A fungus laccase overexpression gene, plasmid, strain and laccase expression method

By screening transcription factors that regulate laccase expression and constructing overexpression strains, the problem of low yield of fungal laccase heterologous expression was solved, enabling efficient laccase production under non-induction conditions, increasing laccase yield and reducing safety risks.

CN119799735BActive Publication Date: 2026-04-24ANHUI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
ANHUI UNIV
Filing Date
2024-12-06
Publication Date
2026-04-24

AI Technical Summary

Technical Problem

Existing technologies for heterologous expression of fungal laccase have low yields, long fermentation cycles, and high costs, making it difficult to meet industrial needs. Furthermore, aromatic compound inducers are toxic and pose safety risks.

Method used

By screening transcription factors that regulate laccase expression, an overexpression strain was constructed to significantly increase laccase production without induction. The strain TrameteshirsutaAH28-2(GME12003_g-OE-5) was constructed by using the fungal laccase overexpression gene GME12003_g and overexpression plasmid and by homologous recombination of Saccharomyces cerevisiae.

Benefits of technology

Without the presence of inducing substances, laccase yield was significantly increased, reaching approximately three times that of the wild-type strain, achieving efficient and safe laccase production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119799735B_ABST
    Figure CN119799735B_ABST
Patent Text Reader

Abstract

The application discloses a kind of fungal laccase overexpression genes, plasmid, strain and the expression method of laccase, and provides a kind of fungal laccase overexpression gene GME12003_g in the application, the nucleotide sequence of the fungal laccase overexpression gene GME12003_g is as shown in SEQ ID No:1;In addition, the application provides a kind of overexpression strain of fungal laccase, the overexpression strain of the fungal laccase is obtained after overexpression fungal gene GME12003_g in Trametes hirsuta AH28-2;The fungal laccase overexpression strain is named Trametes hirsuta AH28-2 (GME12003_g-OE-5), and the laccase enzyme activity of the modified strain can reach 1000U / L without induction, is 3 times of wild type strain, and the strain has the characteristics of efficient expression laccase.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of microbial technology, and in particular to a fungal laccase overexpression gene, plasmid, strain, and method for expressing laccase. Background Technology

[0002] Laccase (phenylene glycol: oxygen oxidoreductase, EC1.10.3.2) is a copper-containing polyphenol oxidase that plays a crucial role in the efficient degradation of lignocellulose. Lignocellulose is a naturally abundant renewable resource. Achieving efficient degradation of lignocellulose using various technologies can not only reduce environmental pollution but also alleviate fossil fuel shortages, showing great promise for applications. Microbial degradation utilizes microbial colonies (including fungi and bacteria) to degrade lignocellulose. Studies have shown that fungi have a stronger ability to degrade lignocellulose than bacteria. As the main lignocellulose-degrading enzyme secreted by most fungi, laccase not only plays a vital role in the efficient degradation of lignocellulose but also has broad substrate specificity and catalytic advantages such as using O2 as an electron acceptor and H2O as a byproduct, making it applicable to various industries, including food processing, textiles, biofuels, biosynthesis and remediation, biosensors, and cosmetics. However, wild-type fungi secrete low amounts of laccase, and their extracellular laccase activity is weak. Therefore, how to prepare laccase inexpensively and safely has become a major concern for researchers. To address this problem, heterologous expression of fungal laccase is commonly used to increase laccase yield. However, existing heterologous expression techniques suffer from low yields, long fermentation cycles, and high costs, making them unsuitable for industrial-scale applications.

[0003] To increase fungal laccase yield, most methods involve inducing the expression of fungal laccase. However, the obtained strains require the induction of aromatic compounds to significantly increase laccase yield. Furthermore, the aromatic compounds used, such as guaiacol and o-toluidine, are toxic, posing potential pollution and safety risks. Therefore, finding a safer and more efficient method to increase fungal laccase yield is urgently needed. Summary of the Invention

[0004] This invention addresses the problems of existing technologies by developing a method to screen transcription factors that regulate laccase expression and construct overexpression strains, thereby significantly increasing laccase production without induction. The overexpression strain, after 7 days of pure culture in XH medium, exhibited enzyme activity reaching 1000 U / L, while the wild-type strain only showed 300 U / L after 7 days of pure culture. This strain demonstrates a significantly higher efficiency in laccase production.

