Rice LPA1 gene and application thereof in regulation and control of plant phosphorus nutrient accumulation

Abstract

The invention discloses a rice LPA1 gene and application of the rice LPA1 gene in regulation and control of phosphorus nutrient accumulation of plants. The gene sequence is shown as a sequence table SEQ ID No: 1, and the protein sequence is shown as a sequence table SEQ ID No: 2. It is identified for the first time that LPA1 gene expression can obviously regulate phosphorus nutrient accumulation, rice LPA1 protein mutation enables phosphorus nutrient accumulation to be reduced, and rice LPA1 protein overexpression enables phosphorus nutrient accumulation to be enhanced. The protein and the coding gene thereof have important theoretical and practical significance for improving phosphorus nutrient accumulation of plants and crop yield, can play an important role in genetic breeding of crops, and have wide application prospects.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering, and in particular relates to a rice LPA1 gene and an application thereof in regulating the accumulation of plant phosphorus nutrients. Background Art

[0002] Phosphorus is one of the essential macronutrients for plant growth and development, and is involved in important processes such as signal transduction, photosynthesis and respiration, and yield and quality formation. Sufficient phosphorus can improve the tolerance of plants to various stresses, but its utilization rate and mobility in plants are very low. Phosphorus in natural soil is mainly in the form of Pi (H 2 PO4 - 、HPO4 2- and PO4 3- ), and the available Pi concentration generally does not exceed 10μmol / L, which is far below the optimal concentration for plant growth. According to statistics, about 43% of the world's arable land is deficient in phosphorus, and about 66% of my country's arable land is deficient in phosphorus. Due to the insufficient supply of Pi and the difficulty for plants to absorb and utilize it, crop production is severely restricted. Farmers apply phosphate fertilizers to supplement the phosphorus needs of plants in agricultural production activities, but only 10%-15% is absorbed and utilized by plants, and the rest of the phosphorus enters the water environment in different forms, causing pollution such as eutrophication of water bodies. In addition, due to the rapid reduction of natural phosphate resources, the production cost of phosphate fertilizers has increased. Therefore, studying the regulatory mechanism of plant phosphorus nutrients is one of the important ways to improve the phosphorus absorption capacity of plants and improve phosphorus nutrition.

[0003] Histone modification is one of the important ways to study epigenetics, including methylation, acetylation, ubiquitination, adenylation and other covalent modifications of histones after translation. Histone acetylation is a dynamic and reversible modification process. Under the regulation of protein acetyltransferases and deacetylases, it participates in important processes such as gene expression activity, genome stability and chromatin structure remodeling in organisms. In recent years, research on histone modification in rice has continued to emerge, and some acetylase genes have been cloned in rice. These genes are involved in changing the chromatin state and regulating the transcription of genes related to plant growth and development and stress response, thereby affecting the development of various organs of rice and the growth process at various stages. Song et al. found that HAT1 increases the size of the husk, grain weight and yield by increasing cell number and accelerating grain filling, and increases the overall acetylation level of histone H4 (SONG XJ, KUROHA T, AYANO M, et al.. Rare allele of a previously unidentified histone H4 acetyltransferase enhances grain weight, yield, and plant biomass in rice[J]. Proc. Natl. Acad. Sci. USA, 2015, 112(1): 76-81); Ullah et al. showed that HDA710 is involved in the regulation of salt stress response genes by changing the acetylation level of histone H4 in its promoter, and knocking out the hda710 mutation can enhance the salt tolerance of rice (ULLAH F, XU Q, ZHAO Y, et al.. Histone deacetylase HDA710 controls salt tolerance by regulating ABA signaling in rice[J]. J. Intergr. Plant Biol., 2021, 63: 451-467.). However, the application of histone acetylase genes in plant phosphorus nutrient accumulation has not been reported. Summary of the invention

[0004] The purpose of the present invention is to provide a rice LPA1 gene and its application in regulating the accumulation of plant phosphorus nutrients.

