Sweet potato anti-root rot gene ibpxc3 and application thereof

Abstract

The present application relates to the technical field of genetic engineering, and proposes a sweet potato root rot resistance gene IbPXC3 and application thereof, wherein the nucleotide sequence of the sweet potato root rot resistance gene IbPXC3 is shown as SEQ ID NO:1. The above technical solution solves the problem of poor sweet potato root rot resistance in the related art.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, in particular to a sweet potato root rot resistance gene IbPXC3 and application thereof. BACKGROUND

[0002] Sweet potato is an important food, feed and industrial raw material crop in the world, which occupies a significant position in global agricultural production. It has the advantages of strong adaptability, high yield and rich nutrition, and is widely planted in tropical, subtropical and temperate regions. However, sweet potato is susceptible to a variety of pests and diseases during growth, among which the root rot caused by Fusarium oxysporum f. sp. batatas is one of the most destructive diseases that seriously restrict sweet potato production. Root rot can cause sweet potato roots to rot, growth and development to be hindered, leaf yellowing and wilting, tuber yield to be greatly reduced, and quality to be deteriorated. This has a very adverse effect on the economic benefits of sweet potato growers and threatens the stable development of the sweet potato industry.

[0003] At present, the prevention and control of sweet potato root rot mainly relies on agricultural control measures and chemical pesticide control. Although it can reduce the occurrence of root rot to some extent, there are still many limitations. For example, the rotation period is long, which is difficult to effectively implement in areas with limited land resources. The process of breeding disease-resistant varieties is slow, and traditional breeding methods have the problems of long cycle, low efficiency, limited available disease-resistant gene resources, etc. Although chemical pesticide control can control the spread of the disease in the short term, long-term use not only increases production costs, but also causes a series of problems such as increased resistance of pathogenic bacteria, environmental pollution, and excessive pesticide residues in agricultural products.

[0004] With the rapid development of modern biotechnology, genetic engineering technology provides a new way and strategy for crop disease-resistant breeding. By identifying and cloning disease-resistant genes and introducing them into target crops, new varieties with persistent and efficient disease resistance can be bred. However, the genes for resistance to sweet potato root rot still need to be further developed and applied. SUMMARY

[0005] The present application provides a sweet potato root rot resistance gene IbPXC3 and application thereof, which solves the problem of poor resistance to root rot in related technologies.

[0006] The technical scheme of the present application is as follows:

[0007] The present application provides a sweet potato root rot resistance gene IbPXC3, and the nucleotide sequence of the sweet potato root rot resistance gene IbPXC3 is shown in SEQ ID NO: 4.

[0008] The present application also provides a protein encoded by the sweet potato root rot resistance gene IBPXC3, and the amino acid sequence of the protein is shown in SEQ ID NO: 2.

[0009] The application further provides a recombinant overexpression vector pCAMBIA1301S-IbPXC3 containing the gene IbPXC3.

[0010] As a further technical scheme, the overexpression vector of the gene IbPXC3 is obtained by constructing the gene IbPXC3.

[0011] As a further technical scheme, the overexpression vector of the gene IbPXC3 comprises the following construction steps.

[0012] S1, amplifying the target gene IbPXC3 containing XbaI and KpnI enzyme cutting sites at both ends of ORF shown as SEQ ID NO. 4 through PCR;

[0013] S2, linearizing the pCAMBIA1301SS plasmid by using XbaI and KpnI;

[0014] S3, connecting the target gene IbPXC3 containing XbaI and KpnI enzyme cutting sites with the linearized pCAMBIA1301S plasmid to obtain a recombination product, then performing transformation sequencing in an E.coli competent cell to obtain the overexpression vector pCAMBIA1301S-IbPXC3 of the gene IbPXC3.

[0015] As a further technical scheme, the E.coli competent cell in S3 is DH5a.

[0016] The application further provides an application of the gene IbPXC3, the protein, the recombinant expression vector or the transformant in resisting root rot of sweet potato.

[0017] As a further technical scheme, the application is cultivating sweet potato resistant to root rot or preparing a product for cultivating sweet potato resistant to root rot.

[0018] The application further provides a method for cultivating sweet potato resistant to root rot, which comprises the step of introducing the sweet potato root rot resistant gene IbPXC3 into a receptor sweet potato to obtain sweet potato resistant to root rot.

[0019] The working principle and beneficial effects of the application are as follows.

[0020] In the application, Jishu Zi 203 with high resistance to root rot and Jishu Zi 563 with high susceptibility to root rot are screened from the hybrid offspring of Jishu Zi 203 with high resistance to root rot as the female parent and Longshu 9 with high susceptibility to root rot as the male parent, and the RNA of 0h, 36h, 72h, 5d and 10d after natural nursery treatment is used to construct a cDNA library, and the transcriptome sequencing is carried out by using an Illumina Hiseq 2500 platform, 137 differential genes are screened through differential gene analysis, the IbPXC3 gene is cloned and analyzed, and it is obtained through expression analysis of the IbPXC3 gene that the expression amount of the IbPXC3 gene in tubers is the highest, followed by fibrous roots, leaves and stems, and the coded protein of the IbPXC3 gene is distributed in the cell membrane, nucleus and cytoplasm of tobacco cells. Finally, it is obtained through gene function verification that the IbPXC3 has the function of improving the resistance of sweet potato to root rot. BRIEF DESCRIPTION OF DRAWINGS

[0021] The application will be further described in detail below in combination with the drawings and specific embodiments.

[0022] Figure 1 It is the root rot infection process diagram of Jishu Zi 203 and Jishu Zi 536 in the embodiment 1 of the application;

[0023] Figure 2 It is the differential expression gene of Jishu Zi 203 in the embodiment 1 of the application;

[0024] Among them, A is the up-regulated expression gene, and B is the down-regulated expression gene;

[0025] Figure 3 It is the differential expression gene of Jishu Zi 563 in the embodiment 1 of the application;

[0026] Among them, A is the up-regulated expression gene, and B is the down-regulated expression gene;

[0027] Figure 4 It is the differential expression gene of Jishu Zi 203 and Jishu Zi 563 in the application;

[0028] Among them, A is the up-regulated and down-regulated expression gene of Jishu Zi 203 and Jishu Zi 563 at each time point; B is the down-regulated and up-regulated expression gene of Jishu Zi 203 and Jishu Zi 563 at each time point; C is the up-regulated expression gene of Jishu Zi 203 at 36h, 72h, 120h, 240h compared with 0h, and the up-regulated expression gene of Jishu Zi 203 compared with Jishu Zi 563;

[0029] Figure 5 It is the cDNA and DNA product of IbPXC3 in the embodiment 3 of the application;

[0030] Among them, C is the cDNA product, and D is the DNA product;

[0031] Figure 6 Figure 3 is a diagram of IbPXC3 exon and intron analysis in Example 3 of the present application;

[0032] Figure 7 Figure 4 is a diagram of IbPXC3 protein transmembrane domain in Example 3 of the present application;

[0033] Figure 8 Figure 5 is a diagram of homologous phylogenetic tree constructed by MAGE7.0 software in Example 3 of the present application;

[0034] Figure 9 Figure 6 is a diagram of IbPXC3 tissue expression analysis in Example 3 of the present application;

