Rice leaf color regulation gene YL5, protein coded by rice leaf color regulation gene YL5 and application of rice leaf color regulation gene YL5

Abstract

The invention discloses a rice leaf color regulation gene YL5, a protein coded by the rice leaf color regulation gene YL5 and application of the rice leaf color regulation gene YL5. The nucleotide sequence of the rice leaf color regulation gene YL5 is any one of the following sequences: (a) a nucleotide sequence shown in SEQ ID NO.1; and (b) a nucleotide sequence which is generated by inserting, deleting or replacing one or more basic groups in the nucleotide sequence as shown in SEQ ID NO.1 and leads to early termination of the functional protein for coding and controlling the rice leaf color. The gene YL5 disclosed by the invention has a biological function in the aspect of regulating and controlling the rice leaf color, can be used as a color marker for producing hybrid rice seeds, has an important breeding application value in improving the purity of the seeds, and provides a new thought for researching a rice leaf color regulation and control mechanism.

Description

Technical Field

[0001] The present invention belongs to the technical field of rice breeding, and specifically relates to a rice leaf color regulating gene YL5 and its encoded proteins and applications. Background Art

[0002] Leaves are the main site for photosynthesis in plants, and their photosynthetic efficiency is closely related to yield. As one of the most important food crops in the world, the growth cycle of rice is directly related to the photosynthesis process of leaves, and affects the yield and quality of rice. Leaf color mutants are very important for studying plant photosynthesis, chlorophyll metabolism mechanism, and chloroplast development regulation mechanism. Therefore, discovering and cloning new genes regulating rice leaf color and studying their formation mechanism are beneficial to the cultivation of rice photosynthetic system and high-light-efficiency varieties. Leaf color can be used as a morphological marker, which can be used in the screening of breeding materials and hybrid rice seed production to improve the purity of hybrid rice seeds. It can also be used in the production of landscape rice and rice field patterns.

[0003] Studies have shown that the genetic mechanism of leaf color variation mainly includes nuclear genetic variation, cytoplasmic genetic variation and nuclear-cytoplasmic interaction mutation, involving multiple metabolic pathways and signal pathways, mainly chlorophyll metabolic pathway, heme metabolic pathway, chloroplast development regulation pathway, nuclear-cytoplasmic transport pathway, carotenoid metabolic pathway and purine nucleotide synthesis pathway. At present, some rice leaf color related genes have been located and cloned. OsCHLH It is the first gene cloned in rice, encoding the H subunit of magnesium chelatase, a key enzyme in the chlorophyll synthesis process. Mutation of this gene causes plant albinism (Jung et al., Plant and Cell Physiology , 2003, 44(5): 463-472); YGL1 Encoding chlorophyll synthase, mutations in this gene cause chloroplast dysgenesis and delayed thylakoid membrane formation, resulting in abnormal yellow-green leaf color (Wu et al., Plant Physiology , 2007, 145(1): 29-40); LYL1 Encodes geranyl reductase, which is involved in the final step of chlorophyll synthesis in rice. Its mutant phenotype is yellow leaves (Zhou et al., PLoS ONE , 2013, 8(9): e75299); YGL8 The gene encodes a catalytic subunit of the monoester cyclase of magnesium protoporphyrin IX, an intermediate in the synthesis of tetrastyrol. ygl8 Appearing as yellow-green leaves (Kong et al., Plant Molecular Biology, 2016, 92(1): 177-191 ); YGL18 Encodes magnesium protoporphyrin IX methyltransferase, which catalyzes magnesium protoporphyrin IX to form magnesium protoporphyrin IX monomethyl ester in the chlorophyll biosynthesis pathway. ygl18The chlorophyll level of the leaves decreased and the leaves became yellow-green (Wang et al. Frontiers in Plant Science , 2017, 8: 1694); and GRY79GRY79 Encodes a metallo-β-lactamase-triple helical chimera involved in chloroplast development in early rice seedling stages (Wan et al. Plant Cell Reports , 2015, 34(8): 1353-1363) etc.