[0005] Rice LPA1 gene, wherein the polynucleotide of the LPA1 gene is as shown in (a), (b), (c) or (d):

[0006] (a) a polynucleotide as shown in SEQ ID No: 1 in the sequence listing; or

[0007] (b) a polynucleotide that can hybridize with the complementary sequence of SEQ ID No: 1 under stringent hybridization conditions, and the protein encoded by the polynucleotide still has the function of regulating the accumulation of phosphorus nutrients in plants;

[0008] (c) a polynucleotide having at least 90% homology with the polynucleotide shown in SEQ ID No: 1; or

[0009] (d) A polynucleotide mutant obtained by deleting, substituting or inserting one or more bases based on the polynucleotide shown in SEQ ID No: 1, and the protein encoded by the polynucleotide mutant still has the function of regulating the accumulation of phosphorus nutrients in plants.

[0010] Rice LPA1 protein, wherein the amino acid sequence of the LPA1 protein is as shown in (a), (b) or (c):

[0011] (a) the amino acid sequence shown in SEQ ID No: 2 in the sequence listing; or

[0012] (b) an amino acid having at least 90% homology with the amino acid shown in SEQ ID No: 2; or

[0013] (c) A protein mutant obtained by deleting, replacing or inserting one or more amino acids on the basis of the protein shown in SEQ ID No: 2, and the protein still has the function of regulating the accumulation of phosphorus nutrients in plants.

[0014] A vector containing the rice LPA1 gene.

[0015] An engineered bacterium containing the rice LPA1 gene vector.

[0016] Primers for amplifying any fragment of the rice LPA1 gene.

[0017] The rice LPA1 gene is used in regulating the accumulation of phosphorus nutrients in plants.

[0018] A method for enhancing phosphorus nutrient accumulation in rice, and increasing the expression level of LPA1 protein in rice.

[0019] Beneficial effects of the present invention: The present invention identifies for the first time that LPA1 gene expression can significantly regulate phosphorus nutrient accumulation, rice LPA1 protein mutation reduces phosphorus nutrient accumulation, and rice LPA1 protein overexpression enhances phosphorus nutrient accumulation. The protein of the present invention and its encoding gene have important theoretical and practical significance for improving plant phosphorus nutrient accumulation and crop yield, will play an important role in crop genetic breeding, and have broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1is the relative expression level of LPA1 gene in rice overexpressing transgenic plants.

[0021] Figure 2 Creation of rice LPA1 Cas9 gene editing mutant.

[0022] Figure 3 To observe the leaf phenotype and inorganic phosphorus content of rice LPA1 overexpressing transgenic plants under normal culture conditions.

[0023] Figure 4 Inorganic phosphorus staining was used to observe the Pi content in the leaves of rice LPA1 overexpressing transgenic plants under normal hydroponic conditions.

[0024] Figure 5 The phenotypes of LPA1 overexpression and LPA1 mutant plants as well as plant height, tiller number, single plant yield, and phosphorus content were statistically determined and analyzed. DETAILED DESCRIPTION

[0025] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0026] Experimental materials used in the following examples: rice material: SSBM; strains: Escherichia coli strain DH5α, Agrobacterium tumefaciens strain EHA105; overexpression vector: pCAMBIA1300.

[0027] Example 1 Preparation of rice LPA1 overexpressing transgenic plants

[0028] Construction of pCAMBIA1300-HDA1 overexpression vector: Using cDNA of the aerial part of rice SSBM under hydroponic conditions as a template, PCR amplification was performed using the upstream primer 5'-TCGAGGGGGGGCCCGGTACCATGTCGGGGCAGGCGCCG-3' (SEQ ID No: 3) and the downstream primer 5'-TGCTCACCATGTCGACCTACTCGTTTGCAGCAACTTCTGC-3' (SEQ ID No: 4), and the LPA1 gene DNA fragment of about 5000 bp was purified and recovered. The pCAMBIA1300 vector was digested with Kpn I endonuclease (NEB) and Sal I endonuclease (NEB), and the digestion product was recovered. The LPA1 recovered fragment was ligated to the linearized pCAMBIA1300 vector by In-Fusion (Clontech) to obtain the recombinant vector pCAMBIA1300-HDA1.