[0005] The present invention achieves its objective through the following technical solutions:

[0006] Technical Solution 1:

[0007] A fungal laccase overexpression gene GME12003_g, the nucleotide sequence of which is shown in SEQ ID No: 1.

[0008] Technical Solution Two:

[0009] A fungal laccase overexpression plasmid comprising the aforementioned fungal laccase overexpression gene GME12003_g, wherein the fungal laccase overexpression plasmid includes a linearized recombinant pYSK7 plasmid and a linked L22-GME12003_g-L24 sequence, wherein the L22-GME12003_g-L24 sequence is formed by linking the L22 sequence and the L24 sequence to both sides of the fungal laccase overexpression gene GME12003_g.

[0010] Technical Solution 3:

[0011] The above-mentioned method for preparing fungal laccase overexpression plasmids includes the following steps:

[0012] a. The overexpressed gene GME12003_g and the empty vector pet-28a described in technical solution 1 are digested with enzymes and then ligated with DNA ligase to obtain a ligation vector;

[0013] b. Transform the ligation vector into E. coli DH5α competent cells, culture them, and screen to obtain recombinant plasmids;

[0014] c. Using L22-GME12003_g-F and L24-GME12003-R as primers, and the recombinant plasmid obtained in step b as a template, the target sequence was amplified.

[0015] d. After purifying the obtained target sequence, use it as a template and amplify the L22-GME12003_g-L24 sequence using the L22 and L24 sequences described in technical solution 2 as primers;

[0016] e. Using the Saccharomyces cerevisiae homologous recombination method, the L22-GME12003_g-L24 sequence obtained in step d is ligated with the linearized recombination pYSK7 plasmid described in technical solution 2 to obtain a fungal laccase overexpression plasmid.

[0017] As a further technical solution, the method for linearizing the recombinant pYSK7 plasmid is as follows: the recombinant pYSK7 plasmid is digested with enzymes, and the digestion product is incubated at 37°C for 1.5 h and then purified by agarose gel electrophoresis to obtain the linearized recombinant pYSK7 plasmid; the recombinant pYSK7 plasmid is a pYSK7 plasmid recombined with a promoter, and the nucleotide sequence of the promoter of the recombinant pYSK7 plasmid is shown in SEQ ID No: 2.

[0018] Technical Solution Four:

[0019] A fungal laccase overexpression strain, wherein the fungal laccase overexpression strain is a strain obtained by overexpressing the fungal gene GME12003_g in Trameteshirsuta AH28-2;

[0020] The fungal laccase overexpression strain is named Trametes hirsuta AH28-2(GME12003_g-OE-5), deposited at the China Center for Type Culture Collection, Wuhan University, Wuhan, China, on November 12, 2024, with accession number CCTCCM20242538.

[0021] Technical Solution 5:

[0022] A method for preparing an overexpression strain of the above-mentioned fungal laccase includes the following steps:

[0023] (1) Preparation of protoplasts of wild strain T. hirsutaAH28-2.

[0024] (2) Then, the overexpression plasmid or the overexpression plasmid prepared by the above preparation method is transformed into the protoplasts described in step (1).

[0025] (3) The transformed protoplasts were regenerated, initially screened and then screened again to obtain overexpression strains of fungal laccase.

[0026] Technical Solution Six:

[0027] A method for expressing fungal laccase involves culturing the overexpression strain described above or the overexpression strain prepared by the above method in a medium containing cellobiose (XH medium) for 144 h, and then centrifuging the fermentation broth to remove the bacterial cells and obtaining the fermentation supernatant to measure laccase activity.

