Application of OsMYBR1 gene in regulation and control of rice quality

Abstract

The invention discloses application of an OsMYBR1 gene in regulation and control of rice quality, and belongs to the technical field of gene engineering. The OsMYBR1 gene is knocked out in Nipponbare by utilizing a CRISPR / Cas9 technology, and compared with a wild type, the chalkiness and chalky grain rate of rice with the mutant knocked out are remarkably improved, and the appearance quality becomes poor; however, the amylose of the mutant rice is reduced, the gelatinization temperature of endosperm starch is reduced, the hardness and chewiness of rice are reduced, and the viscosity is obviously increased, which indicates that the cooking taste quality of the rice with the mutant knocked out is improved; compared with a wild type, the over-expressed OsMYBR1 gene has the advantages that the chalkiness and chalkiness grain rate of over-expressed strain rice have no significant difference; the content of amylopectin in the rice is obviously increased, the alkali digestion value of endosperm starch is increased, and the gelatinization entropy value is reduced, so that overexpression of the OsMYBR1 gene can improve the cooking taste quality of the rice on the premise of not influencing the appearance quality, and the OsMYBR1 gene can be used for rice quality breeding improvement.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to application of OsMYBR1 gene in regulating rice quality. Background Art

[0002] Rice (Oryza sativa L.) is one of the important food crops in my country. With the improvement of people's living standards, the requirements for rice quality are also higher. In the past few decades, my country's rice production has been greatly improved, but the quality of rice is still far from the requirements of consumers. Starch is the main component of rice, and its composition and structure determine the quality of rice. Rice quality traits mainly include processing, appearance, cooking and eating quality, and nutritional quality. Chalkiness (chalkiness and chalky grain rate) is an important indicator for evaluating the appearance quality of rice, which directly affects the market price of rice. Chalkiness refers to the white opaque part of the rice endosperm. Rice with chalkiness is easy to break during fine milling, which directly affects the processing quality such as the whole polished rice rate. Chalkiness is a quantitative trait regulated by multiple genes and is also easily affected by environmental factors. Rice cooking and eating quality includes the content of amylose, gelatinization temperature and gelatin consistency of rice. Rice cooking and eating quality is an important physical and chemical indicator for evaluating rice quality, which determines the taste of rice. Mutations in endosperm starch synthesis-related enzyme genes, such as OsGBSSⅠ, OsSSⅢa, and OsBEⅡb, can lead to obstacles in rice endosperm starch synthesis, changes in starch structure, increased endosperm chalkiness, and changes in cooking and taste quality. Therefore, finding transcription factor genes involved in regulating rice endosperm starch synthesis and regulating rice endosperm starch synthesis by gene editing or overexpression has important theoretical value and production application potential for improving rice quality. Summary of the invention

[0003] The purpose of the present invention is to provide an application of the OsMYBR1 gene in regulating rice quality to solve the problems existing in the above-mentioned prior art. By overexpressing the OsMYBR1 gene in rice, the cooking and eating quality of rice can be significantly improved without changing the appearance quality. The present invention provides technical support for improving rice quality using the OsMYBR1 gene.

[0004] To achieve the above object, the present invention provides the following solutions:

[0005] The present invention provides the use of OsMYBR1 gene in any of the following:

[0006] (1) Application in regulating rice quality;

[0007] (2) Application in rice breeding;

[0008] Wherein, the nucleotide sequence of the OsMYBR1 gene is shown as SEQ ID No.1.

[0009] The present invention also provides the use of the protein encoded by the OsMYBR1 gene in any of the following:

[0010] (1) Application in regulating rice quality;

[0011] (2) Application in rice breeding;

[0012] Wherein, the amino acid sequence of the protein is shown as SEQ ID No.2.

[0013] The present invention also provides a recombinant vector comprising the OsMYBR1 gene for use in any of the following:

[0014] (1) Application in regulating rice quality;

[0015] (2) Application in rice breeding;

[0016] Wherein, the nucleotide sequence of the OsMYBR1 gene is shown as SEQ ID No.1.