[0035] Figure 10 Figure 7 is a diagram of IbPXC3 protein expression in tobacco cells in Example 3 of the present application;

[0036] Figure 11 Figure 8 is the expression amount of IbPXC3 gene in different periods of sweet potato underground stems in Example 3 of the present application;

[0037] Figure 12 Figure 9 is the overexpression positive plant detection result in Example 3 of the present application;

[0038] Figure 10 is the detection result of Hpt-F and Hpt-R primers, and the detection result of IbPCK3-O-F and JD-13sFlag-R primers, wherein 1-9 is the detection result of Hpt-F and Hpt-R primers, and 10-18 is the detection result of IbPCK3-O-F and JD-13sFlag-R primers;

[0039] Figure 13 Figure 11 is the interference expression positive plant detection result in Example 3 of the present application;

[0040] Figure 12 is the detection result of pCRD-infu-F and pFGC5941-M1R primers, and the detection result of pFGC5941-M2F and pCRD-infu-R primers, wherein the upper row is the detection result of pCRD-infu-F and pFGC5941-M1R primers, and the lower row 10-18 is the detection result of pFGC5941-M2F and pCRD-infu-R primers;

[0041] Figure 14 Figure 13 is the overexpression and interference of sweet potato plant root rot resistance identification in Example 4 of the present application. DETAILED DESCRIPTION

[0042] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor also fall within the scope of protection of the present application.

[0043] Example 1 Determination of differential genes

[0044] (1) Take high root rot disease resistant variety Jishuizi 1 as female parent, and high root rot disease susceptible variety Longshu 9 as male parent to carry out hybridization. Among the hybrid offspring, high root rot disease resistant line Jishuizi 203 and high root rot disease susceptible line Jishuizi 563 are screened out. RNA extracted from 0h, 36h, 72h, 5d and 10d after natural disease nursery and clean soil treatment is used to construct a cDNA library, and Illumina Hiseq 2500 platform is used for transcriptome sequencing, Figure 1 The root rot disease infection conditions of Jishuizi 203 and Jishuizi 536 at 5d, 10d, 15d, 20d, 40d and 120d are determined.

[0045] The high-throughput method is used to screen the 0h, 36h, 72h, 5d and 10d differential expression genes of sweet potato resistant to root rot disease. The function annotation and enrichment analysis of differential genes are carried out to determine the possible biological functions and main biological metabolic pathways and signal transduction pathways involved by the differential genes. The genome of cultivated sweet potato Taizhong 6 is used as a reference for sequence alignment and subsequent analysis.

[0046] The differential gene analysis strategy is as follows: the differential expression genes of Jishuizi 203 at 36h, 72h, 120h and 240h compared with 0h after root rot disease induction, and the differential expression genes of Jishuizi 563 at 36h, 72h, 120h and 240h compared with 0h. The statistical results show that under the induction of root rot disease, Jishuizi 203 and Jishuizi 563 obtain 34603 and 30011 differential expression genes respectively (Table 1). Among them, the up-regulated genes of Jishuizi 203 at 36h, 72h, 120h and 240h compared with 0h are 3072, 4379, 5160 and 5087 respectively, and the common up-regulated genes are 1082 (A), and the down-regulated genes are 2763, 4782, 5429 and 3931, and the common down-regulated genes are 1209 (B); the up-regulated genes of Jishuizi 563 at 36h, 72h, 120h and 240h compared with 0h are 3632, 3965, 3822 and 4683 respectively, and the common up-regulated genes are 1380 (A), and the down-regulated genes are 3548, 3877, 2940 and 3544, and the common down-regulated genes are 1018 (B). Figure 2 Figure 2 Figure 3 Figure 3

[0047] Table 1 Differential expression gene statistics of Jishuizi 203 and Jishuizi 563

[0048]

[0049] ​​​​In the differentially expressed genes of Jishuzi 203 and Jishuzi 563, differentially expressed genes with opposite expression patterns were screened. The results showed that the number of differentially expressed genes that were upregulated at all time points in Jishuzi 203 and downregulated at all time points in Jishuzi 563 was 0. Figure 4 A), there were 7 differentially expressed genes that were downregulated at all time points of Jishuzi 203 and upregulated at all time points of Jishuzi 563. Figure 4 B), in addition, 137 genes were upregulated at 36h, 72h, 120h, and 240h in Jishuzi 203 compared to 0h, and also compared to the corresponding 36h, 72h, 120h, and 240h in Jishuzi 563. Figure 4 C).

[0050] Example 2: Screening of the root rot resistance-related gene IbPXC3

[0051] Jishuzi 203 and Jishuzi 563 were planted in a diseased nursery with uniform sweet potato root rot. Samples were taken at 0h, 36h, 72h, 120h and 240h, respectively. The gene expression levels of 137 differentially expressed genes screened out were measured and gene annotations were performed in Jishuzi 203 and Jishuzi 563 at different time points.

[0052] The results showed that among the 137 differentially expressed genes, the expression levels of the IbPXC3 gene in Jishuzi 203 at 36h, 72h, 120h, and 240h were higher than at 0h, and also higher than the expression levels in Jishuzi 563 at the corresponding time points. Furthermore, the expression level of the IbPXC3 gene peaked at 120h. Therefore, the gene IbPXC3, which is associated with resistance to root rot, was selected for cloning and analysis. Table 2 shows the expression levels in Jishuzi 203 and Jishuzi 563 after root rot induction.

[0053] Table 2. Expression levels of *Shuzi* 203 and *Shuzi* 563 after root rot induction.

[0054]

[0055] (1) IbPXC3 gene characteristic analysis

[0056] Leucine-rich repeat receptor-like protein kinases (LRR-RLKs) are the largest known subfamily of transmembrane receptor kinases in the plant genome, consisting of three parts: an extracellular LRR domain, a transmembrane domain, and an intracellular kinase domain. The LRR domain contains 1–32 tandem repeats of LRRs, each LRR consisting of a 20–24 conserved amino acid sequence: LxxLxLxxNxLt / sGxIPxxLGxLxx (where L represents hydrophobic amino acids such as leucine, isoleucine, capsidine, or phenylalanine, and X represents any amino acid). Recent studies have shown that LRR-RLKs play important roles in regulating plant growth and development, plant-microbe immune defense responses, hormone signaling pathway regulation, and stress resistance.

[0057] PXC PXY / TDR-correlated genes are also a typical class of LRR-RLK genes. In Arabidopsis, TDIF (tracheary element differentiation inhibitory factor) and the TDIF receptor PXY / TDR (phloem intercalated with xylem) can regulate vascular bundle cell growth. The TDIF-PXY / TDR signaling pathway is believed to be necessary for localizing vascular bundle polarity in early vascular bundle development and to continuously regulate this process throughout development. In vascular tissues, the TDIF-PXY / TDR signaling pathway plays multiple roles in xylem development, such as promoting cambium cell division and inhibiting xylem formation. The absence of PXC1 may delay the formation of secondary cell wall deposition, while whether PXC is involved in resistance to root rot requires further investigation.