[0028] As a further technical solution, the XH culture medium comprises the following components: 1.5% cellobiose, 0.1% tryptone, 0.15% DL-asparagine, 0.01% Na2HPO4, 0.1% KH2PO4, 0.001% CaCl2, 0.001% FeSO4·7H2O, 0.00257% adenine sulfate, 0.000005% vitamin B1, and 0.0002% CuSO4·7H2O, sterilized at 115℃ for 30 min.

[0029] In summary, the beneficial effects of the present invention are as follows:

[0030] 1. This invention screened out the fungal laccase overexpression gene GME12003_g, and overexpressed the above gene in *Strombus haematobium* AH28-2 using genetic methods. The resulting strain can significantly increase laccase production without any induction.

[0031] 2. This invention provides an overexpression strain of the fungal laccase gene GME12003_g, named TrameteshirsutaAH28-2 (GME12003_g-OE-5). The constructed new strain can not only stably overexpress the above gene through passages, but also increase the laccase yield by about 3 times compared with the wild-type T. hirsuta AH28-2 strain without any inducing substances. This strain has a significant advantage in producing laccase more efficiently. Attached Figure Description

[0032] Figure 1 This is an electrophoresis image of the amplified GME12003_g sequence in Example 1 of this application;

[0033] Figure 2 The graph shows the changes in the transcriptional level of the laccase gene lacA in the GME12003_g overexpression strain;

[0034] Figure 3 This is a graph showing the changes in the transcriptional level of the GME12003_g gene in the GME12003_g overexpressing strain;

[0035] Figure 4 The graph shows the changes in total laccase activity between the overexpression strain and the wild-type strain.

[0036] Figure 5 This is a diagram showing the changes in isozyme profiles of the overexpressing strain and the wild-type strain. Detailed Implementation

[0037] The present application will be further described in detail below with reference to the accompanying drawings and embodiments.

[0038] This invention provides a fungal laccase overexpression gene GME12003_g, the nucleotide sequence of which is shown in SEQ ID No: 1. The screened fungal gene GME12003_g can be obtained from *T. hirsuta* AH28-2. Overexpression of this gene in *T. hirsuta* AH28-2 can significantly increase laccase yield.

[0039] This application provides an overexpression strain of fungal laccase, which is obtained by overexpressing the fungal gene GME12003_g of this application in Trametes hirsuta AH28-2; the overexpression strain is named Trametes hirsuta AH28-2(GME12003_g-OE-5); depositary institution: China Center for Type Culture Collection, address: Wuhan University, Wuhan, China, deposit date: November 12, 2024, deposit number: CCTCCM20242538.

[0040] The thrombus strain T. hirsuta AH28-2 used in this application is a wild-type laccase-producing strain. The depositary institution is the China Center for Type Culture Collection (CCTCC); address: Wuhan University, Wuhan, China; deposit date: November 29, 2005; accession number: CCTCCNO: M205134.

[0041] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the present invention will be fully described below in conjunction with the embodiments.

[0042] The primer sequences used in this application were prepared by a third-party biotechnology company, and all primer sequences were designed independently by the inventors of this application.

[0043] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0044] Example 1

[0045] This embodiment provides a method for preparing the fungal laccase overexpression gene GME12003_g, including the following steps:

[0046] 1) Total RNA was extracted from T. hirsuta AH28-2 strain, reverse transcribed into cDNA template, and then amplified by PCR to obtain the full-length sequence of GME12003_g. The amplification primers are shown in Table 1, the amplification system is shown in Table 2, and the amplification conditions are shown in Table 3.

[0047] Table 1 Amplification Primers

[0048] Primer name Sequence (5'-3') GME12003_g-F ATGAACATCCCTCTCTTCCAGTTCC GME12003_g-R TCATCTCCCCATCGCCATCGCGAGC

[0049] Table 2 PCR reaction system

[0050]

[0051]

[0052] Table 3 PCR reaction conditions

[0053] Reaction Procedure Reaction conditions Pre-variation 96℃, 5min transsexual 96℃,15s annealing 58℃,10s Extension 1 72℃, 30s, 30 cycles Extension 2 72℃, 5min

[0054] 2) The amplification product obtained in step 1) was analyzed using an agarose gel electrophoresis to recover the target fragment. The electrophoresis results are as follows: Figure 1 As shown.