[0017] The present invention also provides the use of a host bacterium comprising a recombinant vector in any of the following:

[0018] (1) Application in regulating rice quality;

[0019] (2) Application in rice breeding;

[0020] The recombinant vector comprises the OsMYBR1 gene, and the OsMYBR1 gene is integrated into the genome of the host bacteria through the recombinant vector. The nucleotide sequence of the OsMYBR1 gene is shown in SEQ ID No.1.

[0021] Optionally, the rice quality includes chalkiness, chalky grain rate, amylose content, amylopectin content, endosperm starch alkali consumption value, gelatinization temperature, gelatinization entropy value and gel consistency of the rice.

[0022] Optionally, the regulation method includes (1) overexpressing the OsMYBR1 gene in rice to increase the amylopectin content and endosperm starch alkali absorption value in rice to improve rice quality; or (2) knocking out the OsMYBR1 gene in rice to reduce the amylose content and endosperm starch gelatinization temperature in rice to improve rice quality; wherein the nucleotide sequence of the OsMYBR1 gene is shown in SEQ ID No.1.

[0023] The present invention also provides a method for improving the cooking and eating quality of rice, comprising the steps of (1) overexpressing the OsMYBR1 gene in rice to increase the amylopectin content and the alkali digestion value of endosperm starch in the rice; or (2) knocking out the OsMYBR1 gene in rice to reduce the amylose content and the gelatinization temperature of endosperm starch in the rice; the nucleotide sequence of the OsMYBR1 gene is shown in SEQ ID No. 1.

[0024] The present invention also provides a method for cultivating transgenic rice with improved rice cooking and taste quality, comprising the steps of (1) increasing the content of amylopectin and the alkali digestibility of endosperm starch in rice by overexpressing the OsMYBR1 gene in rice, thereby improving the cooking and taste quality of the constructed transgenic rice; or (2) knocking out the OsMYBR1 gene in rice, thereby reducing the content of amylose and the gelatinization temperature of endosperm starch in rice, thereby improving the cooking and taste quality of the constructed transgenic rice; the nucleotide sequence of the OsMYBR1 gene is shown in SEQ ID No. 1.

[0025] The present invention discloses the following technical effects:

[0026] (1) The present invention discovered that the OsMYBR1 gene is a gene that regulates rice quality and can be applied to genetic improvement of rice quality.

[0027] (2) The present invention provides the function of the OsMYBR1 gene in regulating rice quality. In the background of rice Nipponbare, the present invention uses CRISPR / Cas9 technology to knock out the OsMYBR1 gene. Compared with the wild type, the OsMYBR1 gene knockout mutant strain has significantly improved rice chalkiness and chalky grain rate, and its appearance quality has deteriorated; however, the mutant rice has reduced amylose and gelatinization temperature of endosperm starch, which will reduce the hardness and chewiness of rice and significantly increase viscosity, indicating that the knockout mutant rice has improved cooking and taste quality.

[0028] (3) The present invention overexpresses the OsMYBR1 gene in the rice Nipponbare background. Compared with the wild type, the chalkiness and chalky grain rate of the overexpressed transgenic strains are not significantly different, the amylopectin content of the rice is significantly increased, and the alkali digestibility is improved. This indicates that overexpressing the OsMYBR1 gene can make starch easier to gelatinize without affecting the appearance quality, thereby improving the cooking and eating quality of rice, and can be used for rice quality breeding and improvement. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0030] Figure 1 is the relative expression level of OsMYBR1 gene in various tissues of rice; Root is young root, Shoot is young stem, Leaf is young leaf, Spikelet is young panicle, 3DAF-24DAF is rice seeds 3-24 days after flowering;

[0031] Figure 2 The figure shows the construction of OsMYBR1 knockout and overexpression strains; A: Plant phenotypes of OsMYBR1 knockout and overexpression strains; B: The target sites of OsMYBR1 gene knockout using CRISPR / Cas9 technology and the base variation information of the homozygous mutants obtained; C: The relative expression levels of OsMYBR1 gene in the wild type, OsMYBR1 knockout mutants (osmybr1-1 and osmybr1-2) and overexpression strains (OE-MYBR1-1 and OE-MYBR1-2);