[0058] Example 3 Cloning and Functional Identification of the Sweet Potato IbPXC3 Gene

[0059] 3.1 Materials and Methods

[0060] 3.1.1 Sweet potato materials, strains, and plasmid vectors

[0061] Plant materials: Sweet potato material Jishuzi 203 (resistant to root rot) was used for total RNA extraction and cloning of the IbPXC3 gene. Jiyuan 2 (moderately resistant to root rot) was used for sweet potato genetic transformation via rooting.

[0062] Strains: Escherichia coli DH5α (Shanghai Weidi Biotechnology Co., Ltd.), Agrobacterium K599 and EHA105 (Shanghai Weidi Biotechnology Co., Ltd.).

[0063] The vector plasmids pCAMBIA1301S and pFGC5941, which contain the hygromycin resistance selection marker gene (HygR), were used to construct sweet potato overexpression vectors and interference expression vectors, respectively, and are currently stored in our laboratory.

[0064] Both the pCAMBIA1301S and pFGC5941 vectors are described in the following literature: You C, Li C, Ma M, Tang W, Kou M, Yan H, Song W, Gao R, Wang X, Zhang Y, Li Q. A C2-DomainAbscisic Acid-Related Gene, IbCAR1, Positively Enhances Salt Tolerance in Sweet Potato (Ipomoea batatas (L.) Lam.). Int. J. Mol. Sci. 2022, 23(17):9680. doi: 10.3390 / ijms23179680.

[0065] 3.1.2 Obtaining the CDS sequence of the IbPXC3 gene

[0066] 3.1.2.1 Total RNA extraction from sweet potato

[0067] Leaves of Jishuzi 203 were frozen in liquid nitrogen, ground, and total RNA was extracted from Jishuzi 203 using the TRANS EasyPure Universal PlantTotal RNA Kit (ER302).

[0068] The specific extraction method is as follows:

[0069] Referring to the TRANS EasyPure Universal Plant Total RNA Kit (ER302), the specific steps are as follows:

[0070] 1. Weigh approximately 100 mg of fresh plant tissue that has been ground in liquid nitrogen into a 1.5 mL sterile centrifuge tube.

[0071] 2. Add 700 µL of lysis buffer LB52 to the ground sample and mix thoroughly. Incubate at 65°C for 5 min.

[0072] 3. Add 175 µL of PB52 solution, mix thoroughly, centrifuge at 13,500×g for 3 min, transfer all supernatant to Filtration Columns with Collection Tubes (there may be a small amount of precipitate or impurities in the supernatant, which will not affect downstream extraction), then centrifuge at 13,500×g for 2 min. If the solution is viscous after lysis, add PB52 and incubate on ice for 5 min before centrifuging.

[0073] 4. Add 350 µL of isopropanol to the above collection tube, and mix by inverting the tube. At this time, flocculent precipitate may appear.

[0074] 5. Take all the above mixture and add it to the RNA Spin Columns with Collection Tubes II in two portions. Centrifuge at 13,500×g for 30 s and discard the eluent.

[0075] 6. Add 80 µL of DNase I working solution to the center of the adsorption column filter membrane and let it stand at room temperature for 10 min.

[0076] Preparation of DNase I working solution: Add 70 μL of DNase I Reaction Buffer to an RNase-free centrifuge tube, then add 10 µL of DNase I and mix well.

[0077] 7. Add 500 µL of CB52 solution, centrifuge at 13,500×g for 30 s, and discard the effluent (please check whether anhydrous ethanol has been added before using CB).

[0078] 8. Add 500 µL of WB52 solution, centrifuge at 13,500 × g for 30 s, and discard the eluent (please check whether anhydrous ethanol has been added before using WB).

[0079] 9. Repeat step 8 once.

[0080] 10. Centrifuge at 13,500×g for 2 min to completely remove residual WB52. Place the adsorption column in a clean centrifuge tube.

[0081] 11. Add 50-100 µL of RNase-free water to the center of the adsorption column, let stand at room temperature for 2 min, centrifuge at 13,500× g for 1 min, and elute the RNA.

[0082] 12. To obtain more RNA, repeat step 10 for a second elution. Store the RNA solution at -80°C for later use.

[0083] 3.1.2.2 cDNA First-Strand Synthesis

[0084] Using the extracted total RNA as a template, the first strand of cDNA was synthesized by reverse transcription using Reverse Transcriptase M-MLV (RNase H-) (TaKaRa).

[0085] The specific methods for first-strand cDNA synthesis are as follows:

[0086] Reverse transcription was performed using Reverse Transcriptase M-MLV (RNase H-) (TaKaRa). The specific steps are as follows:

[0087] 1. Add the following components to a 200 µL PCR tube:

[0088] Table 3

[0089]

[0090] 2. Mix the above ingredients thoroughly and centrifuge briefly;

[0091] 3. 70℃, 10 min; on ice for 2 min, then instantaneous centrifugation;

[0092] 4. Add the following ingredients (containing 6 µL) to the centrifuge tube:

[0093] Table 4

[0094]

[0095] 5. 42℃, 1 h; 70℃, 15 min;

[0096] 6. Store at -20℃ for later use.

[0097] 3.1.2.3 IbPXC3 gene cDNA amplification

[0098] The partial IbPXC3 sequence obtained from the transcriptome was aligned with the reference genome website of the sweet potato wild relative Ipomoea triloba (http: / / sweetpotato.uga.edu / ) to obtain the CDS sequence of the IbPXC3 gene. Primers IbPXC3-F: GATCAGAAAAACATCATGGGTAGAC and IbPXC3-R: TTCTCTTTTGGTAATTTGGTGTAAG were designed on the two segments of the IbPXC3 gene CDS sequence using the Primer 3.0 online tool. Amplification was performed using KOD FX high-fidelity enzyme with cDNA from Jishuzi 203 as a template. The amplification system (Table 5) and procedure are as follows:

[0099] Table 5 Amplification System

[0100]

[0101] Amplification procedure:

[0102]

[0103] PCR products were detected by 1.0% agarose gel electrophoresis.

[0104] 3.1.2.4 Purification and Recovery of Target Fragment

[0105] For the amplification products, electrophoresis loading buffer was added, and agarose gel electrophoresis was performed using fresh electrophoresis buffer. The electrophoresis results were imaged using a UV gel imaging system, and the target bands were selected for gel extraction and recovery. Gel extraction was performed using the TRANS EasyPure Quick Gel Extraction Kit (EG101).

[0106] 3.1.2.5 Target Fragment Connection and Transformation

[0107] The target fragment was ligated using the TRANS pEASY-Blunt Zero Cloning Kit (CB501), and the reaction system is shown in the table below:

[0108] Table 6

[0109]

[0110] The DNA concentration in the gel recovery product should ideally be 50-150 ng / µL. The ligation reaction should be performed at 25°C for 30 min. The ligation product is then transformed into competent E. coli DH5α cells. The E. coli transformation method is as follows:

[0111] 1. Remove DH5α competent cells from -80℃ and quickly place them on ice. After 5 minutes, wait for the bacterial block to thaw, add the target DNA (plasmid or ligation product), and gently mix by tapping the bottom of the EP tube (avoid using a pipette). Let it stand on ice for 25 minutes.