[0029] Preparation of HDA1 overexpressing transgenic plants: Using rice SSBM as the background material, the Agrobacterium EHA105 strain containing the pCAMBIA1300-HDA1 vector was used to infect rice embryos to obtain T0 generation transgenic positive plants; the T0 generation positive transgenic plants were self-pollinated for 2 generations to obtain homozygous LPA1 overexpressing transgenic rice materials. Two homozygous overexpressing lines #1 and #2 were selected and used

[0030] Real-time fluorescence quantitative PCR detection was performed using a primer pair consisting of 5'-GCACCATACTATACCGTTG-3' (SEQ ID No: 5) and 5'-CGTCATTCCTTTTTTTCTC-3' (SEQ ID No: 6).

[0031] The results are as follows Figure 1 As shown, the relative expression level of LPA1 gene in LPA1-OE#1 and #2 lines was increased compared with that in wild-type plants.

[0032] Example 2 Creation of Rice LPA1 Cas9 Gene Editing Mutants

[0033] The 45-66 bp of CDS sequence of gene LPA1 was selected as the target site (e.g. Figure 1 ), homology arm primers were LPA1-u3-F: ggcAGTCACAGTACAACCAGGA (SEQ ID No: 7), LPA1-u3-R: aaacTCCTGGTTGTACTGTGACT (SEQ ID No: 8);

[0034] LPA1-u6a-F: ggcGCAACCTCAGATAAAAACTG (SEQ ID No: 9), LPA1-u6a-R: aaacCAGTTTTTATCTGAGGTTG (SEQ ID No: 10). The identification primers are LPA1-cas9-Seq-F1: TGGACATCTTTCCAGCTCTC (SEQ ID No: 11), LPA1-cas9-Seq-R1: CATCTGACACTAGGTCGATG (SEQ ID No: 12), LPA1-cas9-Seq-F2: CATTACACCCATTTGATCTG (SEQ ID No: 13), LPA1-cas9-Seq-R2: GACATTATCATGAGCACTTC (SEQ ID No: 14).

[0035] The specific steps of CRIPSR / Cas9 vector construction refer to Zeng Dongchang et al. (Zeng Dongchang, Ma Xingliang, Xie Xianrong, et al. Methods for constructing plant CRISPR / Cas9 multi-gene editing vectors and analyzing mutations [J]. Chinese Science: Life Sciences, 2018, 48(07): 783-794.). The constructed vector was transferred into Ishikari Shiragi (SSBM) by Agrobacterium EHA105-mediated transgenic method (commissioned by the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences), and two independent lpa1 mutants were obtained, which were missing 9 bases "TGTACTGTG" and 6 bases "AACTGA", respectively. They were named lpa1-Cr-1 and lpa1-Cr-2, as shown in Figure 2. Figure 2 .

[0036] Example 3 Observation of leaf phenotype and inorganic phosphorus content of rice LPA1 overexpressing transgenic plants under normal culture conditions

[0037] Experimental material treatment and inorganic phosphorus content measurement: The wild-type material (SSBM) and LPA1 overexpressing transgenic materials (#1 and #2) were hydroponically treated. The formula of the hydroponic complete nutrient solution was: 1.4mM NH4NO3, 0.2mM NaH2PO4·2H2O, 0.19mM K2SO4, 0.55mM MgSO4·7H2O, 0.36mM CaCl2, 0.1mM EDTA-FeNa, 0.005mM MnCl2·4H2O, 0.03mM H3BO3, 0.001mM (NH4)6Mo7O 24 ·4H2O, 0.004mM ZnSO4·7H2O, 0.002mM CuSO4·5H2O. The pH is 6. The nutrient solution was changed twice a week. After culturing for 3 weeks under the conditions of 12h light / 12h dark and 30℃ / 22℃, the leaf phenotype of the transgenic material was observed. At the same time, the third leaf was sampled, frozen in liquid nitrogen and ground into powder, and 5M H2SO4 was added for 30min, 1mLddH2O was added, vortexed and mixed, centrifuged at 1,3000rpm for 10min, the supernatant was aspirated, and the inorganic phosphorus content was calculated by the molybdenum antimony colorimetric method at a wavelength of 695nm.