[0032] Figure 3 Figure 2 shows the seed phenotypes of OsMYBR1 knockout and overexpression lines; A: Rice appearance phenotypes of OsMYBR1 knockout mutants and overexpression lines; B: Seed length, width and thickness of wild-type material Nipponbare NIP, OsMYBR1 knockout mutant lines (osmybr1-1 and osmybr1-2) and OsMYBR1 overexpression transgenic lines (OE-MYBR1-1 and OE-MYBR1-2), respectively; E and F: Chalky grain rate and chalkiness, respectively. G: represents the thousand-grain weight of seeds of wild-type rice Nipponbare NIP, OsMYBR1 gene knockout mutant strains (osmybr1-1 and osmybr1-2) and OsMYBR1 gene overexpression transgenic strains (OE-MYBR1-1 and OE-MYBR1-2); different letters represent significant differences at p < 0.05, and statistical differences were tested by one-way ANOVA;

[0033] Figure 4 The effects of OsMYBR1 gene knockout and overexpression on rice endosperm starch granules;

[0034] Figure 5Comparison results of rice taste quality among wild-type rice Nipponbare NIP, OsMYBR1 gene knockout mutant and overexpression transgenic plants; A: amylose content, B: amylopectin starch content, C: total starch content, D: total protein content, E: alkali elimination value determination results, F: peak gelatinization temperature, G: gelatinization entropy value of rice flour, H: gelatin consistency determination results of rice flour; different letters represent significant differences with p<0.05, and statistical differences were tested by one-way ANOVA. DETAILED DESCRIPTION

[0035] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0036] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0037] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0038] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0039] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0040] Example 1 Analysis of tissue expression pattern of OsMYBR1 gene

[0041] Total RNA was extracted from rice roots, stems, leaves, panicles, and seeds at 3, 10, 18, and 24 days after flowering using TRIzol reagent (Invitrogen, Carlsbad, CA); the concentration of the extracted total RNA was measured using the Nanodrop 2000 instrument, and then the extracted RNA was reverse transcribed into cDNA using a reverse transcription kit (ReverTra Ace qPCR RT Kit, Toyobo, Osaka, Japan). Real-time fluorescence quantitative PCR was performed using the SYBR Green Master Mix (Toyobo Co. Ltd, Japan) kit and the ABIPRISM 7900HT (Applied Biosystems, Foster City, CA) fluorescence quantitative PCR instrument, with the UBIQUITIN (LOC_Os03g13170) gene as an internal reference. The fluorescence quantitative RT-qPCR program was: 95.0℃3min; 95.0℃10s, 60.0℃30s, 40 cycles; melting curve 65.0℃-95.0℃, 0.5℃ measurement once, heating rate 0.5℃ / s. The primer sequences are shown in Table 1.

[0042] The results are as follows Figure 1 As shown, real-time fluorescence quantitative PCR indicated that the OsMYBR1 gene was specifically expressed in rice seeds.

[0043] Table 1 Real-time fluorescence quantitative PCR primer sequences

[0044]

[0045] Example 2 Construction of OsMYBR1 gene transgenic strain

[0046] 1. Construction of OsMYBR1 gene CRISPR / Cas9 knockout transgenic strain

[0047] The sequence of the OsMYBR1 gene (Locus number LOC_Os10g20990) was obtained using the RGAP (http: / / rice.plantbiology.msu.edu / ) database. The nucleotide sequence is shown in SEQ ID No.1, and the amino acid sequence encoded by the OsMYBR1 gene is shown in SEQ ID No.2.

[0048] The OsMYBR1 gene knockout target sequence (SEQ ID No. 7) is: 5'-CCGCTGGAAGGAGATTGGCCGGG-3'.

