Application of NO-regulated msa-miR156e gene in regulation of plant drought resistance

Abstract

The invention discloses an application of an msa-miR156e gene regulated by NO in regulation of drought resistance of plants, and is characterized in that a mature sequence of the msa-miR156e gene is as shown in SEQ ID No. 1, and a precursor sequence of the msa-miR156e gene is as shown in SEQ ID No. 2. The invention also discloses an application of the msa-miR156e gene in regulation of drought resistance of plants. According to the application, the mechanism of NO for regulating the alfalfa msa-miR156e gene to cope with drought stress is studied, the NO is found to up-regulate the expression of msa-miR156e, enhance the activity of antioxidant enzyme and reduce the accumulation of active oxygen, so that the drought resistance of alfalfa is remarkably improved, SPL family genes are regulated in a targeted manner through msa-miR156e, the physiological adaptability of plants is promoted, and the theoretical basis of plant stress resistance is enriched; the cultivation of a high-quality alfalfa variety adapting to a drought environment is facilitated.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to application of NO regulating msa-miR156e gene in regulating plant drought resistance. Background Art

[0002] Alfalfa (Medicago sativa L.) is one of the important perennial legumes in the world. Its high protein content and strong adaptability make it widely used in animal husbandry. However, drought stress is an environmental factor that seriously limits the growth and productivity of alfalfa, especially in northern China and other arid and semi-arid areas. Drought significantly affects the yield and quality of alfalfa. Traditional alfalfa breeding methods are difficult to quickly achieve a significant improvement in drought resistance due to the autotetraploid characteristics of the plant and self-incompatibility. Therefore, drought resistance enhancement technology based on molecular biology has become an important research direction.

[0003] In the study of plant drought resistance, nitric oxide (NO) has been found as a key signaling molecule that can regulate a variety of stress resistance processes. NO helps plants improve their ability to adapt to stress environments by affecting plant signal transduction pathways and gene expression under drought stress. In the study of the mechanism of action of NO, microRNA (miRNA) has attracted much attention due to its importance in regulating gene expression. miRNA can regulate the expression of stress resistance-related genes by targeting the mRNA of specific genes. Among the known miRNA families, miR156 has become a research hotspot due to its important role in plant growth and development and stress resistance regulation. miR156 regulates multiple developmental processes and stress adaptation processes of plants by targeting genes of the SPL transcription factor family.

[0004] There have been many reports on the physiological metabolism of NO regulating plant resistance, but the regulation of miR156 family members at the molecular level, especially in alfalfa, and its mechanism of drought resistance are still unclear. Specifically, how NO affects the expression of drought resistance-related genes by regulating the expression of miR156e in alfalfa, as well as its performance in a transgenic background, is still lacking in detailed research. Therefore, it is urgent to explore the molecular mechanism of NO regulating alfalfa miR156e to cope with drought stress, so as to provide a scientific basis and new strategies for drought resistance breeding of alfalfa.

[0005] Therefore, the present invention proposes the application of NO regulating the msa-miR156e gene in regulating plant drought resistance. Summary of the invention

[0006] In order to solve the above technical problems, the present invention proposes the application of NO regulating msa-miR156e in regulating plant drought resistance.

[0007] In order to achieve the above technical effects, the present invention is implemented through the following technical solutions:

[0008] The use of NO to regulate msa-miR156e in regulating plant drought resistance, characterized in that the mature sequence of msa-miR156e is shown in SEQ ID No.1, and the precursor sequence of msa-miR156e is shown in SEQ ID No.2;

[0009] SEQ ID No.1:ttgacagaagatagagagcac;

[0010] SEQ ID No.2:

[0011] GGUUGUUGACAGAAGAUAGAGAGCACAGAUGAUGAUAUGCA

[0012] UUUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAUAU

[0013] AUAUAUAUAUAUAUUGAGGAGCUGGAGCUGCAUGGAGAUG

[0014] AAUUUUGUGCAUAUCACUCCUUUGUGCUCUCUAUGCUUCUGUCAUCACC.

