2, PR3, PR4, PR5, PR8, PR10, and WRKY45 in the mutant spla all showed significantly upregulated expression.

[0101] 2. Cloning of OsFBX388 gene using SiteFinding-PCR technology

[0102] 1. Acquisition of OsFBX388 gene

[0103] Genetic analysis of the mutant spla obtained in step 1 above showed that the disease-like phenotype of this mutant co-segregated with the T-DNA insertion, and it was a recessive mutant with single-site insertion. The T-DNA flanking sequence was isolated using SiteFinding-PCR technology. The analysis found that the T-DNA insertion site was on chromosome 10 ( Figure 4A). Primers JD-F (5'-AAACTCCGATCCCTCCCTGC-3'), JD-R (5'-TGCGAGAGAGTTCAGTAACGATGAT-3') and T-DNA border primers L3 (5'-GATGCCGACCGGATCTGTCGATC-3'), R3 (5'-CTGTTGCCGGTCTTGCGATGAT-3') were designed on the genome for PCR amplification ( Figure 4 B), sequencing analysis revealed that the T-DNA was inserted into the promoter region of a gene, and the T-DNA insertion site was located 1509 bp upstream of the ATG start codon of the gene ( Figure 4 A), the gene was named OsFBX388 gene, the open reading frame (ORF) of OsFBX388 gene was shown as Sequence 1 in the sequence table, and the amino acid sequence of the protein encoded by it (OsFBX388 protein) was shown as Sequence 2 in the sequence table.

[0104] Compared with the wild-type rice Aichi Asahi, the mutant spla had a T-DNA insertion mutation only in the promoter region of the OsFBX388 gene in the wild-type rice Aichi Asahi genome, and the T-DNA insertion site was located 1509 bp upstream of the start codon ATG of the OsFBX388 gene.

[0105] 2. Detection of OsFBX388 gene expression

[0106] Fluorescence quantitative PCR was used to analyze the expression of OsFBX388 gene in mutant spla and wild-type rice Aichi Xu, with ACTIN1 gene as internal reference. The primer sequences are shown in Table 1. The detection method and data processing are the same as step 1, 4. The primer sequences are as follows:

[0107] qRT-OsFBX388-F: 5'-CCCCATCATGGACTACCACG-3';

[0108] qRT-OsFBX388-R: 5'-GGCATTGCAGCTTTGTAGCTC-3'.

[0109] The results are as follows Figure 4 As shown in C, the results showed that T-DNA insertion led to a significant down-regulation of the expression of the OsFBX388 gene in the mutant spla.

[0110] Example 2: Subcellular localization of OsFBX388 protein

[0111] 1. Using PCR method, FBX388-GFP-F (5'-ata ggtaccATGGAGTCGCTGC-3', the underlined part is the Kpn I site) as the forward primer, and FBX388-GFP-R (5'-aat tctaga TGGCGTTCGCGTC-3', the underlined part is the Xba I site) was used as the reverse primer to amplify the partial open reading frame sequence of the OsFBX388 gene from the cDNA of the rice variety Aichi Asahi (obtained by reverse transcription of extracted RNA).

[0112] 2. After the PCR product obtained in step 1 is recovered, it is connected to the pMD-18T vector (TaKaRa). After the sequencing is correct, it is double-digested with Kpn I and Xba I, and the digested product is connected to the plant subcellular localization expression vector pCG1301 (Prudin Biotechnology (Beijing) Co., Ltd.), and the recombinant expression vector pCG1301-OsFBX388-GFP containing the OsFBX388 gene is obtained. The structure of the recombinant expression vector pCG1301-OsFBX388-GFP is described as follows: the DNA molecule shown in the sequence 1 at positions 1-2037 in the sequence table is inserted between the multiple cloning sites Kpn I and Xba I of the pCG1301 vector. In the recombinant expression vector pCG1301-OsFBX388-GFP, the promoter driving the expression of the OsFBX388 gene is the 35S promoter.

[0113] 3. According to the method in the literature "Li, X., 2011, Infiltration of Nicotiana benthamiana Protocol for Transient Expression via Agrobacterium. Bio-protocol Bio101: e95. DOI: 10.21769 / BioProtoc.95" and the literature "Wang, K., Liu, Y. and Li, S., 2013, Bimolecular Fluorescence Complementation (BIFC) Protocol for Rice Protoplast Transformation. Bio-protocol 3(22): e979. DOI: 10.21769 / BioProtoc.979.", the recombinant expression vector pCG1301-OsFBX388-GFP (denoted as OsFBX388-GFP in the figure) was transferred into Aichi Asahi rice protoplasts, and the localization of OsFBX388 protein was observed under a laser confocal microscope.

[0114] The results are as follows Figure 5As shown in the figure, it can be seen that OsFBX388 protein is localized in the nucleus and cytoplasm in rice protoplasts.