[0049] The target sequence was constructed into the BGK032 vector using the Biogene BGK032 knockout kit, and Wuhan Aidijing Biotechnology Co., Ltd. was commissioned to carry out Agrobacterium-mediated genetic transformation to obtain the OsMYBR1 gene mutant plants in the Nipponbare background. The OsMYBR1 gene mutant sequence was confirmed by PCR and Sanger sequencing.

[0050] 2. Construction of OsMYBR1 gene overexpression transgenic strain

[0051] According to the characteristics of the pCAMBIA1305 vector, primers containing (KpnⅠ and BamHI) restriction sites were designed (F: 5'-TTCTGCACTAGGTACCATGCGTGTGGGGAAGGCAA-3', SEQ ID No.8; R: 5'-TGCTCACCATGGATCCCTATCTTCGCAGGCGGAAGT-3', SEQ ID No.9). The OsMYBR1 gene was amplified by PCR using the cDNA of young seeds of Nipponbare as a template. The PCR product was cut and recovered from the gel, and the fragment was connected to the pCAMBIA1305 vector using a recombinase. The plasmid was sent to Wuhan Aidijing Biotechnology Co., Ltd. for genetic transformation to obtain the transgenic overexpression T0 generation strain under the Nipponbare background. RNA was extracted from the leaves of the T0 generation plants, and the extracted RNA was reverse transcribed into cDNA using a reverse transcription kit (ReverTraAce qPCR RTKit, Toyobo, Osaka, Japan). At the same time, the wild-type Nipponbare leaf material was used as a control, and the plant leaf RNA was extracted and reverse transcribed into cDNA. Real-time fluorescence quantitative PCR was performed using the SYBR Green Master Mix (Toyobo Co. Ltd, Japan) kit, and the real-time fluorescence quantitative PCR analysis was performed on the ABIPRISM 7900HT (Applied Biosystems, Foster City, CA) fluorescence quantitative PCR instrument, and the UBIQUITIN (LOC_Os03g13170) gene was used as an internal reference. T0 generation plants overexpressing the OsMYBR1 gene were screened, and T2 generation plants were used for phenotypic identification. The fluorescence quantitative RT-qPCR program was: 95.0℃3min; 95.0℃10s, 60.0℃30s, 40 cycles; melting curve 65.0℃-95.0℃: 0.5℃ measurement once, the heating rate was 0.5℃ / s; the primer sequences are shown in Table 1.

[0052] The results are as follows Figure 2 As shown, the gene expression level in the OsMYBR1 knockout transgenic line was significantly reduced, and the gene expression level in the overexpression transgenic line was significantly increased.

[0053] Example 3 Phenotypic detection of OsMYBR1 gene knockout and overexpression transgenic strains

[0054] The wild-type NIP materials, OsMYBR1 knockout and overexpression transgenic materials were planted in the experimental field and managed with conventional water and fertilizer. The mature seeds were harvested and dried naturally. The seed length, width and thickness were measured with a vernier caliper; 1000 full seeds were randomly selected for the thousand-grain weight measurement; the rice was husked with a rice husker to obtain brown rice, and the brown rice was ground into polished rice with a rice polisher. After the whole polished rice was selected, the chalkiness, chalky grain rate and thousand-grain weight of the rice were measured with a Wanshen SC-G seed tester.

[0055] like Figure 3 As shown, compared with the wild-type control, there was no significant difference in grain length and width, the seed thickness of the OsMYBR1 gene knockout mutant and the overexpression transgenic lines was reduced, resulting in a decrease in 1000-grain weight; the chalkiness and chalky grain rate of the OsMYBR1 gene knockout mutant rice were significantly increased, while the chalkiness and chalky grain rate of the overexpression transgenic lines were not significantly different from those of the wild-type control.

[0056] Example 4 Effects of OsMYBR1 gene knockout and OsMYBR1 gene overexpression on rice endosperm starch granules

[0057] The formation of endosperm chalkiness is often closely related to the structure of endosperm starch granules and the arrangement of starch granules. The present invention used scanning electron microscopy to observe the morphology of starch granules in cross-sections of wild-type NIP, OsMYBR1 gene knockout strains and OsMYBR1 gene overexpression transgenic strains.