[0015] Further, the primer pair for amplifying msa-miR156e includes I miR-s and II miR-a, III miR*s and IVmiR*a and universal primers A and B; wherein the primer sequence of I miR-s is shown in SEQ ID No.3; the primer sequence of II miR-a is shown in SEQ ID No.4; the primer sequence of III miR*s is shown in SEQ ID No.5; the primer sequence of IV miR*a is shown in SEQ ID No.6; the primer sequence of A is shown in SEQ ID No.7; the primer sequence of B is shown in SEQ ID No.8;

[0016] SEQ ID No.3:

[0017] gaTTGACAGAAGATAGAGAGCACtctctcttttgtattcc;

[0018] SEQ ID No.4:

[0019] gaGTGCTCTCTATCTTCTGTCAAtcaaagagaatcaatga;

[0020] SEQ ID No.5:

[0021] gaGTACTCTCTATCTACTGTCATtcacaggtcgtgatatg;

[0022] SEQ ID No.6:

[0023] gaATGACAGTAGATAGAGAGTACtctacatatatattcct;

[0024] SEQ ID No.7:

[0025] CTGCAAGGCGATTAAGTTGGGTAAC;

[0026] SEQ ID No.8:

[0027] GCGGATAACAATTTCACACAGGAAACAG;

[0028] Furthermore, artificial microRNA (amiRNA) technology was used to improve the drought resistance of plants by overexpressing msa-amiR156e.

[0029] Further, constructing a cloning vector to achieve efficient expression of the amiR156e gene, thereby studying its drought resistance function in transgenic plants, comprises the following steps:

[0030] (1) Nested PCR was used to replace the original 20 nucleotides of miR319a in the pRS300 plasmid with the mature sequence (21 bp) of the desired alfalfa miR156e, and the 5' arm a fragment, the central loop b fragment, and the 3' arm c fragment were amplified respectively. The mixture of a, b, and c fragments was used as a template, and the d fragment was amplified using universal primers A and B. The cloning vector was used to connect with the d fragment to generate the recombinant plasmid pMD18T-amiR156e, which was then connected with the expression vector pCPBI121. The overexpression vector pCPBI121-amiR156e was constructed by the reaction of two restriction enzymes KpnⅠ and SacⅠ and the action of T4 ligase;

[0031] (2) The constructed pCPBI121-amiR156e overexpression vector was transformed into Agrobacterium GV3101, and then the vector was transferred into the hypocotyl of the plant through the Agrobacterium-mediated method to achieve the expression of the msa-miR156e gene, thereby obtaining transgenic plants overexpressing msa-miR156e;

[0032] Furthermore, the msa-miR156e gene improves plant drought resistance by regulating the activity of plant-related antioxidant enzymes.

[0033] Furthermore, the plant is alfalfa.

[0034] The beneficial effects of the present invention are:

[0035] The present invention has achieved remarkable beneficial effects by studying the mechanism of NO regulating alfalfa miR156e in coping with drought stress. The study found that NO can significantly upregulate the expression of miR156e, enhance the activity of antioxidant enzymes, and reduce the accumulation of reactive oxygen under drought stress, thereby effectively improving the drought resistance of alfalfa; in addition, NO targets and regulates SPL family genes through msa-miR156e, promotes the physiological adaptability of alfalfa, and reveals the regulatory mechanism of NO and msa-miR156e; this study not only provides new theoretical support for understanding plant stress resistance, but also provides potential genetic engineering means for drought-resistant plant breeding, which is helpful to cultivate high-quality alfalfa varieties that adapt to drought environments. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for describing the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative work.

[0037] Figure 1 Shown is the conservation analysis of miR156 family members in Medicago truncatula;

[0038] Figure 2 Shown are the secondary structures of the Medicago miR156 family members;

[0039] Figure 3 Shown is the construction of the evolutionary tree of Medicago truncatula miR156;

[0040] Figure 4 Shown is the expression pattern of alfalfa miR156e under drought and NO treatment;

[0041] Figure 5 Shown is the amplification of the amiR156e precursor sequence;

[0042] Figure 6 Shown is the ligation verification of the cloning vector;

[0043] Figure 7 The display shows the restriction enzyme verification of pCPBI121-ami156e plasmid;

[0044] Figure 8 Shown is the PCR detection of bacterial solution connected with the vector pCPBI121-ami156e;

[0045] Fig. 9 Shown is the genetic transformation of alfalfa;

[0046] Fig.10 Shown are the phenotypes and identification diagrams of msa-miR156e transgenic plants;