[0004] Although a large number of rice leaf color regulatory genes have been cloned, the genetic mechanism and protein level regulation of these leaf color traits is an extremely complex process. Therefore, it is necessary to explore new rice leaf color regulatory genes, which is of great significance for studying the molecular mechanisms of chlorophyll metabolism, photosynthesis, photomorphogenesis, etc. At the same time, they can be used as excellent germplasm resources and screening markers to carry out the application of molecular design in hybrid rice breeding.

[0005] It should be noted that the information disclosed in the above background technology section is only used to enhance the understanding of the background of the present disclosure, and therefore may include information that does not constitute the prior art known to ordinary technicians in the field. Summary of the invention

[0006] The purpose of the present invention is to provide a rice leaf color regulating gene YL5 and the protein it encodes and its applications. This gene has a biological function in regulating rice leaf color, can be used as a color marker in hybrid rice seed production, and has important breeding application value in improving seed purity.

[0007] In order to achieve the above object, the present invention provides a rice leaf color regulating gene YL5 , the gene YL5 The nucleotide sequence is any of the following: (a) the nucleotide sequence shown in SEQ ID NO.1; (b) A nucleotide sequence generated by inserting, deleting or replacing one or more bases in the nucleotide sequence shown in SEQ ID NO.1, which results in premature termination of the nucleotide sequence encoding the functional protein controlling rice leaf color.

[0008] The second object of the present invention is to provide a rice leaf color-related protein YL5, the amino acid sequence of which is any one of the following: (1) the amino acid sequence shown in SEQ ID NO.2; (2) An amino acid sequence derived from the amino acid sequence shown in SEQ ID NO. 2 by inserting, deleting, or replacing one or more amino acid residues and having the function of controlling rice leaf color.

[0009] The third object of the present invention is to provide a recombinant expression vector comprising the gene YL5.

[0010] The fourth object of the present invention is to provide a host comprising the recombinant expression vector.

[0011] The fifth object of the present invention is to provide the gene YL5 Or the use of the protein YL5, the recombinant expression vector or the host in regulating rice leaf color.

[0012] Preferably, the gene YL5 Or the protein YL5 is used to control the rice leaves to turn yellow-green after heading.

[0013] Preferably, the invention is used in the molecular breeding of rice leaf color traits.

[0014] The sixth object of the present invention is to provide the gene YL5 Or the application of the protein YL5, the recombinant expression vector or the host in the identification of hybrid purity of hybrid rice offspring and / or the identification of purity of sterile line self-pollinated seeds.

[0015] Rice leaf color regulating gene of the present invention YL5 The encoded protein and application thereof have the following advantages: The inventors of the present invention obtained a mutant whose leaves showed yellow-green leaf phenotype after heading through screening, performed gene positioning analysis using the MutMap method based on whole-genome resequencing, obtained candidate genes, and constructed a genetic complementation expression vector to transform the yellow-green leaf mutation, obtaining positive transgenic plants whose leaf color recovered to the wild-type phenotype after heading, and verified the genetic complementation function, clarifying the biological function of the gene in regulating rice leaf color.

[0016] Genes of the present invention YL5 It can regulate the yellow-green leaves of rice, provide new ideas for analyzing the regulatory network of yellow-green leaves of rice, and provide new gene resources for molecular breeding. Moreover, leaf color can be used as a marker to improve the leaf color of hybrid rice sterile lines and improve the purity of hybrid rice seeds. It has important molecular breeding application value and provides new ideas for studying the regulatory mechanism of rice leaf color variation. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Wild type and mutant yl5 Plant phenotype and pigment content; A is the phenotype of mature plants; B is the phenotype of mature flag leaves; C is the pigment content of mature flag leaves.

[0018] Figure 2 For the present invention YL5Gene positioning results; A is the gene positioning result of the Mutmap method; B is YL5 Gene structure; C is yl5 Sequencing peak diagram of gene mutation site.

[0019] Figure 3 This is a diagram for constructing the genetic complementation vector of the present invention.