[0112] 2. Heat shock in a 42℃ water bath for 45 seconds, then quickly return to ice and let stand for 2 minutes. Shaking will reduce the conversion efficiency.

[0113] 3. Add 700 µL of antibiotic-free sterile LB liquid medium to the centrifuge tube, mix well, and incubate at 37°C and 200 rpm for 60 min.

[0114] 4. Centrifuge at 5000 rpm for 1 min to collect the bacterial cells. Take about 100 µL of supernatant, gently resuspend the bacterial block by pipetting, and spread it onto solid LB medium containing the appropriate antibiotic.

[0115] 5. Invert the plate and incubate it overnight at 37°C for 16 hours.

[0116] LB medium: NaCl 10 g, tryptone 10 g, yeast extract 5 g, adjust pH to 7.0, bring volume to 1 L. For solid medium, add 15 g agar; for liquid medium, do not add agar.

[0117] 3.1.2.6 Target Fragment Detection and Sequencing

[0118] Colonies were selected using a white pipette tip and cultured in LB / Amp (100 mg / mL) liquid medium overnight at 37°C and 200 rpm. Positive clones were then detected by PCR (amplification procedure as in 3.1.2.3) and sent to Tianjin Qingke Biotechnology Co., Ltd. for sequencing analysis.

[0119] 3.1.2.7 Bacterial culture preservation and plasmid extraction

[0120] After sequencing, single clones with 100% sequence similarity were selected for activation. After activation, a portion of the bacterial culture was frozen with 50% glycerol for preservation. The remaining bacterial culture was used to extract plasmids using the EasyPure Plasmid MiniPrepKit (EM101) kit from TRANS. The extracted plasmids were stored at -20℃ for later use.

[0121] The specific method for plasmid extraction is as follows:

[0122] Plasmid extraction was performed using the TRANS EasyPure Plasmid MiniPrep Kit (EM101). The specific steps are as follows:

[0123] 1. Take the overnight cultured bacterial suspension, centrifuge at 10,000 xg for 1 min, discard the supernatant, and aspirate as much as possible. If the volume of bacterial suspension is too large, it can be collected by centrifugation in multiple stages.

[0124] 2. According to the table above, add colorless solution RB (containing RNase A), shake to suspend the bacterial precipitate, and no small bacterial clumps should remain.

[0125] 3. According to the table above, add the blue solution LB and gently invert and mix 4-6 times to fully lyse the bacteria and form a clear blue solution. The color changes from semi-transparent to clear blue, indicating complete lysis. The time should not exceed 5 minutes.

[0126] 4. According to the table above, add the yellow solution NB and gently mix 5-6 times. The color will change completely from blue to yellow, indicating that the mixture is uniform and neutralized completely, until a firm yellow aggregate is formed. Let it stand at room temperature for 2 minutes.

[0127] 5. Centrifuge at 12,000 xg for 5 min, carefully aspirate the supernatant and add it to the centrifuge column. Centrifuge at 12,000 xg for 1 min, and discard the eluent. If the supernatant volume is greater than 800 µL, it can be added to the column in multiple portions, centrifuged as above, and the eluent discarded.

[0128] 6. Add 650 µL of WB solution, centrifuge at 12,000 xg for 1 min, and discard the effluent.

[0129] 7. Centrifuge at 12,000 xg for 2 min to completely remove residual white blood cells (WB).

[0130] 8. Place the centrifuge column in a clean centrifuge tube, add 30-50 µL EB or deionized water (pH>7.0) to the center of the column, and let it stand at room temperature for 1 minute (preheating the EB or deionized water in a 60-70°C water bath will improve the results).

[0131] 9. Centrifuge at 10,000 xg for 1 min to elute the DNA. Store the eluted DNA at -20°C.

[0132] 3.1.3 Obtaining the IbPXC3 genomic DNA sequence

[0133] 3.1.3.1 Extraction of sweet potato genomic DNA

[0134] Genomic DNA was extracted from leaves of Jishuzi 203 using the CTAB method. The specific steps are as follows:

[0135] l) Grind the sweet potato leaves with liquid nitrogen and quickly add 800 μL of CTAB extract preheated to 65°C and 80 μL of CTAB / NaCl preheated to 65°C.

[0136] 2) Heat the sample in a 65℃ bath for 30 minutes, inverting it occasionally to mix it thoroughly.

[0137] 3) Add an equal volume of chloroform:isoamyl alcohol (V:V=24:l), gently invert and mix for 15 min, then centrifuge at 12000 rpm for 10 min;

[0138] 4) Take the supernatant, transfer it to another new tube, add 1 / 10 volume of CTAB / NaCl at 65℃ and mix well;

[0139] 5) Extract with an equal volume of chloroform:isoamyl alcohol (V:V=24:l), mix gently for 15 min, then centrifuge at 12000 rpm for 10 min, recover the supernatant, and repeat until no white color remains;

[0140] 6) Add 16 μL of 10 mg / mL RNase A and incubate at 37°C for 1 hour;

[0141] 7) Add an equal volume of chloroform:isoamyl alcohol (V:V=24:l), mix gently for 15 min, and then centrifuge at 12000 rpm for 10 min;

[0142] 8) Transfer the supernatant to another new centrifuge tube, add 2 volumes of frozen anhydrous ethanol, and precipitate the DNA at -20°C;

[0143] 9) Wash 2-3 times with 75% ethanol, dry until the DNA is transparent, and dissolve the DNA in 40 μL TE.

[0144] 10) Store at 4℃, or at -20℃ for long-term storage.

[0145] 3.1.3.2 Amplification of the full length of the IbPXC3 gene

[0146] Using genomic DNA from leaves of Jishuzi 203 as a template, amplification was performed using TOYOBO's KOD FX enzyme. The amplification primers, system, and procedure are described in section 3.1.2.3.

[0147] 3.1.3.3 Recovery and purification of PCR products

[0148] The PCR products were detected by agarose gel electrophoresis, and the target fragment was recovered and purified. For specific steps, please refer to 3.1.2.4.

[0149] 3.1.3.4 Target Fragment Connection and Transformation

[0150] The target fragment was ligated into the pEASY-Blunt Zero Cloning Vector from TRANS and transformed into E. coli DH5α. For specific steps, please refer to 3.1.2.5.

[0151] 3.1.3.5 Detection and sequencing of target fragments in bacterial culture by PCR

[0152] Select single clones and perform bacterial PCR and sequencing. Refer to 3.1.2.6 for specific steps.

[0153] 3.1.3.6 Bacterial culture preservation and plasmid extraction

[0154] After sequencing, select 3-5 single-clone bacterial cultures with 100% sequence similarity for bacterial culture preservation and plasmid extraction. For specific steps, refer to 3.1.2.7.

[0155] The IbPXC3 DNA is 2879 bp long, and the cDNA is 2792 bp long. Figure 5 The 2792bp sequencing sequence was input into the ORF Finder in NCBI to search for possible open reading frames in the gene sequence (http: / / www.ncbi.nlm.nih.gov / gorf / gorf.html), resulting in the full-length ORF sequence of the gene, 2736bp, encoding 911AA. The nucleotide sequence of the cDNA is shown in SEQ ID NO: 3. The nucleotide sequences of the ORF and CDS are the same, as shown in SEQ ID NO: 4.