[0047] Fig.11 Shown are the relative expression levels of miR156e and target genes in transgenic plants;

[0048] Fig.12 Shown is the water loss rate of detached leaves of transgenic plants;

[0049] Fig.13 Shown are the phenotypic observations of transgenic alfalfa under drought and drought and NO treatments;

[0050] Fig.14 Shown is the effect of exogenous NO on antioxidant enzyme activities and MDA content of transgenic alfalfa under drought stress;

[0051] Fig.15 Shown is the effect of exogenous NO on H2O2 content in transgenic alfalfa under drought stress;

[0052] Fig.16 The results show that exogenous NO affects the O2 .- The influence of content. DETAILED DESCRIPTION

[0053] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0054] Example 1

[0055] See also Figures 1 to 16 As shown, the use of NO regulating msa-miR156e gene in regulating plant drought resistance is characterized by comprising the following steps:

[0056] 1) Identify msa-miR156e in alfalfa and perform bioinformatics analysis on it;

[0057] 2) Using amiRNA technology to construct an msa-miR156 overexpression vector in alfalfa and perform genetic transformation;

[0058] 3) Obtain transgenic msa-miR156e overexpressing plants and analyze their drought resistance under the regulation of exogenous NO.

[0059] 1. Bioinformatics analysis of msa-miR156 in alfalfa

[0060] 1. Methods:

[0061] (1) Bioinformatics analysis of msa-miR156:

[0062] DNAMAN software was used to align the mature sequences and precursor sequences of the miR156 family members of alfalfa. The mature sequence alignment results were used to draw a sequence conservation logo diagram using WebLogo (http:weblogo.Berkeley.edu / ) to observe the sequence conservation of the miR156 family members of alfalfa. The secondary structure of the miR156 family members of alfalfa was predicted using the online tool RNAfold Web Server (http: / / ma.tbi.univie.ac.at / / cgi-bin / RNAWebsuite / RNAfold.cgi). The current limit for the calculation of the distribution function was 7500 nt, and the limit for the minimum free energy prediction was 10000 nt. The parameters were set to default. The precursor and mature sequence information of miR156 of the recorded species were obtained by screening and searching the miRNA database (http: / / www.plantsrnas.org / sRNAannoServerlet / public_html / index.html), from which all non-redundant miR156 precursor sequences were selected. The DNAMAN software program was used to align the miR156 precursor sequences, and the MEGA 11 software was used to construct an evolutionary tree using the neighbor-joining (NJ) method.

[0063] (2) Analysis of the expression pattern of msa-miR156e under drought and exogenous NO treatment

[0064] Select the alfalfa variety "Suntory" seeds (scientific name M. sativa L., variety registration number 247, variety type introduction, and Suntory is the most sensitive variety to NO) provided by Jiuquan Future Grass Industry Co., Ltd. Select the same size, full and fresh alfalfa seeds, use nutrient soil and vermiculite 3:1 as the culture matrix, culture in a 15 cm diameter flower pot, placed at 25 ± 1 ° C, 16h light / 8h dark photoperiod, a total of 10 pots, 10 plants per pot. During the experiment, 1 / 10 Hoagland nutrient solution was regularly used for irrigation to prevent alfalfa malnutrition. Under the same cultivation and management conditions, 15% PEG, 15% PEG + 0.1mmol / L SNP (NO donor), 15% PEG + 200μmol / L PTIO (NO scavenger donor) treatment was carried out when the seedlings grew for 40 days (PEG irrigation, SNP and PTIO spraying), and each group of treatments was repeated 3 times. The leaves were mixed and sampled after 0h (CK), 6h, 12h, and 24h. After the samples were collected, they were quickly frozen in liquid nitrogen and stored at -80℃ for later use.