[0055] The recovered target sequence fragment was sequenced, and after sequence alignment, it was found that the target fragment completely matched the sequence of the fungal laccase overexpression gene GME12003_g in this application, thus successfully obtaining the fungal laccase overexpression gene GME12003_g.

[0056] Example 2

[0057] This embodiment provides a method for preparing a fungal laccase overexpression plasmid, comprising the following steps:

[0058] 1) The fungal laccase overexpression gene GME12003_g and the empty vector pet-28a obtained in Example 1 were double digested with BamHI and XhoI, and then the digestion products were ligated using T4 DNA ligase to obtain the ligation vector.

[0059] 2) The vector obtained in step 1) was transformed into E. coli DH5α competent cells, cultured and screened to obtain positive clones, and after sequencing verification, plasmid was extracted to obtain the recombinant plasmid pet-28a-GME12003_g.

[0060] 3) Using the recombinant plasmid obtained in step 2) as a template, PCR amplification was performed to obtain the target sequence. The amplification product was detected by 1% agarose gel and the target fragment was recovered. The amplification primers are shown in Table 4, the amplification system is shown in Table 5, and the amplification conditions are shown in Table 6.

[0061] Table 4 Amplification Primers

[0062]

[0063] Table 5 PCR reaction system

[0064] Component Name Added amount pet-28a-GME12003_g plasmid 2μL 2×ApexHFFLPCRMasterMix 25μL L22-GME12003_g-F 2μL L24-GME12003_g-R 2μL <![CDATA[ddH2O]]> Add to 50μL

[0065] Table 6 PCR reaction conditions

[0066]

[0067]

[0068] 4) Using the target fragment recovered in step 3) as a template, perform PCR amplification again to obtain the L22-GME12003_g-L24 sequence. The PCR primers used are shown in Table 7 below, the PCR system is shown in Table 8 below, and the PCR conditions used are the same as in step 3).

[0069] Table 7 Amplification Primers

[0070] Primers Sequence (5'-3') L22 ACATCCACCATCTCCGTTTTCCCCATCTACACACAACAAGCTTATCGCC L24 TGACTATAGCAGCCTCCTACCACTGGCCCTCTGGTCAACTATAATATTAT

[0071] Table 8 PCR Reaction System

[0072] Component Name Added amount Glue recycling purpose segment 4μL 2×ApexHFFLPCRMasterMix 25μL L22 2μL L24 2μL <![CDATA[ddH2O]]> Add to 50μL

[0073] 5) The recombinant pYSK7 plasmid was double-digested with BamHI and XhoI, incubated at 37℃ for 1.5h, and detected by 1% agarose gel electrophoresis. The target fragment was recovered to obtain the linearized pYSK7 plasmid. The enzyme digestion reaction system is shown in Table 9.

[0074] Table 9. Double Enzyme Digestion Reaction System

[0075]

[0076]

[0077] The recombinant pYSK7 plasmid is a pYSK7 plasmid recombined with a promoter, and the nucleotide sequence of the promoter of the recombinant pYSK7 plasmid is shown in SEQ ID No: 2.

[0078] 6) Finally, using competent cells of Saccharomyces cerevisiae, the L22-GME12003_g-L24 sequence prepared in step 4) was ligated with the linearized pYSK7 plasmid prepared in step 5) by homologous recombination to obtain the fungal laccase overexpression plasmid.

[0079] The specific steps of the homologous recombination ligation are as follows:

[0080] a. Mix 100 ng of the overexpression plasmid with the vector plasmid separately and place them in a pre-cooled Ep tube;

[0081] b. Preheat the Carrier DNA in a boiling water bath for 5 minutes to denature it into a single-stranded state. After pre-cooling, take 5 μL of Carrier DNA and add it to the mixture.