[0020] Figure 4 The present invention pCAMBIA1300- YL5 Conversion yl5 Hygromycin electrophoresis of mutant complementation transgenic lines; lanes 1 to 16 represent different transgenic lines of the T0 generation.

[0021] Figure 5 The mutant of the present invention yl5 Complementation of positive transgenic plant phenotype; WT is wild type, yl 5 is a mutant, yl 5-C is a complementary positive transgenic material; A is the phenotype of mature plants; B is the phenotype of mature flag leaves; C is the pigment content of mature flag leaves. DETAILED DESCRIPTION

[0022] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0023] It should be noted that if the specific conditions are not specified in the examples, the experiments were carried out according to conventional conditions or the conditions recommended by the manufacturer. If the manufacturers of the reagents or instruments are not specified, they are all conventional products that can be purchased from the market.

[0024] In the present invention, all features defined in the form of numerical ranges or percentage ranges, such as values, quantities, contents and concentrations, are only for brevity and convenience. Accordingly, the description of numerical ranges or percentage ranges should be deemed to have included and specifically disclosed all possible secondary ranges and individual values ​​within the range (including integers and fractions).

[0025] The features mentioned in the present invention can be combined arbitrarily, as long as there is no contradiction in the combination of these features, all possible combinations should be considered as the scope of this specification. Each feature disclosed in the specification can be replaced by any alternative feature that can provide the same, equal or similar purpose. Therefore, unless otherwise specified, the disclosed features are only general examples of equal or similar features.

[0026] Experimental Example 1 Phenotypic Identification of Yellow Leaf Rice Mutants 1. Mutants yl5 Phenotypic characteristics From Guizhou local resource japonica rice "Qiaogang Pearl" 60 A yellow-green leaf mutant was screened from the Co-γ radiation mutagenesis mutant library. The wild-type plants showed green leaves during normal growth and development. Compared with the wild-type, the mutant yl5 The leaf color is normal before heading, and gradually turns yellow-green after heading ( Figure 1 ).

[0027] 2. Determination of photosynthetic pigment content Changes in leaf color are usually associated with changes in the content of photosynthetic pigments in the leaves. yl5 The leaves turned yellow-green after heading, so the wild type and mutant yl5 The contents of chlorophyll a, b and carotenoids in leaves were determined.

[0028] See also Figure 1 The results showed that the contents of chlorophyll a, chlorophyll b, total chlorophyll and carotenoids in the mutant were significantly lower than those in the wild type at maturity (P<0.01), indicating that the mutant yl5 The yellow-green phenotype that appears after heading is caused by a decrease in the content of photosynthetic pigments in its leaves.

[0029] Experimental Example 2 YL5 Gene mapping and candidate gene analysis To locate the gene controlling the yellow-green leaf phenotype, the mutant yl5 The hybrid was hybridized with the wild-type "Qiaogang Pearl" (Wild-type, WT), and the hybrid seeds were planted to obtain F1 plants. The seeds harvested from the F1 plants were planted into the F2 population. After heading, the segregation ratio of normal leaf color and yellow-green leaf plants in the F2 segregation population was counted for genetic analysis. The chi-square test results showed that the segregation ratio of normal leaf color and yellow leaf color plants was 3:1, indicating that the yellow-green leaf phenotype gene is controlled by a recessive gene.

[0030] In order to locate the yellow-green leaf gene, 30 leaves of mutant yellow-green leaf phenotype and normal leaf color plants were selected from the F2 population and mixed in equal amounts to extract DNA. The DNA of wild-type samples was also extracted and whole genome resequencing was performed for each plant. The gene controlling leaf color was located using the Mutmap method.

[0031] The results are as follows Figure 2 As shown in Figure 2, the SNP-Index only shows a significant peak at the 18-19 Mb position of chromosome 5. Within the positioning interval, there is a candidate gene with a SNP-index that is completely linked to the leaf color phenotype. LOC_Os05g32390 ( Figure 2 A). Sanger sequencing analysis showed that the mutantyl5 exist LOC_Os05g32390 A T base was replaced by an A in exon 11 of the gene. Figure 2 B and C), causing the codon encoding leucine to become a stop codon, resulting in premature termination of coding.