[0065] After sample collection, total RNA was extracted using the SteadyPure RNA extraction kit, and the Servucebio miRNA first-strand cDNA synthesis kit (tailing method) was used for alfalfa miR156e; qRT-PCR was determined using the SYBR Green Premix Pro Taq HS qPCR Kit. NCBI Premier-BLAST was used to design primers (Table 1), and the amplified fragment was about 100 to 200 bp. U6 was used as an internal reference. The Quantageneq 225 real-time fluorescence quantitative PCR instrument completed the entire quantitative experiment. The experimental reaction system (20 μL) was: 10 μL Mix (Vazyme), cDNA 2 μL, 1 μL of upstream and downstream primers, and 6 μL of ddH2O. Add the above reaction components, centrifuge and mix, and place in a real-time fluorescence quantitative PCR instrument for amplification. The amplification program was: 95°C 30s, 95°C 15s, 60°C 30s, and a total of 40 cycles. After the reaction was completed, the specificity of the PCR product was determined by detecting the melting curve. Each reaction was repeated 3 times, and 2 -ΔΔCT The relative expression levels of genes under different treatment times were calculated.

[0066] Primer name Forward Primer Reverse primer Msa-miR156e TTGACAGAAGATAGAGAGCAC CAGTGCAGGGTCCGAGGT MsU6 GGAACGATACAGAGAAGATTAGC TGGAACGCTTCACGAATTTGCG MsSPL01 TACCATCGCCGCCATAAAGT ACCAAGTCATGGAACCTGCT MsSPL12 ACCAAGATTGCTGTCCCAGG AGTTGCATACTGAGGGGTGC 18S rRNA TACCTGGTTGATCCTGCCAGTAGTC CAATGATCCTTCCGCAGGTTCAC

[0067] Table 1

[0068] 2. Results:

[0069] 2.1 Identification and conservation analysis of miR156 family members in alfalfa

[0070] A total of 10 members (miR156a-j) were identified in alfalfa miR156. Figure 1 As shown, the 10 alfalfa miR156 members contain 20-21 bases, of which the G+C content is between 42.86% and 55%, the highest base content is A (accounting for 40.98%), and the lowest is U (accounting for 11.22%). The alfalfa miR156-5p members have highly conserved mature sequences, with only a few bases not conserved, while the alfalfa miR156-3p members are not highly conserved, which indicates that alfalfa miR156-3p may have significant differences in function.

[0071] 2.2 Secondary structure analysis of miR156 family members in alfalfa

[0072] The precursor sequences of seven alfalfa miR156 members were identified, namely miR156a / b / c / d / e / g / i, with lengths of 460nt, 95nt, 98nt, 90nt, 172nt, 120nt, and 93nt, respectively. The secondary structure prediction results are shown in Figure 2 As shown, the precursor sequences of the seven members can form a typical hairpin structure, and the minimum folding free energy is -94.20kcal / mol, -62.30kcal / mol, -54.10kcal / mol, -41.10kcal / mol, -81.00kcal / mol, -45.70kcal / mol, -43.10kcal / mol, respectively, all less than -18kcal / mol, which is consistent with the miRNA characteristics. The mature sequences of the seven miR156 members are all located on the 5' arm of the precursor secondary structure.

[0073] 2.3 Conservation and cluster analysis of miR156 member sequences between alfalfa and other species

[0074] The cluster analysis results are as follows Figure 3 As shown in the figure, the precursor sequences of 87 miR156 family members from different species were compared and clustered into 5 subtribes. The miR156 family of these 8 species is distributed in 5 branches, which shows that the miR156 family is relatively conservative in herbs and vines. Different members of the miR156 family of these 8 species are clustered in different branches, indicating that the precursor sequences of the plant miR156 family are rich in diversity. Alfalfa miR156 is distributed in subtribes I, II, IV, and V, containing 1, 2, 2, and 2 members, respectively. Alfalfa miR156e is most closely related to Medicago truncatula miR156k, indicating that the two miRNAs may have similar functions.

[0075] 2.4 Analysis of the expression pattern of msa-miR156e under drought and exogenous NO treatment

[0076] Quantitative results such as Figure 4 As shown in the figure, with the increase of drought time, the expression level of alfalfa miR156e showed an upward trend, and compared with 0h, it increased by 0.17, 1 and 0.91 times at 6h, 12h and 24h, respectively. After PEG+NO treatment, the expression level of miR156e was upregulated at 6h, and the expression level at 12h increased rapidly, increasing by 53.57 times compared with 0h, and 26.29 times compared with 12h of drought stress, but the expression level decreased significantly at 24h. After PEG+PTIO treatment, the relative expression level of miR156e was significantly downregulated at 12h, decreasing by 0.56 times. This shows that exogenous NO can significantly induce the expression of miR156e.