[0156] 3.1.4 Bioinformatics Analysis of IbPXC3 Gene

[0157] 3.1.4.1 The cDNA and gDNA sequences of the gene were compared and analyzed using online software https: / / gsds.gao-lab.org / , and a schematic diagram of the gene structure was drawn. Figure 6 The results showed that the IbPXC3 gene contains one intron and two exons.

[0158] 3.1.4.2 Predictive Analysis of Amino Acid Composition and Physicochemical Properties

[0159] The primary structure of amino acids (such as isoelectric point and molecular weight) can be predicted using the ProtParam website (http: / / www.expasy.ch / tools / protparam.html).

[0160] The ProtParam program prediction results are as follows:

[0161] Molecular weight: 99080.01 Da

[0162] Theoretical pI: 6.16

[0163] Number of amino acid residues: 911

[0164] Amino acid composition: see Table 7

[0165] Negative charge residues (Asp+Glu): 69

[0166] Positively charged residues (Arg+Lys): 61

[0167] Molecular formula: C4429H7082N1176O1326S33

[0168] Total number of atoms: 14046

[0169] Extinction coefficients / M⁻¹ cm⁻¹: 71445 (70820)

[0170] Half-life (N-terminal residue M is assumed to be Met): mammalian reticulocytes (in vitro) 30 h; yeast (in vivo) >20 h; Escherichia coli (in vivo) >10 h.

[0171] The instability index is 37.28, indicating that the protein is stable.

[0172] Aliphatic index: 106.49

[0173] The average hydrophobicity (Grand average of hydropathicity coefficient; a negative value indicates that the protein is hydrophilic, and a positive value indicates that it is hydrophobic): 0.081, indicating that the protein is hydrophobic.

[0174] Table 7 Amino acid composition of the protein encoded by the IbPXC3 gene.

[0175]

[0176] 3.1.4.3 Prediction and Analysis of Transmembrane Domains of Proteins

[0177] The transmembrane region of the peptide is determined by the TMpred (http: / / www.ch.embnet.org / software / TMPRED_form.html) or TMHMM (http: / / www.cbs.dtu.dk / services / TMHMM / ) program.

[0178] The results are as follows Figure 7 As shown, typical transmembrane helical structures exist at amino acid positions 577-599 and 687-709, indicating the presence of transmembrane domains in the protein.

[0179] 3.1.4.4 Multiple comparison and phylogenetic analysis of amino acid sequences

[0180] Based on the BLASTx results, amino acid sequences with high homology to the target gene were selected, and the maximum parsimony method was used with Clustal X, BioEdit, and MAGE4 software.

[0181] Ten species with high homology in the comparison results were selected for analysis: Ipomoea nil (XP_019177675.1), Ipomoea batatas (GMD70699.1), Ipomoea triloba (XP_031113650.1), Capsicum annuum (XP_016569740.1), Solanum verrucosum (XP_049344919.1), Solanum tuberosum (KAH0777753.1), Capsicum chinense (PHU19945.1), Solanum bulbocastanum (KAK6775579.1), Solanum pennellii (XP_015056547.1), and Solanum dulcamara (XP_055833739.1). A homologous phylogenetic tree was constructed using MAGE 7.0 software as follows: Figure 8 As shown, IbPXC3 is most closely related to the wild sweet potato species Ipomoeanil, followed by the hexaploid sweet potato species Ipomoea batatas and diploid sweet potato species Ipomoea triloba, and is less closely related to the potato species Solanum tuberosum.

[0182] 3.1.5 Analysis of IbPXC3 gene expression in different tissues

[0183] Using the 40-day-old Jishu Zi 203 potato variety as material, leaves, stems, fibrous roots, and tubers were selected. RNA was extracted, and the first strand of cDNA was synthesized using the TRANS Uni All-in-One First-Strand cDNA Synthesis SuperMix for qPCR Reverse Transcription Kit (AU341). The specific method is as follows. Using the reverse-transcribed cDNA as a template for RT-qPCR, the relative expression level of the IbPXC3 gene in different tissues was determined. The results are as follows. Figure 9 As shown, the results indicate that the expression level of the IbPXC3 gene is highest in the tuber.

[0184] Table 8 Primers for IbPXC3 Real-Time Quantitative Analysis

[0185]

[0186] The specific method for synthesizing the first strand of cDNA is as follows: The first strand of cDNA was synthesized using the TRANS Uni All-in-One First-Strand cDNA Synthesis SuperMix for qPCR Reverse Transcription Kit (AU341), and the specific steps are as follows:

[0187] 1. Reverse transcription reaction system

[0188] Table 9

[0189]

[0190] 2. Mix gently and incubate at 50°C for 5 min. For RNA templates with high GC content or complex secondary structures, the reaction temperature can be appropriately increased (≤65°C).

[0191] 3. Deactivate by heating at 85℃ for 2 minutes.

[0192] 4. Store at -20℃ for later use.

[0193] qPCR system:

[0194] Table 10

[0195]

[0196] qPCR program:

[0197]

[0198] 3.1.6 Subcellular localization analysis of IbPXC3

[0199] 3.1.6.1 Construction of vectors for subcellular localization of IbPXC3

[0200] The terminator was removed from the ORF sequence of the IbPXC3 gene, and specific primers containing KpnⅠ and BamHI restriction sites were designed: IbPCK3-kpn1-F: ACGGGGGACGAGCTCGGTACCATGGGTAGACTCTATGATAT and IbPCK3-BamH1-R: CATGTCGACTCTAGAGGATCCCTTAGCCAAATCAAGCAGCA. Using the plasmid stored in 3.1.2.7 as a template, amplification was performed using the high-fidelity enzyme KOD. The amplification system and procedure are as described in 3.1.2.3. PCR products were detected by 1.0% agarose gel electrophoresis, and the target fragment was then recovered and purified as described in 3.1.2.4.

[0201] The subcellular localization pCAMBIA1301S-GFP vector (plasmid concentration 73 ng / µL) was linearized using KpnⅠ and BamHI. The enzyme digestion system is shown in the table below:

[0202] Table 11

[0203]

[0204] React at 37℃ for 2 hours.

[0205] After the enzyme digestion reaction was completed, the fragments were detected by 1.0% agarose gel electrophoresis, and the large fragments were recovered by gel extraction as in 3.1.2.4.

[0206] Using homologous recombination, the CDS sequence of the IbPXC3 gene (with the terminator removed) was ligated with a linear fragment of pCAMBIA1301S-GFP digested with KpnⅠ and BamHI restriction endonucleases using the GenStar EZ-HiFi Seamless Cloning Kit to construct the subcellular localization vector pCAMBIA1301S-IbPXC3-GFP containing the IbPXC3 gene. The homologous recombination system is shown in the table below:

[0207] Table 12

[0208]

[0209] Mix gently and react at 50°C for 60 min. After the reaction is complete, place on ice. The reaction product can be directly converted for sequencing. Extract plasmids and preserve them using the same methods and steps as 3.1.2.5 to 3.1.2.7.