[0032] Therefore, LOC_Os05g32390 Candidate gene YL5 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2. By analyzing the amino acid sequence of the encoded protein, the protein encoded by the gene is a transmembrane GTPase FZO-like protein.

[0033] SEQ ID NO. 1 is as follows: SEQ ID NO. 2 is as follows: MFAASTSSTGLPLPRAGGLLLLPTSRSLLLPRHRHRLRLRDVGAAAAAGGGVSGGGGGAASSREPPRTLFPGGFKRPEIRVPALVLRVGADEALASGDAVVAAVARGVGIVVLEAGEEGGGRVYEAALSLKASVGDRAYLLVAERVDVASAVGASGVVLADDGIPAIVARSMMMKSNSDSIYLPLVARTIRSADTARSATSSEGADFLIIDTGSDDAINVMNGVSGTQHVKIPIFSTLSDSQSEGSYSDNTSRLLQSGASGIVMSLAGIQVLADDIIERDFSKVDTAESVLQANYSSASTLEEADNVMVLTREKAKVAGFTKLDEKVMQLISIEKPILSEAVAVIRKAAPMMEEVELLVDAASRLSEPFLLVTVGEFNSGKSTFINALLGRKYLQEGVVPTTNEIMLLSYSDVDSESAERCERHPDGQYMCYLSAPVLKEMNLVDTPGTNVILQRQQRLTEEYVPRADLILFVLSSDRPLTDSEVGFLQYVQQWKKKVVFVLNKLDLYRNSNELEEATAFIKENARKLLNTEDVTLFPVSSRSALEAKLLYSKNDGREHHGEALFNDPRWRNSKFYDLEHYLLSFLDGSTENGKERVRLKLETPIGIADRLLTSCQRLVKLEYEKAIDDLTSIKDLVSGANNYAVKIEADSDSWQRQISSLIARAKGRAISLMESTLQLSNIDLIFTYTLSGGKSTPTKVTSFFQNDILSPSLDDAANLLSEYSTWLSSTNVREANIYVDCFHERWGALVAQEQRIPPEKNELVNEEEKLCVKALDGFSASAAAKVFEEEIREVAWGTFGGLGVAGLSASLLTSVLTSTLEDLLALALCSAGGFFAISNFPTRRKLAVEKIGKAAEKLSSKVDEAIQQDISRSANQLVHFVETVSKPYQDACQQKIDWLQGVQGELSTVERKLQTLKVEIQNLHES。

[0034] Experimental Example 3: Verification of genetic complementation of mutants 1. YL5 Construction of gene complementation vector According to the MSU7.0 annotation genome (Rice Genome Annotation Project) YL5 Gene( LOC_Os05g32390 ) full-length genomic and cDNA sequences to design two pairs of primers ( YL5 -Pro-F / YL5 -Pro-R and YL5 -F / YL5 -R), as follows: Upstream primer YL5 -Pro-F (SEQ ID NO. 3): 5'-tatgaccatgattacgaattcGCTCTTGTCCTTAGTGGCTTTTTT-3' (contains Eco RI restriction site); Downstream primer YL5 -Pro-R (SEQ ID NO. 4): 5'-aacatGGGGAGCGACAGGGATGG-3'; Upstream primer YL5 -F (SEQ ID NO. 5): 5'-tccctgtcgctccccATGTTCCGCCGCTTCCACC-3'; Downstream primer YL5 -R (SEQ ID NO. 6): 5'-agtgtcgactctagaggatccTGATTCATGAAGATTTTGAATTTCAA-3' (contains Bam HI restriction site).