[0077] 2. Construction of msa-miR156e overexpression vector and genetic transformation

[0078] 1. Methods

[0079] 1.1 Primer design of amiR156e

[0080] The mature sequence of alfalfa miR156e (ttgacagaagatagagagcac) was obtained by comparison and downloading from the alfalfa miRNA database and the degradation group database; primers were designed using the online website WMD3 (http: / / wmd3.weigelworld.org / ) as shown in Table 2.

[0081] Primer name amiR156e precursor sequence ImiR-s gaTTGACAGAAGATAGAGAGCACtctctcttttgtattcc IImiR-a gaGTGCTCTCTATCTTCTGTCAAtcaaagagaatcaatga IIImiR*s gaGTACTCTCTATCTACTGTCATtcacaggtcgtgatatg IVmiR*a gaATGACAGTAGATAGAGAGTACtctacatatatattcct A CTGCAAGGCGATTAAGTTGGGTAAC B GCGGATAACAATTTCACACAGGAAACAG

[0082] Table 2

[0083] 1.2 Extraction of pRS300 plasmid

[0084] The extraction method of pRS300 plasmid was carried out according to the instructions of the spin column type plasmid mini-extraction kit (DP103).

[0085] 1.3 Amplification of miR156e precursor sequence

[0086] The pRS300 plasmid that has been successfully extracted was used as a template, and nested PCR was used to replace the original 20 nucleotides of miR319a in pRS300 with the mature sequence (21 bp) of the desired alfalfa miR156e. Different combinations of primers I, II, III, IV, A and B in Table 3 were used to amplify the a fragment of the 5' arm, the b fragment of the central loop and the c fragment of the 3' arm, respectively. The PCR reaction system is shown in Table 3.

[0087] PCR reaction Forward Primer Reverse primer template Product length a A IV pRS300 272 b III II pRS300 171 c I B pRS300 298 d A B a+b+c 701

[0088] Table 3

[0089] The amplification reaction conditions are: 95℃ pre-denaturation for 2min; 95℃ for 30s; 60℃ for 30s; 70℃ for 40s; 35 cycles; 72℃ extension for 10min. Then, the mixture of a, b and c fragments was used as a template, and universal primers A and B were used to amplify fragment d. The reaction conditions are: 95℃ pre-denaturation for 2min; 95℃ for 30s; 58℃ for 30s; 72℃ for 1.5min, 35 cycles; 72℃ extension for 10min; 4℃ storage.

[0090] 1.4 Construction of cloning vector

[0091] The d fragment was connected to the cloning vector pMD18-T to construct a recombinant plasmid, and then the recombinant vector was transformed into DH5α Escherichia coli competent cells using the heat shock method.

[0092] (1) The reaction system for ligating fragment d with pMD18-T is shown in Table 4.

[0093] Components Volume (μL) pMD18-TVector 1 D fragment 4 SolutionⅠ 5 <![CDATA[ddH2O]]> upto10

[0094] Table 4

[0095] In the above system, n(Vector DNA):n(d fragment)=1:2-10;

[0096] (2) 16°C for 30 min;

[0097] (3) Take 1 tube of 100 μL DH5α competent cells from the -80°C refrigerator, quickly place it in ice, and leave it for 5 min to thaw;

[0098] (4) The recombinant vector (10 μL) was divided into two portions (5 μL each) and added to the DH5α competent cells. The mixture was gently mixed and placed on ice for 30 min, incubated in a water bath at 42°C for 45 s, and placed on ice for 1 min.

[0099] (5) Add 445 μL LB liquid medium (without antibiotics) to the two tubes and culture at 37°C with shaking at 260 rpm for 1 h;

[0100] (6) Centrifuge at 6000 rpm for 5 min, remove the excess supernatant, retain 100 μL of the supernatant and the bacterial block, gently pipette and mix, then apply an appropriate amount of bacterial solution onto LB solid medium containing Amp (1 mg / mL), X-Gal (200 μg / mL), and IPTG (2 mg / mL), seal and mark, place upside down in a constant temperature biochemical incubator, and culture overnight at 37°C in the dark;

[0101] (7) Blue-white screening: single white colonies with neat edges were selected from the plates with growing colonies in an ultra-clean workbench, inoculated into 5 mL of LB liquid culture medium (1 mg / mL Amp), and cultured at 37°C with shaking at 260 rpm for 6–8 h;

[0102] (8) Take 1.5 μL of the above bacterial solution as a PCR amplification template to amplify the band;

[0103] (9) The positive clones were sent to a biological company for sequencing, and the recombinant plasmid suitable for sequencing was named pMD18T-amiR156e.