[0058] The results are as follows Figure 4 As shown, compared with the control NIP, the starch granules in the rice endosperm of the OsMYBR1 gene knockout mutant were irregularly round and loosely arranged, while the starch granules in the rice endosperm of the wild type and OsMYBR1 overexpressing transgenic plants were polyhedral and tightly arranged.

[0059] Example 5 Detection method and analysis of rice taste quality of OsMYBR1 gene knockout mutant and overexpression transgenic strain

[0060] (1) Determination of amylose content: The polished rice of the wild type, OsMYBR1 knockout mutant and overexpression transgenic strain was ground into rice flour, passed through a 100-mesh sieve, and 0.050 g of each was weighed and placed in a 50 mL volumetric flask. At the same time, standard samples (with concentrations of 0.4%, 10.6%, 16.2% and 26.5% amylose) were prepared and treated in the same way. Slowly add 0.5 mL of 95% ethanol, gently shake the volumetric flask, then add 4.5 mL of 1 mol / L NaOH solution, and let stand at room temperature overnight; on the next day, add deionized water to 50 mL, mix upside down, and let stand for 20 minutes. Accurately pipette 0.5 mL of sample and standard into a 10 mL test tube, add 5 mL of ddH2O, 100 μL of 1 M acetic acid solution, 200 μL of KI-I2 (2 g I2 + 20 g KI + 1000 mL ddH2O) solution and 4.2 mL of ddH2O in sequence, mix well using an oscillator, and let stand at room temperature for 20 min; pipette 0.2 mL of the above mixture onto a transparent ELISA plate, and use an ELISA reader to measure the absorbance of the sample at a wavelength of 620 nm. Calculate the amylose content of each sample ( Figure 5 (A).

[0061] (2) Determination of total starch content: The total starch content in refined rice flour of wild-type NIP, OsMYBR1 knockout mutant and overexpression transgenic strain was determined using the Megazyme Total Starch Assay Kit K-TSTA (Megazyme, Ireland, UK). Figure 5 C), refer to the instructions of the kit for specific steps. The content of amylopectin in refined rice flour = total starch content - amylose content, the results are shown in Figure 5 Middle B.

[0062] (3) Determination of total protein content: Weigh 0.1g refined rice flour and place it in a 100mL digestion tube. Add 5mL concentrated sulfuric acid, place the digestion tube in a 290℃ digestion furnace, start timing, take it out and shake it every 15 minutes, generally shake it about 4 times, and time it for 60 minutes. Take out the digestion tube and cool it to room temperature. Add 0.75mL of hydrogen peroxide solution and place it in the 290℃ digestion furnace again. Observe whether the solution in the digestion tube becomes clear. After the solution becomes clear, take it out, cool it to room temperature, and then make up to 100mL. Use an enzyme marker to measure the absorbance value of the sample and the standard sample at a wavelength of 280nm. Draw a linear equation based on the nitrogen content and absorbance OD value of the standard sample. Calculate the nitrogen content in the sample based on the variance and convert it into protein content. The results are shown in Figure 5 Middle D.

[0063] (4) Determination of alkali elimination value: Select 6 full grains of polished rice and place them in a square box. Add 10 mL of 1.70% potassium hydroxide solution, cover the box, and place it in a 30°C constant temperature box for about 23 hours. Observe the decomposition of the rice endosperm. The grading was recorded according to the national edible rice variety quality standard NT / T593-2021. The results are shown in Figure 5 Middle E.

[0064] (5) Determination of gelatinization temperature: Weigh 0.005 g of refined rice flour into an aluminum sample cup, add 10 μL of distilled water, seal the cup, and measure the gelatinization temperature of wild-type NIP, OsMYBR1 gene knockout mutant, and OsMYBR1 overexpressing transgenic rice strains using a Mettler-Toledo differential scanning calorimeter (DSC). The results are shown in Table 2. Figure 5 Medium FG.