[0210] 3.1.6.2 Subcellular localization of IbPXC3 in tobacco

[0211] The pCAMBIA1301S-IbPXC3-GFP plasmid was transformed into Agrobacterium GV3101 using a heat shock method, as described below. Subsequently, leaves of approximately one-month-old Nicotiana Bunsenata were used for infection, as described below. Two to three days after infection, the tobacco was observed under a laser confocal microscope: GFP field: 488 nm, DAPI field: 358 nm.

[0212] The specific conversion method is as follows:

[0213] 1. Take the competent Agrobacterium cells stored at -80℃ and leave them at room temperature or in your palm for a moment until they partially thaw. When they are in an ice-water mixture, insert them into ice.

[0214] 2. Add 0.01-1 µg of plasmid DNA to each 100 µL of accepted state (the transformation efficiency is relatively high, and it is best to conduct a preliminary experiment to determine the amount of plasmid to add before the first use), mix well by hand by tapping the bottom of the tube, and incubate on ice for 5 min, liquid nitrogen for 5 min, water bath at 37℃ for 5 min, and ice bath for 5 min in sequence.

[0215] 3. Add 700 µL of antibiotic-free LB liquid medium and incubate at 28°C with shaking for 2-3 h.

[0216] 4. Centrifuge at 6000 rpm for 1 min to collect the bacteria. Retain approximately 100 µL of supernatant, gently pipette to resuspend the bacterial block, and spread it onto LB or YEB plates containing the appropriate antibiotic. Invert the plates and incubate at 28°C for 2-3 days. (When the plate contains only 50 µg / mL kan, incubation at 28°C for 48 h is sufficient; when 50 µg / mL kan and 20 µg / mL rif are added to the plate, incubation at 28°C for 60 h is required; if the plate contains 50 µg / mL rif, incubation at 28°C for 72-90 h is required).

[0217] The specific methods of infection are as follows:

[0218] 1. Pick a single clone and place it in 3 ml of liquid LB (corresponding antibiotic), incubate at 28°C and 200 rpm for about 2 days.

[0219] 2. Collect bacterial culture, centrifuge, resuspend, and inject into tobacco.

[0220] (1) Take 2 mL of bacterial culture, 4000 rpm × 5 min, remove the supernatant, add 1 mL of resuspension (MgCl2·6H2O, 2.033 g / L; MES, 2.132 g / L), and vortex;

[0221] (2) Measure OD600. Adjust the OD600 of the bacterial suspension to 0.4 (0.1-0.8 as needed, but do not exceed 1) with resuspension, and let it stand at room temperature for 1 to 3 hours;

[0222] (3) Mark the leaves with numbers, use a 1ml syringe to inject the bacterial solution into the tobacco leaves from the back of the leaves using pressure, then spray the leaves with water, put them in a plastic bag, and leave them in the dark overnight.

[0223] (4) Open the plastic bag on the second day. The expression level is highest 3 days after injection.

[0224] (5) Observation under a laser confocal microscope.

[0225] The results are as follows Figure 10 As shown, the IbPXC3 fusion protein is expressed in the nucleus, cytoplasm, and cell membrane, without specific localization.

[0226] 3.1.7. Expression analysis of IbPXC3 gene in sweet potato rhizomes at different time points after root rot induction.

[0227] Jishuzi 203 and Jishuzi 563 were planted in a root rot disease nursery. Rhizomes were collected at 0h, 36h, 72h, 120h, and 240h, with three plants collected from each site at each time point. RNA was extracted from each plant, and the first strand of cDNA was synthesized using the TRANS Uni All-in-One First-Strand cDNA Synthesis SuperMix for qPCR Reverse Transcription Kit (AU341), following the same method as in 3.1.6. The reverse-transcribed cDNA was used as a template for qPCR to analyze the expression level of the IbPXC3 gene at different time points after root rot induction in different materials. The qPCR system and procedure were the same as in 3.1.6.

[0228] The results are as follows Figure 11 As shown, the expression level of the IbPXC3 gene in the root rot resistant variety Jishuzi 203 was higher than that in the root rot susceptible variety Jishuzi 563. Among them, the expression of IbPXC3 in Jishuzi 203 showed a trend of first increasing and then decreasing, and the expression level reached a peak (19.42 times) at 72h.

[0229] 3.1.8 Obtaining transgenic sweet potato plants overexpressing the IbPXC3 gene

[0230] 3.1.8.1 Construction of pCAMBIA1301S-IbPXC3 overexpression vector

[0231] Specific primers containing XbaⅠ and KpnⅠ restriction sites, IbPCK3-Xba1-F: GAGAACAACGGGGACTCTAGAATGGGTAGACTCTATGATATGATTCACA and IbPCK3-Kpn1-R: CGATTTCGAACCCGGGGTACCTTACTTAGCCAAATCAAGCAGCA, were designed at both ends of the CDS sequence of the IbPXC3 gene. Amplification was performed using the plasmid stored in 3.1.2.7 as a template, and the amplification system is shown in the table below:

[0232] Table 13

[0233]

[0234] Amplification procedure:

[0235]

[0236] The PCR products were detected by 1.0% agarose gel electrophoresis, and the target fragment was then recovered and purified as in 3.1.2.4.

[0237] The plasmid of the overexpression vector pCAMBIA1301S was extracted as described in 3.1.2.7, with a plasmid concentration exceeding 200 ng / µL. The pCAMBIA1301S plasmid was linearized using XbaI and KpnI, and the enzyme digestion system is shown in the table below:

[0238] Table 14

[0239]

[0240] React at 37℃ for 2 hours.

[0241] After the enzyme digestion reaction, the vector was purified by linearization using the VAHTS DNA Clean Beads kit from Vazyme. The specific steps are as follows:

[0242] 1. Remove the magnetic bead solution from 2-8℃ 30 minutes in advance and let it stand to allow its temperature to equalize to room temperature.

[0243] 2. Invert or vortex to thoroughly mix the magnetic bead solution. Add half the volume of magnetic bead solution to the DNA sample and gently pipette 10 times to mix thoroughly.

[0244] 3. Incubate at room temperature for 10 minutes to allow DNA to bind to the magnetic beads.

[0245] 4. Place the sample on the magnetic rack and wait for the solution to clarify (about 5 minutes), then carefully remove the supernatant.

[0246] 5. Keep the sample on the magnetic rack at all times, add 200 µL of freshly prepared 80% ethanol to rinse the magnetic beads, incubate at room temperature for 30 s, and carefully remove the supernatant.

[0247] 6. Repeat step 5 once, for a total of two rinses.

[0248] 7. Keep the sample on the magnetic rack at all times, and open the lid to dry the magnetic beads for about 5-10 minutes at room temperature.

[0249] 8. Remove the sample from the magnetic rack, add an appropriate amount of nuclease-free water, vortex or pipette to mix thoroughly, and let stand at room temperature for 2 minutes. After the solution has clarified, let it stand on the magnetic rack for 5 minutes, then carefully aspirate the supernatant into a new nuclease-free centrifuge tube.