[0104] 1.5 Construction of expression vector

[0105] 1.5.1 Plasmid double restriction digestion

[0106] The plasmids were extracted from the bacterial solution with suitable sequencing and no base mutations, and the plasmids were double-digested with two restriction endonucleases, KpnⅠ and SacⅠ, respectively. The enzyme digestion system is shown in Table 5:

[0107] Components Volume (μL) KpnⅠ 1 SacⅠ 1 Recombinant plasmid 2 GreenBuffer 5 <![CDATA[ddH2O]]> upto20

[0108] Table 5

[0109] 1.5.2 Ligation of enzyme digestion products

[0110] The products obtained by double enzyme digestion were detected by 1% agarose gel electrophoresis, recovered by gel recovery kit, and the pCPBI121 large fragment and the target small fragment of alfalfa miR156e were connected by T4 DNA ligase. The reaction system is shown in Table 6. The ligation product was transferred into Escherichia coli competent cells, and a single colony was picked from the plate and shaken, and the positive colony was picked and named pCPBI121-amiR156e.

[0111]

[0112]

[0113] Table 6

[0114] 1.5.3 Transformation of Agrobacterium with recombinant plasmid pCPBI121-amiR156e

[0115] (1) Take 100 μL of Agrobacterium GV3101 competent cells and add 2 μL of pCPBI121-amiR156e recombinant expression vector;

[0116] (2) Rapid freezing in liquid nitrogen for 5 min, followed by thawing in a 37°C water bath for 5 min;

[0117] (3) Add 1.5 mL of LB liquid medium and culture at 28°C, 200 rpm for 4 h;

[0118] (4) Centrifuge the bacterial solution at 5000 rpm for 1 min and discard the excess supernatant;

[0119] (5) 200 μL of liquid suspended cells were spread on LB solid plate and cultured at 28°C for 2 days;

[0120] (6) A single colony was selected for PCR verification. After verification, it was named GV3101-amiR156e and stored at -80°C for future use.

[0121] 1.6 Agrobacterium-mediated genetic transformation of alfalfa and production of transgenic plants 1.6.1 Agrobacterium-mediated genetic transformation of alfalfa

[0122] The genetic transformation of alfalfa hypocotyls was carried out by Agrobacterium-mediated method, and the specific operation process is as follows:

[0123] (1) Take GV3101-amiR156e out of the -80°C freezer, first streak culture on LB solid medium (containing 50 μg / mL Kan and 50 μg / mL Rif) for 2-3 days, then pick a single colony and place it in 50 mL LB liquid medium (containing 50 μg / mL Kan and 50 μg / mL Rif), shake at 200 rpm at 28°C until the OD600 is 0.6-0.8. Finally, prepare a MS resuspended bacterial solution containing 0.1 mmol / L acetosyringone (OD600 is 0.6-0.8).

[0124] (2) Cut about 1 cm of sterile hypocotyls of 7-day-old seedlings and infect them in MS resuspended bacterial solution for 10 min. Use sterile dry filter paper to absorb the remaining bacterial solution on the surface of the hypocotyls, and then inoculate them into the modified SH co-culture medium and culture them in the dark for 3 days.

[0125] (3) Sterilize with modified SH liquid medium containing 400 mg / L carbenicillin, then transfer to callus medium for callus culture for 20 days, subculture once every 10 days; callus tissue with compact and moist appearance, uniform size and good growth is transferred to MSO differentiation medium (containing 50 mg / L Kan for screening culture) for differentiation and budding, subculture once every 20 days, and the carbenicillin concentration is reduced by 100 mg / L each time.

[0126] (4) After about 60 days of culture, adventitious buds grow from the hypocotyls, which are then transferred to a rooting medium for rooting. After rooting, they are preliminarily identified as transformed seedlings, which are then preserved and propagated.