[0082] c. Add 100 μL of Y1H competent cells that have been thawed on ice and gently mix.

[0083] d. Add 500 μL of PEG / LiAc solution (PEG3500, TE Buffer, and LiAc are mixed in a ratio of 8:1:1), gently mix by pipetting, and react in a 30°C water bath for 30 min.

[0084] e. Centrifuge the reaction solution at 12000g for 10s, discard the supernatant, and resuspend the bacterial cells in 1ml LYPDA medium;

[0085] f. Incubate the resuspended solution in a shaker at 30°C and 200 rpm for 1 hour;

[0086] g. Centrifuge the resuspended solution at 12000g for 15s, discard the supernatant, and add 1mL of NaCl (0.9%) solution to resuspend the bacterial cells;

[0087] h. Centrifuge the resuspended solution at 12000g for 10s, discard the supernatant, and take 200μL of bacterial solution to spread on SD / -Ura solid medium. Incubate at 30℃ for 3 days.

[0088] i. Randomly select 5 transformants and transfer them into 5 mL of liquid medium supplemented with Amp resistance. Incubate with shaking at 30°C and 200 rpm.

[0089] j. Incubate on a shaker for 16 hours; then centrifuge the culture medium at 12000g for 10 minutes, collect the bacterial cells, and store them in a -80℃ refrigerator for later use.

[0090] k. Following the instructions of the TIANGEN yeast plasmid extraction kit, yeast plasmids were extracted, overexpression plasmids were prepared, and sent to the company for sequencing.

[0091] Example 3

[0092] This embodiment provides a method for constructing and screening strains that overexpress fungal laccase.

[0093] In this embodiment, the wild laccase-producing strain T. hirsutaAH28-2 was selected as the basic strain.

[0094] The obtained overexpression plasmid was transformed into the protoplasts of *T. hirsuta* AH28-2 using the PEG method. After regeneration, primary screening, and secondary screening, the overexpression strain was obtained. The specific method is as follows:

[0095] (1) Preparation of protoplasts

[0096] The preparation of protoplasts specifically includes the following steps:

[0097] A. Take 10 CPDA plates to culture T. hirsuta AH28-2 strain, set the culture environment to 28℃, and control the culture time to 7-8 days;

[0098] B. Under aseptic conditions, add 5 mL of sterile water to each CPDA plate to soak the mycelium, scrape the mycelium from the surface of the plate with a sterile spatula, filter it through a spore filter, and retain the filtrate.

[0099] C. Centrifuge the filtrate at 3000g for 10 min, discard the supernatant under aseptic conditions, and obtain mycelial precipitate;

[0100] D. Add 8 mL of MM buffer to the mycelial pellet to resuspend and wash the spores. After simple counting, centrifuge again and discard the supernatant to obtain the mycelial cells.

[0101] E. Resuspend the spores in 1 mL (depending on the amount of spores) of cell wall lysin solution (containing 0.5% chitinase and 1.5% cellulase) and place them in a 37℃ constant temperature incubator for 5 hours to lyse. Observe the degree of spore enzymatic hydrolysis under a microscope every hour. When the protoplast formation rate reaches more than 50%, add 5 mL of MMC solution to terminate the enzymatic hydrolysis reaction and obtain a cell suspension.

[0102] F. Centrifuge the cell suspension at 640g for 10min, and slowly discard the supernatant under aseptic conditions to obtain the cell pellet.

[0103] G. Add 400 μL of filtered and sterilized MMC buffer to the cell pellet to prepare T. hirsuta AH28-2 protoplasts.

[0104] (2) Transformation of protoplasts

[0105] The specific steps are as follows:

[0106] A. The successfully constructed overexpression plasmid was inoculated into LB liquid medium, and the plasmid was prepared in medium quantities using the SDS lysis method;

[0107] B. Take 100 μL of protoplasts, 25 μL of PEG solution and 2 μg of overexpression plasmid and put them into a sterile pre-cooled EP tube. Mix well and let stand at low temperature for 20 min. Add 500 μL of sterile PEG solution and mix well. React at room temperature for 5 min.