[0115] Example 3. Obtaining and phenotypic identification of OsFBX388 knockout (KN) plants

[0116] The gene involved in this embodiment is the OsFBX388 gene in the rice variety Aichi Xu obtained in Example 1, and its nucleotide sequence is Sequence 1 in the sequence table, encoding the protein (OsFBX388) shown in Sequence 2 in the sequence table. Sequence 1 consists of 2040 nucleotides, and Sequence 2 consists of 679 amino acids.

[0117] 1. Obtaining OsFBX388 gene KN plants

[0118] 1. Construction of expression vector pCas9-OsFBX388

[0119] (1) Using a PCR instrument, primer 5'- ggca CTCCCGCCTGCCGGCCAGGT-3' (sequence 3, the underlined part is the Bsa I site) and 5'- aaac ACCTGGCCGGCAGGCGGGAG-3′ (sequence 4, the underlined part is the Bsa I site), 10 μL of each was mixed and incubated at 98°C for 2 min on a PCR instrument, and annealed to 25°C at 0.1°C per second to obtain the sgRNA encoding double-stranded sequence.

[0120] The target of sgRNA is sequence 1, positions 39-58.

[0121] (2) The pOs-sgRNA vector was digested with Bsa I, and then recovered and ligated with double-stranded sgRNA using T4 ligase at 16°C overnight; the ligation product was heat-shocked and transformed into E. coli DH5α, and a single clone was selected for shaking culture, and the clones positive for PCR detection were sent for sequencing verification. For details of the intermediate vector pOs-sgRNA, please refer to the literature "Miao, J., Guo, D., Zhang, J. et al. Targeted mutagenesis in rice using CRISPR-Cas system. Cell research, 2013, 23 (10): 1233-1236.", and its name in the literature is pOs-sgRNA. pOs-sgRNA-OsFBX388 was obtained.

[0122] (3) The plasmid pOs-sgRNA-OsFBX388 verified by sequencing was mixed with the pCas9 vector in equal mass, and Gateway LR homologous recombination enzyme (Invitrogen) was added to perform homologous recombination at room temperature for 4-8 hours. After the recombination reaction was completed, 1 μL of Protein K was added to terminate. The ligation product was transformed into Escherichia coli DH5α by heat shock, and a single clone was picked and cultured on a shaking table. The clones that were positive in PCR detection were sent for sequencing. The pCas9-OsFBX388 knockout plasmid was obtained by sequencing verification. The vector pCas9 is detailed in the literature "Miao, J., Guo, D., Zhang, J. et al. Targeted mutagenesis in rice using CRISPR-Cas system. Cell research, 2013, 23 (10): 1233-1236.", and its name in the literature is pH-Ubi-cas9-7.

[0123] The pCas9-OsFBX388 knockout plasmid is a plasmid obtained by inserting the OsFBX388 gene sgRNA coding sequence into the pCas9 vector, and the plasmid contains a sgRNA coding double-stranded sequence.

[0124] The above OsFBX388 gene sgRNA coding sequence was obtained by annealing the primers shown in SEQ ID NO: 3 and SEQ ID NO: 4.

[0125] 2. Obtaining OsFBX388-KN rice

[0126] The recombinant expression vector pCas9-OsFBX388 constructed in step 1 above was introduced into the embryonic callus of wild-type rice variety Oryza sativa L. cv. Aichiasahi through Agrobacterium EHA105 (Prudin Biotechnology (Beijing) Co., Ltd.) to obtain T0 generation OsFBX388-KN rice. For the preparation of embryonic callus and the specific transformation method, refer to the article "Yi Zili, Cao Shouyun, Wang Li, Chu Chengcai, Li Xiang, He Shijie, Tang Zuoshun, Zhou Puhua, Tian Wenzhong, Study on improving the frequency of Agrobacterium transformation of rice, Journal of Genetics, 2001, 28 (4): 352-358".

[0127] 3. Identification of OsFBX388-KN rice

[0128] (1) Preliminary identification by PCR

[0129] Extract genomic DNA from the T0 generation OsFBX388-KN rice obtained in step 2, and use primers 5'-GCTGCGCCGATGGTTTCTACAA-3' and 5'-CACGGCCTCCAGAAGAAGA TGTTG-3' to detect the neomycin phosphotransferase gene (HPTII) fragment in the T0 generation OsFBX388-KN rice. The PCR amplification product is a 514 bp fragment, which is a positive plant. Further, use primers 5'-CGACCTCGACAATCTCCTCG-3' and 5'-GTAGTACGGGATGCGGAAGG-3' to detect the Cas9 gene fragment in the T0 generation OsFBX388-KN rice. The PCR amplification product can obtain a 535 bp fragment, which is a positive plant.

[0130] Through the above PCR identification, the plants with positive HPTII fragment and positive Cas9 gene fragment were positive T0 generation OsFBX388-KN rice, and the two positive T0 generation OsFBX388-KN rice lines were recorded as T0 generation OsFBX388-KN rice lines KN-7 and KN-9, respectively.