[0127] 1.6.2 Acquisition and identification of positive plants

[0128] 0.5 g of sterile seedling leaves were taken to extract DNA (according to the kit operation) and PCR detection was performed, with DNA of non-transgenic alfalfa as a negative control, GV3101-amiR156e as a positive control, and water as a blank control.

[0129] Detection of kanamycin resistance marker gene NPTⅡ: The PCR product of transgenic positive plants was kanamycin resistance marker gene NPTⅡ, and its amplification length was 676bp. The primers were NPTⅡ-F: GCTATGACTGGGACAACAG, NPTⅡ-R: ATACCGTAAA GCACGAGGAA. The reaction system was as follows: 10μL 2×Taq PCR Master Mix, 1μL NPTⅡ-F, 1μL NPTⅡ-R, 2μL DNA, 6μL ddH2O. PCR amplification conditions: 94℃ pre-denaturation for 2min; 94℃ 45s; 60℃ 45s, 72℃ 20s, 35 cycles; 72℃ extension for 10min; 4℃ storage. After the reaction, it was detected with 1% agarose gel. The positive plant was the one with a band at 676bp.

[0130] 2. Results

[0131] 2.1 Amplification of amiR156e precursor sequence

[0132] like Figure 5 As shown in the figure (M: DNA Marker DL 2000; A: amplification of fragments a, b, and c; B: amplification of fragment d), using plasmid pRS300 as a template, a 272 bp fragment a, a 171 bp fragment b, and a 298 bp fragment c were obtained by the first round of nested PCR amplification ( Figure 5 A), and then the a, b, and c fragments were recovered by gel excision as templates for the second round of PCR amplification to obtain a 701 bp d fragment ( Figure 5 B).

[0133] 2.2 Ligation of cloning vector

[0134] like Figure 6 As shown in Figure 1 (A: gel electrophoresis; M: DL 2000 DNA marker; 1-10: bacterial sample number; B: sequencing result comparison), fragment d was connected to the pMD18-T vector for PCR. The results showed that a band at 701 bp was detected in all 10 samples ( Figure 6 A), selected sample 1, 3, 4, 6, 7, 8, 10 and sent them to the company for sequencing. The results showed that sample 1, 3, 4, 6, 7, 8, 10 all contained the target gene sequence ( Figure 6B), indicating that the mature sequence fragment of miR156e has successfully replaced the precursor fragment of Arabidopsis miR319a. The recombinant plasmid was named pMD18T-amiR156e.

[0135] 2.3 Construction of amiR156e expression vector

[0136] The pMD18T-amiR156e plasmid was connected to the pCPBI121 vector and double restriction digestion was performed to construct the pCPBI121-ami156e expression vector. The KpnⅠ restriction site is at 106 bp and the SacⅠ restriction site is at 618 bp. Figure 7 As shown (wherein M: DL2000DNA marker; 1-4 represent the results of enzyme digestion), primers were designed using the double enzyme digestion product of pMD18T-amiR156e, and PCR detection was performed to amplify a 512bp band.

[0137] 2.4 Transformation of Agrobacterium with recombinant plasmid

[0138] The recombinant expression vector pCPBI121-amiR156e was transformed into Agrobacterium GV3101, and PCR detection showed that the 512 bp band could be amplified from bacterial solutions 1, 2, and 3; Figure 8 As shown (wherein M: DL 2000 DNA marker; 1-3: positive bacterial solution), it was proved that the amiRNA expression vector pCPBI121-amiR156e of miR156e had been successfully transformed into Agrobacterium and named as GV3101-amiR156e.

[0139] 2.5 Genetic transformation of alfalfa

[0140] The genetic transformation process of alfalfa Fig. 9 As shown in Figure 1 (A: 7-day-old alfalfa seedlings; B.: 3-day-old callus; C: 20-day-old embryonic callus; D: 40-day-old callus differentiation and budding; E: 60-day-old screening and rooting; F: transgenic seedlings), first cut the hypocotyls of 7-day-old alfalfa "Suntory" ( Fig. 9 A), the successfully constructed overexpression vector pCPBI121-amiR156e was infected with Agrobacterium tumefaciens and co-cultured for 3 days ( Fig. 9 B), transferred to callus medium and cultured in dark for 20 days to differentiate callus tissue ( Fig. 9 C), and the differentiation buds were screened using differentiation medium for 40 days ( Fig. 9 D) and then transferred to rooting medium for rooting ( Fig. 9 E), and after 60 days, the rooted seedlings were screened to obtain the transformed seedlings ( Fig. 9 F).