[0108] C. Add 1 mL of sterile STC buffer to the system, mix well, spread 350 μL of the mixture on the regeneration medium, and incubate at 28°C for 24 h.

[0109] D. Cover the regeneration medium with 5 mL of regeneration medium containing hygromycin (final concentration of 300 μg / mL) and incubate at 28°C for 72 h to obtain transformants.

[0110] (3) Screening of positive transformants

[0111] Includes the following steps:

[0112] A. Under aseptic conditions, remove the monoclonal transformant using an inoculation loop and transfer it to a regeneration medium containing hygromycin at a final concentration of 300 μg / mL;

[0113] B. After 3 days, the transformed strains with hygromycin resistance were transferred to new CPDA medium and cultured for 7-8 days;

[0114] C. After the culture is completed, scrape the hyphae from the plate, add 50 μL of fungal genome extraction reagent MightyPrep, vortex to mix, incubate in boiling water for 10 min, then freeze in liquid nitrogen, incubate in boiling water for 10 min, freeze in liquid nitrogen again, incubate in boiling water for 5 min, centrifuge at 12000g for 1 min, and transfer the supernatant to a sterile EP tube to obtain the genome solution;

[0115] D. Using L22 and L24 sequences as upstream and downstream primers, and genomic solution as template solution, PCR amplification was performed. The PCR reaction system is shown in Table 10. The PCR amplification conditions were: 96℃ pre-denaturation for 5 min, 96℃ denaturation for 15 s, 58℃ annealing for 10 s, 72℃ extension for 30 s, for a total of 30 cycles, and finally 72℃ extension for 5 min.

[0116] Table 10 PCR Reaction System

[0117] Component Name Added amount Genome 6μL 2×ApexHFFLPCRMasterMix 10μL L22 0.5μL L24 0.5μL <![CDATA[ddH2O]]> Add to 20μL

[0118] E. The amplification products were detected by 1% agarose gel electrophoresis. Transformed strains with the target gene band were all strains that had been successfully transformed into the fungal laccase overexpression plasmid.

[0119] (4) Screening of transcriptional levels of overexpression strains

[0120] Includes the following steps:

[0121] 1) RNA was extracted from wild-type and PCR-selected positive transformants and reverse transcribed into cDNA;

[0122] 2) Using the cDNA obtained in step 1) as a template, trans-intron fluorescence quantitative PCR primers were designed. The glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH) was used as an internal control gene. The transcriptional levels of lacA and GME12003_g were analyzed by qRT-PCR using the SYBR Premix Ex Taq™ II kit (Takara) on a LightCycler 96 (Roche) using specific primer sets. The specific primer sets are shown in Table 11 below, the qRT-PCR reaction system is shown in Table 12, and the amplification conditions are shown in Table 13.

[0123] Table 11 Specific primer sequences

[0124] Primer name Sequence (5'-3') lacA-qF TCCTTCGTGTTGAATGCCGA lacA-qR GTTGATACCGCCCGCAAATC GME12003_g-qF ACAAGGATGGCGAAGAGGGT GME12003_g-qR TGCACTGATTGCACCGACG GAPDH-qF GCCGCTTCAAGGGCAAAGTC GAPDH-qR TGTAGTCGGCACCAACGGA

[0125] Table 12 qRT-PCR reaction system

[0126] Component Name Added amount T. hirsuta AH28-2cDNA 1μL 2×SYBRPremixExTaqII 10μL lacA-qF / GME12003_g-qF 1μL lacA-qR / GME12003_g-qR 1μL <![CDATA[ddH2O]]> 7μL Total 20μL

[0127] Table 13 PCR Reaction Conditions

[0128]

[0129]

[0130] 3) The strains that overexpressed the fungal laccase gene GME12003_g were selected through secondary screening, and the transcription level of the fungal laccase overexpression gene was significantly higher than that of the wild-type T. hirsutaAH28-2, thus obtaining the fungal laccase overexpression strains.