[0250] The pCAMBIA1301S vector, purified using the GenStar EZ-HiFi Seamless Cloning Kit, was ligated with the CDS sequence of the IbPXC3 gene containing XbaⅠ and KpnⅠ restriction sites. The specific steps are described in 3.1.7.1. 3.1.8.2 Agrobacterium preparation

[0251] First, the pCAMBIA1301S plasmid was transformed into Agrobacterium rhizogenes K599 competent cells using the freeze-thaw method, resulting in Agrobacterium rhizogenes K599 / pCAMBIA1301S. The specific process is as follows:

[0252] (1) Thaw competent Agrobacterium rhizogenes K599 in ice;

[0253] (2) Add 2 μg pCAMBIA1301S plasmid to the competent Agrobacterium rhizogenes K599 after thawing in step (1), mix gently, and let stand on ice for 5 min.

[0254] (3) Place the competent Agrobacterium rhizogenes K599 after the static setting in step (2) into liquid nitrogen and freeze for 5 min;

[0255] (4) Place the competent Agrobacterium rhizogenes K599 after the quick-freezing in step (3) at 37℃ and let it stand for 5 min;

[0256] (5) Place the competent Agrobacterium rhizogenes K599 after step (4) in ice and let it stand for 5 min again;

[0257] (6) Add 600 μL of LB liquid medium to the competent Agrobacterium rhizogenes K599 after the static setting in step (5), and shake in a shaker at 28°C for 2-3 h;

[0258] (7) Collect the bacterial cells by centrifugation at 6000 rpm for 1 min, retain approximately 100 μL of supernatant, gently resuspend the bacterial blocks by pipetting, and spread them onto the selection medium. The selection medium is LB solid medium containing streptomycin (50 μg / mL) and kanamycin (50 μg / mL).

[0259] (8) After being incubated upside down in the dark at 28℃ for 2-3 days, the resulting Agrobacterium rhizogenes monoclonal strain was named K599 / pCAMBIA1301S.

[0260] 3.1.8.3 Agrobacterium infection of plants

[0261] (1) Pick a single colony of Agrobacterium rhizogenes K599 / pCAMBIA1301S into LB liquid medium containing streptomycin (50 μg / mL) and kanamycin (50 μg / mL), shake the culture on a shaker at 28℃, and the OD value is between 0.8 and 1.0 to obtain Agrobacterium rhizogenes K599 / pCAMBIA1301S bacterial culture.

[0262] (2) Select sweet potato stem segments that are in good condition, fresh and healthy, containing the stem tip and 5-7 lateral branches below it. Use a blade to remove the lateral branches below the stem segment to form a wound, leaving only the top 1-2 lateral branches and leaves. Do not make the wound too large during the operation; just remove the lateral branches.

[0263] (3) Use a 1 mL syringe needle (0.33 mm in diameter) to make holes around the entire stem node after the lateral branches are removed in step (2) and within 1 cm above and below the node to create wounds. Make 6-8 holes at each stem node. Too many wounds are not conducive to the subsequent development of lateral roots from the root primordia.

[0264] (4) Place the treated sweet potato stem segments in the K599 / pCAMBIA1301S obtained in step (1), ensuring that the wounds are completely immersed in the bacterial solution, and culture for more than 8 hours, then overnight.

[0265] (5) Plant the overnight sweet potato stem segments on the prepared ridges, burying only the part of the stem segment that has been soaked in the bacterial solution in the soil until tubers are formed. The infected stem segments grow in the field and the genetically modified tubers can be harvested after 80 days.

[0266] 3.1.8.4 Screening of positive plants

[0267] Transgenic potato tubers were used to cultivate seedlings. DNA was extracted from each seedling and amplified by PCR using the hygromycin gene primers Hpt-F: GACCTATTGCATCTCCCGCC and Hpt-R: GAATCCCCGAACATCGCCTC on the pCAMBIA1301S plasmid, and specific primers IbPCK3-OF: AGAAATTCTTGACAGCCGAGTG and JD-13sFlag-R: GATAATCATCGCAAGACCGG containing partial sequences and vector fragments. Positive plants were then screened.

[0268] The amplification system (Table 15) and amplification procedure are as follows:

[0269] Table 15

[0270]

[0271] Amplification procedure:

[0272] Amplification procedure:

[0273]

[0274] PCR products were detected by 1.0% agarose gel electrophoresis.

[0275] The measurement results are as follows Figure 12As shown in the figure; 1-9 are the detection results of Hpt-F and Hpt-R primers, and 10-18 are the detection results of IbPCK3-OF and JD-13sFlag-R, indicating that four IbPXC3 gene overexpression plants were obtained.

[0276] 3.1.9 Obtaining transgenic sweet potato plants with interference expression of the IbPXC3 gene

[0277] 3.1.9.1 Construction of IbPXC3 interference expression vector

[0278] The FS-intron-RS-pFGC5941 vector was constructed using a double enzyme digestion and ligation method. FS and RS are complementary sequences, forming a neck loop structure that can block gene expression, thereby achieving the purpose of interfering with gene expression. The specific process is as follows:

[0279] (1) Amplify the target gene FS sequence. Design a forward primer sequence carrying the BamHI restriction site IbPCK3-Ri-1F:TTACAATTACAATTAGGATCCATGGGTAGACTCTATGATATGATTCACAACAA and a reverse primer sequence IbPCK3-Ri-1R:AAATTCTTACACTAAAATTCAACACTTTCAACCCACTCAT to amplify the IbPXC3 gene FS sequence. The amplification system (Table 16) and amplification program are as follows:

[0280] Table 16

[0281]

[0282] Amplification procedure:

[0283]

[0284] PCR products were detected by 1.0% agarose gel electrophoresis. The FS sequence was recovered, ligated, transformed, and sequenced using the same methods as 3.1.2.4 to 3.1.2.7.

[0285] (2) Amplify the target gene RS sequence, design and link the forward primer sequence IbPCK3-Ri-3F: CAATTTGCAGACTAAAATTCAACACTTTCAACCCACTCAT and the reverse primer sequence IbPCK3-Ri-3R: AGATCTGGTCGACGGCGCTGGTACCATGGGTAGACTCTATGATATGATTCACAACAA carrying the KpnI restriction site to amplify the partial RS sequence of the IbPXC3 gene. The amplification system, amplification conditions, RS sequence recovery, ligation, transformation and sequencing are the same as in (1).

[0286] (3) Amplify the intron sequence linked to FS and RS. Using Ri-PRI (E. coli) as a template, design primers IbPCK3-Ri-2F: GAATTTTAGTGTAAGAATTTCTTATGTTACATTATTACATTCAACGTTTTATCTTAAT and IbPCK3-Ri-2R: GAAATTTTAGTCTGCAAATTGACCAAAAAAGATGTGAAGAAAAC. The amplification system, amplification conditions, intron sequence recovery, ligation, transformation and sequencing are the same as in (1).

[0287] (4) Linearization of pFGC5941 vector:

[0288] The pFGC5941 plasmid was extracted as described in section 3.1.2.7, reaching a concentration of over 200 ng / µL. The pFGC5941 plasmid was linearized using BamHI and KpnI, as shown in the table below:

[0289] Table 17

[0290]

[0291] React at 37℃ for 2 hours.

[0292] After the enzyme digestion reaction, the linearized vector was purified using the VAHTS DNA Clean Beads kit from Vazyme, as described in 3.1.8.1. The linearized pFGC5941, FS, RS, and intron were ligated using the 2×Multif Seamless Assembly mix from ABclonal, as shown in the table below:

[0293] Table 18

[0294]

[0295] Mix gently and react at 50°C for 60 minutes.