[0131] (2) Sequencing of T0-generation OsFBX388-KN transgenic rice lines KN-7 and KN-9

[0132] RNA was extracted from leaves of T0-generation OsFBX388-KN rice lines KN-7 and KN-9 and reverse transcribed into cDNA, which was amplified using primers 5'-ATGGAGTCGCTGCCG-3' and 5'-ATCGGCGAGCATA-3'. Wild-type rice Aichi Asahi (WT) was used as a control. The amplification results were sequenced, and the results were as follows Figure 6 As shown in B, it can be seen that a "T" base was inserted in KN-7, while an "A" base was inserted in KN-9, which resulted in a frame switch and premature termination of translation of the OsFBX388 gene. PAM, protospacer adjacent motif sequence.

[0133] 4. Phenotype of OsFBX388-KN rice

[0134] (1) Field phenotype of OsFBX388-KN rice

[0135] Seeds of T0 transgenic OsFBX388-KN rice lines KN-7 and KN-9 were sown in the field and the phenotypes were observed after 120 days of growth. Wild-type rice Aichi Asahi (WT) and mutant spla were used as controls.

[0136] The results are as follows Figure 6As shown in A, it can be seen that in the field, on the 120th day after planting, the phenotypes of KN-7 and KN-9 were closer to wild-type rice, except that the plant height became shorter, and no phenotype similar to the lesion-like phenotype of the mutant spla appeared.

[0137] (2) Identification of disease resistance phenotype of OsFBX388-KN rice

[0138] The leaves of T0 generation transgenic OsFBX388-KN rice lines KN-7 and KN-9, the mutant spla and wild-type rice Aichi Asahi (WT) were inoculated in vitro with rice blast race P007 (the method was the same as in Example 1).

[0139] The leaves were observed 96 hours after scratch inoculation. Figure 6 As shown in C and 6D, it can be seen that 96 hours after scratch inoculation, the lesion length of OsFBX388-KN was consistent with that of the mutant spla, and both were significantly shorter than that of the wild type, indicating that the resistance of OsFBX388-KN to rice blast fungus was significantly enhanced.

[0140] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the technical principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of OsFBX388 protein or related biomaterials in regulating plant disease resistance; The OsFBX388 protein is any one of the proteins shown in A1)-A4) below: A1) a protein consisting of the amino acid sequence shown in Sequence 2 in the sequence listing; A2) A fusion protein obtained by connecting a tag to the N-terminus or / and the C-terminus of the protein shown in Sequence 2 in the sequence list; A3) a protein related to plant disease resistance in which one or more amino acid residues of the amino acid sequence shown in Sequence 2 in the sequence list are replaced and / or deleted and / or added; A4) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology with the amino acid sequence defined in any one of A1) to A3) and being associated with plant disease resistance; The biological material related to the OsFBX388 protein is any one of the following B1) to B8): B1) Nucleic acid molecule encoding OsFBX388 protein; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1); B4) a recombinant vector containing the expression cassette described in B2); B5) a recombinant microorganism containing the nucleic acid molecule described in B1); B6) a recombinant microorganism containing the expression cassette described in B2); B7) a recombinant microorganism containing the recombinant vector described in B3); B8) A recombinant microorganism containing the recombinant vector described in B4).

2. A substance that reduces the content or activity of the OsFBX388 protein of claim 1, or a substance that reduces or inhibits the expression of the nucleic acid molecule encoding the OsFBX388 protein of claim 1, in any of the following uses: 1) Improve plant disease resistance; 2) Cultivate plants with improved disease resistance; 3) Plant breeding.

3. A method for cultivating transgenic plants with improved disease resistance, comprising the following steps: reducing the content and / or activity of the OsFBX388 protein described in claim 1 in a recipient plant to obtain a transgenic plant; the transgenic plant has higher disease resistance than the recipient plant.

4. A method for cultivating transgenic plants with improved disease resistance, comprising the following steps: reducing or inhibiting the expression of the nucleic acid molecule encoding the OsFBX388 protein of claim 1 in a recipient plant to obtain a transgenic plant; the transgenic plant has higher disease resistance than the recipient plant.

5. A method for cultivating transgenic plants with improved disease resistance, comprising the following steps: gene editing the nucleic acid encoding the OsFBX388 protein of claim 1 in a recipient plant to stop the translation of the OsFBX388 protein encoding gene, thereby obtaining a gene-edited plant; the disease resistance of the gene-edited plant is higher than that of the recipient plant.

6. The method according to claim 5, characterized in that: The gene editing was performed using the CRISPR / Cas9 system, wherein the target site of the sgRNA was positions 39-58 of sequence 1.

7. The use according to claim 1 or 2 or the method according to any one of claims 3 to 6, characterized in that: The disease resistance is resistance to rice blast and / or resistance to rice bacterial blight.

8. The use according to claim 1 or 2 or the method according to any one of claims 3 to 6, characterized in that: The plant or recipient plant is a monocotyledonous plant or a dicotyledonous plant.

9. Any of the following substances: 1) sgRNA, whose target is sequence 1, positions 39-58; 2) A plasmid expressing the sgRNA or a plasmid containing the sgRNA encoding gene.

Images