[0131] In this embodiment, the strain with the highest transcriptional level of the fungal laccase overexpression gene GME12003_g was selected. The results obtained from the detection and analysis are as follows: Figure 2 and Figure 3 As shown.

[0132] Depend on Figure 2 and Figure 3 As can be seen, compared with the wild-type T. hirsuta AH28-2 strain, the laccase gene lacA transcription level of the fungal laccase overexpression strain finally screened in this embodiment increased by more than 1.4 times, and the transcription level of the GME12003_g gene increased by more than 2 times.

[0133] Using the cultured strain as the base strain, after subculturing, the resulting bacterial cells were subjected to qRT-PCR again, following essentially the same procedures as the qRT-PCR rescreening described in this embodiment. The results showed that the expression levels of the laccase gene lacA and the GME12003_g gene in the subcultured bacterial cells were not significantly different from those of the base strain. Therefore, the fungal laccase overexpression strain of this application can stably overexpress the fungal laccase overexpression gene GME12003_g through subculturing.

[0134] Example 4: Preparation of laccase from overexpressing fungal laccase strains

[0135] This embodiment selects the *Trametes hirsuta* AH28-2 (GME12003_g-OE-5) strain of the present invention, and specifically includes the following steps:

[0136] 1) Activate the overexpression strain by inoculating it onto CPDA plates. Take a piece of bacterial cell from the glycerol tube and inoculate it in the center of the CPDA solid medium plate. Place it in a 28℃ incubator for static incubation and observe continuously. Activation is complete when the hyphae grow to 1cm from the edge of the culture dish (7-8 days).

[0137] 2) Use a punch to take 6 mycelial blocks with a diameter of about 0.5 cm from the activated plate, put them into 100 mL of XH medium and shake them for culture. The culture conditions are: 28℃, 120 rpm.

[0138] 3) After four days of culture, homogenize the cells, take out 5% (v / v) of the cells and place them in a new 100mL XH medium, and continue to culture at 28℃ and 120rpm.

[0139] The XH culture medium consists of the following components: 1.5% cellobiose, 0.1% tryptone, 0.15% DL-asparagine, 0.01% Na₂HPO₄, 0.1% KH₂PO₄, 0.001% CaCl₂, 0.001% FeSO₄·7H₂O, 0.00257% adenine sulfate, 0.000005% vitamin B1, and 0.0002% CuSO₄·7H₂O. The medium is sterilized at 115°C for 30 minutes.

[0140] 4) After three days of cultivation, take a sample and record it as 0h. After centrifugation at 4℃, take the supernatant to measure enzyme activity. Then take the fermentation broth every 24 hours according to the time mark. Stop fermentation when the enzyme activity reaches the highest level (about 144h).

[0141] 5) Centrifuge the fermentation broth to remove the supernatant, and then concentrate and purify it by ultrafiltration to obtain laccase.

[0142] Testing experiment:

[0143] Using the wild-type *T. hirsuta* AH28-2 strain as a control, the laccase activity of both *Trametes hirsuta* AH28-2 (GME12003_g-OE-5)* strain and the wild-type *T. hirsuta* AH28-2 strain was detected using the same procedures as in this example. Samples were taken at seven time points during fermentation: 0h, 24h, 48h, 72h, 96h, 120h, and 144h to determine the total laccase activity and isozyme profile.

[0144] The test results are as follows Figure 4 and Figure 5As shown, the results indicate that the Trametes hirsuta AH28-2 (GME12003_g-OE-5) strain of the present invention can achieve laccase activity of 1000 U / L without induction, which is about 3 times that of the wild-type strain. This strain has the characteristic of high-efficiency expression of laccase.