[0296] 3.1.9.2 Preparation of Agrobacterium

[0297] The FS-intron-RS-pFGC5941 vector plasmid was transformed into Agrobacterium rhizogenes K599 using the freeze-thaw method, resulting in Agrobacterium rhizogenes K599 / FS-intron-RS-pFGC5941. For details, please refer to 3.1.8.2.

[0298] Colony PCR detection primers:

[0299] pCRD-infu-F:AGGACACGCTCGAGTATAAGAGC

[0300] pFGC5941-M1R:GTCCTCCCTCTCTTCTACC

[0301] pFGC5941-M2F:TTACTTACACTTGCCTTGGAG

[0302] pCRD-infu-R:GGACTCTAGGGACTAGTCCCG

[0303] The amplification system and procedure are the same as in 3.1.9.1.

[0304] 3.1.9.3 Agrobacterium infection of plants

[0305] The specific process is the same as in 3.1.8.3.

[0306] 3.1.9.4 Screening of positive plants

[0307] The specific process is the same as in 3.1.9.2.

[0308] Figure 13 The top row shows the detection results for pCRD-infu-F and pFGC5941-M1R primers. Figure 13 The bottom row shows the detection results of pFGC5941-M2F and pCRD-infu-R, indicating that 10 plants with interference expression of the IbPXC3 gene were obtained.

[0309] Example 4: Verification of IbPXC3 gene function

[0310] Positive sweet potato plants expressing or interfering with the IbPXC3 gene, as well as wild-type plants, were propagated in large numbers in a greenhouse. Transgenic plants were then planted in a naturally induced disease identification nursery in early June, with rows 90 cm wide and plant spacing 25 cm. Root rot incidence was investigated at 40 and 80 days. The specific investigation steps are as follows:

[0311] Disease incidence was assessed on the aboveground parts 40 days after planting, and the plants were graded according to the grading standards, with the aboveground disease index calculated. In late October, disease incidence on the underground parts was assessed again according to the grading standards, and the underground disease index was calculated. Variety resistance was determined based on the average of the aboveground and underground disease indices.

[0312] Above-ground grading standards:

[0313] Level 0: No symptoms visible;

[0314] Grade 1: Leaves are slightly yellow, otherwise normal;

[0315] Grade 2: Few and short branches, leaves are noticeably yellow, some varieties are budding or flowering;

[0316] Grade 3: Plant growth is stunted, significantly dwarfed, does not branch, and old leaves fall off from the bottom up;

[0317] Level 4: The entire plant is dead.

[0318] The disease severity of potato tubers is determined according to the following criteria:

[0319] Level 0: Normal potato tubers with no symptoms

[0320] Grade 1: Individual roots turn black (less than 10% of the total number of diseased roots), underground stems have no disease spots, and there is no significant impact on tuber formation.

[0321] Level 2: A small number of roots turn black (10-25% of the total number of roots are diseased), and there are individual lesions on the underground stems and tubers, which have a slight impact on tuber formation.

[0322] Level 3: Nearly half of the roots turn black (the number of diseased roots accounts for 25.1-50.0% of the total number of roots), there are many lesions on the underground stems and tubers, which has a significant impact on tuber formation, and there are twig roots.

[0323] Level 4: Most roots turn black (more than 50% of the total number of diseased roots), the underground stem has many large lesions, does not produce tubers, and may even die.

[0324] The disease index is calculated using the following formula.

[0325]

[0326] The disease index is expressed as a percentage, down to 0.1%.

[0327] The resistance of sweet potato germplasm to root rot was determined based on the disease index.

[0328] High resistance (disease index ≤ 20)

[0329] Disease resistance (20 < disease index ≤ 40)

[0330] Anti-inflammatory response (40 < disease index ≤ 60)

[0331] Illness (60 < Severity Index ≤ 80)

[0332] High susceptibility (80 < Severity index)

[0333] The results are shown in Table 19 and Figure 14The disease index of wild-type sweet potato plants was 53.8, indicating moderate resistance to root rot; the disease index of positive sweet potato plants overexpressing the IbPXC3 gene was 31.3, indicating resistance to root rot, and the resistance of positive sweet potato plants overexpressing the IbPXC3 gene was significantly higher than that of wild-type sweet potato plants; the disease index of positive sweet potato plants interfering with the IbPXC3 gene was 85.0, indicating susceptibility to root rot, and the resistance of positive sweet potato plants interfering with the IbPXC3 gene was significantly lower than that of wild-type sweet potato plants.

[0334] The results showed that IbPXC3 has the function of improving resistance to sweet potato root rot.

[0335] Table 19 Root rot resistance survey

[0336]

[0337] The above are merely preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A sweet potato root rot resistance gene IbPXC3, characterized in that, The nucleotide sequence of the sweet potato root rot resistance gene IbPXC3 is shown in SEQ ID NO:

4.

2. The protein encoded by the sweet potato root rot resistance gene IbPXC3 according to claim 1, characterized in that, The amino acid sequence of the protein is shown in SEQ ID NO:

2.

3. An overexpression vector pCAMBIA1301S-IbPXC3 comprising the gene IbPXC3 of claim 1.

4. The overexpression vector pCAMBIA1301S-IbPXC3 for gene IbPXC3 according to claim 3, characterized in that, The overexpression vector pCAMBIA1301S-IbPXC3 of the gene IbPXC3 was constructed from the gene IbPXC3 described in claim 1.

5. The overexpression vector pCAMBIA1301S-IbPXC3 for gene IbPXC3 according to claim 4, characterized in that, The following are the construction steps: S1. The target gene, as shown in SEQ ID NO.4, is amplified by PCR using an ORF containing XbaⅠ and KpnⅠ restriction sites at both ends; S2. Linearization of pCAMBIA1301SS plasmid was performed using XbaI and KpnI; S3. The target gene containing XbaⅠ and KpnⅠ restriction sites was ligated to the linearized pCAMBIA1301S plasmid to obtain the recombinant product. The product was then transformed and sequenced in E. coli competent cells to obtain the overexpression vector pCAMBIA1301S-IbPXC3 of the gene IbPXC3.

6. The overexpression vector pCAMBIA1301S-IbPXC3 for gene IbPXC3 according to claim 5, characterized in that, The competent Escherichia coli cells in S3 are DH5α.

7. The application of the gene IbPXC3 of claim 1, the protein of claim 2, and the overexpression vector pCAMBIA1301S-IbPXC3 of the gene IbPXC3 of claims 3-6 in the resistance of sweet potato to root rot.

8. The application of the gene IbPXC3 of claim 1, the protein of claim 2, and the overexpression vector pCAMBIA1301S-IbPXC3 of the gene IbPXC3 of claims 3-6 in the cultivation of root rot-resistant sweet potatoes or the preparation of root rot-resistant sweet potato products.

9. A method for cultivating sweet potatoes resistant to root rot, characterized in that, The method includes the step of introducing the sweet potato root rot resistance gene IbPXC3 as described in claim 1 into a recipient sweet potato to obtain root rot resistant sweet potato.

Images