[0038] The results are as follows Figure 3 As shown in the figure, under normal full nutrient solution hydroponic conditions, wild-type rice leaves remained green and swollen, while the leaves of LPA1 overexpressing plants showed scorched and chlorotic phenotypes. In addition, the inorganic phosphorus content in the leaves of LPA1 overexpressing plants was higher than that of the wild type, indicating the accumulation of phosphorus nutrients.

[0039] Example 4 Observation of Pi content in leaves of rice LPA1 overexpressing transgenic plants under normal hydroponic conditions by inorganic phosphorus staining

[0040] The test plants were: LPA1 overexpressing transgenic materials (#1 and #2) and wild-type materials (SSBM).

[0041] Leaf Pi staining: Take about 1 cm of the middle of the second leaf of the wild-type and transgenic plants grown under full nutrient solution hydroponic conditions for 2 weeks, and embed them with 4% agarose. Fix the embedded material on the base of the vibrating microtome, and the slice thickness is 50 μm. Add Pi staining solution to a 2mL EP tube in advance, pick up the complete slice material in the tube for staining. After leaving it at room temperature for 1-2 hours, make slices, and observe and take pictures with a 10x optical microscope.

[0042] The results are as follows Figure 4 As shown, compared with the wild-type plants, the Pi staining color in LPA1OE#1 and #2 strains was darker under normal hydroponic conditions, indicating an increase in Pi content.

[0043] Example 5 Enhancing LPA1 expression can increase rice tiller number and yield

[0044] The experimental plants were: LPA1 overexpressing transgenic materials (#1 and #2), gene-edited mutants lpa1-Cr-1 and lpa1-Cr-2, and wild-type materials (SSBM).

[0045] Pot test and agronomic trait analysis: The above materials were planted in conventional paddy soil, and after they grew to maturity, the plant height, tiller number, single plant yield, and phosphorus content were statistically measured and analyzed.

[0046] The results are as follows Figure 5 As shown in the figure, compared with wild-type plants, the tiller number and yield per plant of LPA1-OE#1 and #2 lines were significantly higher than those of wild-type plants; while the tiller number and yield per plant of mutant plants lpa1-Cr-1 and lpa1-Cr-2 were significantly lower than those of other plants. These results indicate that enhancing LPA1 expression can increase rice tiller number and yield, and also suggest that LPA1-OE#1 and #2 lines have higher phosphorus utilization potential.

[0047] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A rice LPA1 gene, characterized in that The polynucleotide of the LPA1 gene is shown in (a), (b), (c) or (d): (a) a polynucleotide as shown in SEQ ID No: 1 in the sequence listing; or (b) a polynucleotide that can hybridize with the complementary sequence of SEQ ID No: 1 under stringent hybridization conditions, and the protein encoded by the polynucleotide still has the function of regulating the accumulation of phosphorus nutrients in plants; (c) a polynucleotide having at least 90% homology with the polynucleotide shown in SEQ ID No: 1; or (d) A polynucleotide mutant obtained by deleting, substituting or inserting one or more bases based on the polynucleotide shown in SEQ ID No: 1, and the protein encoded by the polynucleotide mutant still has the function of regulating the accumulation of phosphorus nutrients in plants.

2. Rice LPA1 protein, characterized in that The amino acid sequence of the LPA1 protein is shown in (a), (b) or (c): (a) the amino acid sequence shown in SEQ ID No: 2 in the sequence listing; or (b) an amino acid having at least 90% homology with the amino acid shown in SEQ ID No: 2; or (c) A protein mutant obtained by deleting, replacing or inserting one or more amino acids on the basis of the protein shown in SEQ ID No: 2, and the protein still has the function of regulating the accumulation of phosphorus nutrients in plants.

3. A vector containing the rice LPA1 gene according to claim 1.

4. An engineered bacterium containing the rice LPA1 gene vector according to claim 3.

5. Primers for amplifying any fragment of the rice LPA1 gene according to claim 1.

6. Use of the rice LPA1 gene according to claim 1 in regulating phosphorus nutrient accumulation in plants.

7. A method for enhancing phosphorus nutrient accumulation in rice, characterized in that: Increase the expression level of LPA1 protein in rice.

Images