[0145] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A fungal laccase overexpression gene GME12003_g, characterized in that, The nucleic acid sequence of the fungal laccase overexpression gene GME12003_g is shown in SEQ ID No:

1.

2. A method for preparing a fungal laccase overexpression plasmid, characterized in that, Includes the following steps: a. The overexpressed gene GME12003_g and the empty vector pet-28a described in claim 1 are digested with enzymes and then ligated with DNA ligase to obtain a ligation vector; b. Transform the ligation vector into E. coli DH5α competent cells, culture them, and screen to obtain recombinant plasmids; c. Using L22-GME12003_g-F and L24-GME12003-R as primers, and the recombinant plasmid obtained in step b as a template, the target overexpressed gene was amplified. L22-GME12003_g-F: ACACACAACAAGCTTATCGCCATGAACATCCCTCTCTTCC; L24-GME12003_g-R: TCTGGTCAACTATAATATTATTCATCTCCCCATCGCCATCGCGAG; d. After purifying the obtained target overexpression gene, use it as a template and amplify the L22-GME12003_g-L24 element using L22 and L24 as primers; L22: ACATCCACCATCTCCGTTTTTCCCCATCTACACACAACAAGCTTATCGCC; L24: TGACTATAGCAGCCTCCTACCACTGGCCCTCTGGTCAACTATAATATTAT; e. Using the Saccharomyces cerevisiae homologous recombination method, the L22-GME12003_g-L24 element obtained in step d is ligated to the linearized recombinant pYSK7 plasmid to obtain a fungal laccase overexpression plasmid.

3. The method for preparing a fungal laccase overexpression plasmid as described in claim 2, characterized in that, The method for preparing the linearized recombinant pYSK7 plasmid is as follows: the recombinant pYSK7 plasmid is digested with enzymes, and the digestion product is incubated at 37°C for 1.5 h and then purified by agarose gel electrophoresis to obtain the linearized recombinant pYSK7 plasmid; the recombinant pYSK7 plasmid is a pYSK7 plasmid recombined with a promoter, and the nucleotide sequence of the promoter of the recombinant pYSK7 plasmid is shown in SEQ ID No:

2.

4. A fungal laccase overexpression strain, characterized in that, The laccase overexpressing fungal strain has the following accession number: CCTCCM20242538, depositary institution: China Center for Type Culture Collection, address: Wuhan University, Wuhan, China, deposit date: November 12, 2024. The laccase overexpressing fungal strain was obtained by overexpressing the fungal gene GME12003_g in Trametes sp. AH28-2; the laccase overexpressing fungal strain is named Trametes hirsutaAH28-2(GME12003_g-OE-5).

5. A method for preparing a fungal laccase overexpression strain as described in claim 4, characterized in that, Includes the following steps: (1) Preparation of protoplasts of wild-type strain T. hirsuta AH28-2; (2) The overexpression plasmid is then transformed into the protoplasts described in step (1); (3) The transformed protoplasts were regenerated, initially screened and then screened again to obtain overexpression strains of fungal laccase.

6. A method for expressing fungal laccase, characterized in that, The overexpression strain as described in claim 4 or the overexpression strain prepared by the method of claim 5 was cultured in XH medium for 144 h. The fermentation broth was centrifuged to remove the bacterial cells, and the fermentation supernatant was obtained. Laccase activity was then measured.

7. The method for expressing fungal laccase as described in claim 6, characterized in that, The XH culture medium consists of the following components: 1.5% cellobiose, 0.1% tryptone, 0.15% DL-asparagine, 0.01% Na₂HPO₄, 0.1% KH₂PO₄, 0.001% CaCl₂, 0.001% FeSO₄·7H₂O, 0.00257% adenine sulfate, 0.000005% vitamin B1, and 0.0002% CuSO₄·7H₂O. The medium is sterilized at 115°C for 30 minutes.

Citation Information

Patent Citations

  • Regulators involved in mushroom formation

    CN102459318A

  • Fungus laccase overexpression gene, overexpression strain and expression method

    CN118127045A