[0035] The gene was amplified from wild-type genomic DNA by PCR using the high-fidelity enzyme Phanta Max Master Mix (Vazyme). YL5 The 2 kb promoter of the gene was purified by electrophoresis to obtain YL5 -Pro fragment; amplified from wild-type cDNA using RT-PCR YL5 Gene CDS, and electrophoresis purification to obtain YL5 -cds fragment; use Eco RI and Bam The pCambia1300-eGFP vector was double-digested with two endonucleases of HⅠ, purified by electrophoresis, and recovered by gel. YL5 -Pro and YL5 -cds purified fragment and pCambia1300-eGFP ( Eco RI / Bam The gel products after double digestion with HI were mixed in proportion and homologous recombination was carried out using ClonExpress MultiS One Step Cloning Kit (Vazyme). Single clones were selected for PCR detection and sequencing verification, and the transformation vector pCAMBIA1300- YL5 (Figure 3).

[0036] Agrobacterium EHA105 was transformed by Agrobacterium-mediated transformation, and callus induced by mature seed embryos of yellow-green leaf mutants was transformed. The specific transformation method is referenced to (Hiei et al. Plant J. 1994 Aug;6(2):271-82). Hygromycin was used for resistance screening to obtain positive transgenic seedlings.

[0037] 2. Identification and phenotypic analysis of genetically complemented plants After obtaining positive transgenic plants, leaves were taken from individual plants, and T0 rice DNA was extracted using the CTAB method. The transgenic plants were amplified by PCR using hygromycin Hpt-specific primers (Hpt-F / Hpt-R) to further confirm the positive plants.

[0038] Hpt-F (SEQ ID NO. 7): GAAGTGCTTGACATTGGGGAGT; Hpt-R (SEQ ID NO. 8): AGATGTTGGCGACCTCGTATT.

[0039] Electrophoresis results can be found in Figure 4 , using hygromycin Hpt specific primers (PCR product size 472bp), a total of 13 independent positive transgenic complementary lines were obtained. The leaf phenotype of the positive plants during the entire growth process was similar to that of the wild type, and the leaf color and pigment content of the mature plants returned to the wild type level (see Figure 5 ).

[0040] Therefore, the above experiments determined that the mutant yl5 The yellow-green leaf phenotype is caused by LOC_Os05g32390 Functional mutations, YL5 Gene has biological function in regulating rice leaf color 。

[0041] Although the content of the present invention has been described in detail through the above preferred embodiments, it should be appreciated that the above description should not be considered as a limitation of the present invention. After reading the above content, it will be apparent to those skilled in the art that various modifications and substitutions of the present invention will occur. Therefore, the protection scope of the present invention should be limited by the appended claims.

Claims

1. A rice leaf color regulating gene YL5 , characterized in that, The gene YL5 The nucleotide sequence is any of the following: (a) the nucleotide sequence shown in SEQ ID NO.1; (b) A nucleotide sequence generated by inserting, deleting or replacing one or more bases in the nucleotide sequence shown in SEQ ID NO.1, which results in premature termination of the nucleotide sequence encoding the functional protein controlling rice leaf color.

2. A rice leaf color-related protein YL5, characterized in that: The amino acid sequence of the protein YL5 is any of the following: (1) the amino acid sequence shown in SEQ ID NO.2; (2) An amino acid sequence derived from the amino acid sequence shown in SEQ ID NO. 2 by inserting, deleting, or replacing one or more amino acid residues and having the function of controlling rice leaf color.

3. A recombinant expression vector comprising the gene YL5 as claimed in claim 1.

4. A host comprising the recombinant expression vector according to claim 3.

5. The gene according to claim 1 YL5 Or the use of the protein YL5 according to claim 2, the recombinant expression vector according to claim 3, or the host according to claim 4 in regulating rice leaf color.

6. The use according to claim 5, characterized in that: The gene YL5 Or the protein YL5 is used to control the rice leaves to turn yellow-green after heading.

7. The use according to claim 5, characterized in that: Application in molecular breeding of rice leaf color traits.

8. The gene according to claim 1 YL5 Or the use of the protein YL5 according to claim 2, the recombinant expression vector according to claim 3, or the host according to claim 4 in the identification of hybrid purity of hybrid rice offspring and / or the identification of purity of sterile line self-pollinated seeds.

Images