[0065] (6) The gel consistency (GC) was determined in accordance with the national edible rice variety quality standard NT / T593-2021. All data are based on three biological replicates, and the values ​​are the mean values. The error is the standard error of the mean (SEM). Different lowercase letters indicate significant differences (P < 0.05). The statistical differences were tested by one-way ANOVA. The results are shown in Figure 5 Middle H.

[0066] The results showed that compared with wild-type rice, the amylose content in the OsMYBR1 gene knockout mutant rice was significantly reduced, the alkali digestion value was increased, and the gelatinization temperature was significantly reduced; there was no significant change in the amylopectin content, total starch content, total protein content, and gel consistency. Compared with wild-type rice, the amylopectin content of the OsMYBR1 gene overexpression transgenic strain rice was significantly increased (total starch content did not change significantly, and amylose content was significantly reduced), the alkali digestion value was increased; there was no significant change in total protein content, gelatinization temperature, and gel consistency. The above results indicate that starch is easier to gelatinize and the cooking and eating quality is improved.

[0067] The experimental results of the above examples show that the OsMYBR1 gene can regulate multiple indicators that affect rice quality. It is a gene that regulates rice quality and can be applied to genetic improvement of rice quality.

[0068] The OsMYBR1 gene sequence is as follows (SEQ ID No. 1):

[0069] ATGCGTGTGGGGAAGGCAAAGAGGCGGCTGGATCTATCGACGAGAAGGGGGACAGATGAGGGCGGGCGCACCAACTGCTGGAAGACGGCCACGTCAGCACCGTCGTTGGCGCGCGCTACGGCGGTGCGGGTGCTGGCCACGGACCCAGATCCAAGCGGCGTGGCGTGTGTGCGATGTGATGTGAACGGGGAACGAGTGCGGGCGTGGTCGTGTGGGGCAAAAACATGTGGTATGGGAGCTGGGCGCAAGCTCAAGACCCACCGCAGGAACCAAAGATGGGCCGACAAGGCATACAAGAAGAGCCACTTTGGCAATGAGTGGAAGAAACCCTTTGCTGGATCATCTCATGCCAAGGGCATTGTTTTGGAGAAGATTGGTATTGAGGCCAAGCAGCCAAACTCTGCCATCTGTAAGTGTGCTCGTGTTCAGCTGGTGAAGAATGGGAAGAAGATTGCTGCCTTTGTGCCGAATGACGGTTGCTTGAACTTCATCAAGGAAAATGAAGTTGCGTATGTCGATGGCATTTATGGGATTAAAGTGCTTGTCGATGCTCTCAGCTCGAGCAGATTGAGAGGTCGCGATGGATCAGGAGGTGATCATGGCGACGCCACCGCTGCCGCCGCCGCCTCGCGCGAGGTGGCGCCACCACCTCGCCCGCGCGACGTCTACCACCGCCCCTTCACCGCCCGCGACGACGACGAGCTCCTGCGCCTCCACTACCGCCTCGGCGACCGCTGGAAGGAGATTGGCCGGGCCGTTTACGGCCGCACATCGCGCGTCATGAAGCACCGCTGGAGGGAGCTCCGGCGCGGCGGCTTCCTCGCTGCTGCCGCAAGGAAGGAGCTGGCGGCGCTCGACATGGCGGACGACATGGTGGAAACTAGCGAAGTGGAGGAGCCAGCTGATCAGTCGCTGCCGTCGCTAGAGTTGCAGCGCAGTACCCTTGCGGACACTCTTGCCTCGAGCTTCGGTTCTTGCAGCCTTGCCACTGACCACGTGATGGATCCCCTGGCCGGCAGCCTCGCGCTAGGAAAATACCAATTCTTTACTATTATAAAAATTGAAGATGTTTTTACCGGTACTTTGGTACGTCATCCTTGGTTGCCTCGCCTCGTCAAGGAGAACGGCTTCCGCCACTGGAGTAGGGTCGCCAGGATCATGCCACGCCGCTCTGCAAGGTTGTGCCGTGACAGGTGGTGCCACCACCTCGCCCGCGACGTCTACCACCGCCCCTTCACTGCCCGTGACGACGACGAGCTCCTACGCCTCCACTACCGCCTGGGCGACTGCTGGAAGAAGATTGGCCACGCTGTCTACGGCCGGACCTCGCGAGTCATGAATCACCGCTGGAGGGAGCTCCGGCGCAGCGGCTTCCTCGCTGCTGCTGCAAGGACGGAGCAGAAGCTCGACATGGCGGACGATATGGTGGAAAGCGAAGTGGAGGAATCAGATCAGTCGCTGCCCACTACTAGGAAAAGCATTATCGCAACCGGCCGAAAAGGGTCTTTGCAGGCGGGGCAGCCGTCCGCCTGTAAGCCAACGACTGTGAAGATCGCCGATCTTCGCAGGCGGGGCGGCCGTCCGCCTGCGAAGATAATTTTCGCAGGCGGACGTTGGCTAGTCCGGTCCGCTTGCGAAAAGAAGAATCGGCCGCCTACAAAAAAAAACTTCCGCCTGCGAAGATAG。

[0070] The protein sequence encoded by the OsMYBR1 gene is as follows (SEQ ID No.2):

[0071] .

[0072] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Use of OsMYBR1 gene in any of the following: (1) Application in regulating rice quality; (2) Application in rice breeding; in, The nucleotide sequence of the OsMYBR1 gene is shown in SEQ ID No.

1.

2. Use of the protein encoded by the OsMYBR1 gene in any of the following: (1) Application in regulating rice quality; (2) Application in rice breeding; in, The amino acid sequence of the protein is shown in SEQ ID No.

2.

3. Use of a recombinant vector comprising the OsMYBR1 gene in any of the following: (1) Application in regulating rice quality; (2) Application in rice breeding; in, The nucleotide sequence of the OsMYBR1 gene is shown in SEQ ID No.

1.

4. Application of host bacteria containing recombinant vectors in any of the following: (1) Application in regulating rice quality; (2) Application in rice breeding; in, The recombinant vector comprises the OsMYBR1 gene, and the OsMYBR1 gene is integrated into the genome of the host bacteria through the recombinant vector. The nucleotide sequence of the OsMYBR1 gene is shown in SEQ ID No.

1.

5. The use according to any one of claims 1 to 4, characterized in that: The rice quality includes the chalkiness, chalky grain rate, amylose content, amylopectin content, endosperm starch alkali consumption value, gelatinization temperature, gelatinization entropy value and gel consistency of the rice.

6. The use according to claim 5, characterized in that The regulation method includes: (1) increasing the amylopectin content and the alkali absorption value of endosperm starch in rice by overexpressing the OsMYBR1 gene in rice, so as to improve the quality of rice; or (2) reducing the amylose content and the gelatinization temperature of endosperm starch in rice by knocking out the OsMYBR1 gene in rice, so as to improve the quality of rice; wherein the nucleotide sequence of the OsMYBR1 gene is shown in SEQ ID No.

1.

7. A method for improving the cooking and eating quality of rice, characterized in that: The method comprises the steps of (1) overexpressing the OsMYBR1 gene in rice to increase the amylopectin content and the alkali digestion value of endosperm starch in rice; or (2) knocking out the OsMYBR1 gene in rice to reduce the amylose content and the gelatinization temperature of endosperm starch in rice; the nucleotide sequence of the OsMYBR1 gene is shown in SEQ ID No.

1.

8. A method for cultivating transgenic rice with improved rice cooking and taste quality, characterized in that: The method comprises the steps of (1) increasing the content of amylopectin and the alkali digestibility of endosperm starch in rice by overexpressing the OsMYBR1 gene in rice, thereby improving the cooking and eating quality of the constructed transgenic rice; or (2) knocking out the OsMYBR1 gene in rice, thereby reducing the content of amylose and the gelatinization temperature of endosperm starch in rice, thereby improving the cooking and eating quality of the constructed transgenic rice. The nucleotide sequence of the OsMYBR1 gene is shown in SEQ ID No. 1.

Images