[0141] 2.6 Obtaining and identifying transgenic plants

[0142] like Fig.10 As shown (A: transgenic alfalfa; B: transgenic gel image; M: DL 2000 DNA marker; +: positive colony; C: non-transgenic plant; -: ddH2O negative control; 1-7: transgenic plant), the transgenic seedlings were transplanted to nutrient solution culture after hardening ( Fig.10 A). PCR test results showed ( Fig.10 B), except for plant No. 2, the other transgenic plants all had a band with a size and position comparable to that of the positive control, with a size of 676 bp, and a positive rate of 85.71%.

[0143] 3. Analysis of drought resistance of transgenic alfalfa regulated by exogenous NO

[0144] 1. Methods

[0145] 1.1 Experimental treatment

[0146] After hardening, the transgenic plants were transferred to the hydroponic box and continued to grow in the light incubator at 25±1℃, 16h light / 8h dark, and 6000Lx light intensity. After 30 days of cultivation, transgenic and wild-type alfalfa seedlings with basically the same growth and good development were selected for treatment. 1 / 10 Hoagland nutrient solution was still used for culture, and the treatment groups were T1: 15% PGE-6000; T2: 0.1mmol / L SNP+15% PEG. SNP was treated every 24h, and all SNPs used were freshly prepared and used. PEG-6000 treatment time was 7d. After sampling, liquid nitrogen was quickly frozen and stored in a -20℃ refrigerator for standby use. Three biological replicates were set for each physiological indicator.

[0147] 1.2 Physiological and biochemical index determination methods

[0148] 1.2.1 Water loss rate of detached leaves

[0149] Use tweezers to pick mature leaves of wild-type and transgenic plants in good growth condition, rinse the surface gently with running water, and then use filter paper to absorb the moisture on the surface of the leaves, immerse them in a 50mL centrifuge tube filled with ddH2O, and let it stand in the dark for 4 hours to make it fully saturated. After 4 hours, take out the leaves and weigh them on an analytical balance, record and take pictures. Put each leaf in a clean culture dish, weigh it every 30 minutes, record the reading Wn, and weigh it continuously for 2 hours. The water loss rate formula is as follows:

[0150] Water loss rate (%) = (W0-Wn) / W0×100%

[0151] 1.2.2 Determination of MDA content

[0152] Malondialdehyde (MDA) content: The specific method is determined by the thiobarbituric acid colorimetric method of Heath et al.

[0153] 1.2.3 Determination of antioxidant enzyme activity

[0154] Antioxidant enzyme activity: Superoxide dismutase (SOD) activity was determined by referring to the method of Huang et al.; peroxidase (POD) activity was determined by referring to the method of Gao Junfeng et al.; catalase (CAT) activity was determined by referring to the method of Chen Jianxun et al.

[0155] 1.2.4 3,3-Diaminobenzidine (DAB) staining

[0156] DAB staining preparation: Weigh 0.05 g DAB powder and dissolve it in 50 mM pH 7.5 phosphate buffer, adjust the pH to 3.8 with 1 mol / L HCl, and finally make up to 500 mL to obtain 1 mg / mL DAB solution.

[0157] Staining: Cut the alfalfa leaves with different treatments and place them in a centrifuge tube containing 10 mL of DAB dye solution, and stain them overnight on a shaker at 80 r / min.

[0158] Decolorization: Decolorize by boiling in 95% ethanol, changing the ethanol continuously until it is completely decolorized. Finally, store in ethanol, observe the staining and take photos.

[0159] 1.2.5 Nitrotetrazolium chloride (NBT) staining

[0160] NBT reacts with superoxide anions to form blue formazan. The darker the blue color of the leaves, the greater the degree of damage.

[0161] Preparation of NBT dye solution: Dissolve 0.1 g NBT powder in 50 mM phosphate buffer (pH 7.5) to obtain a final concentration of 0.2 mmol / L NBT solution (make sure to prepare and use it immediately and keep it away from light).

[0162] Staining: Add the prepared NBT solution to a 10mL centrifuge tube, carefully cut alfalfa leaves (to avoid external damage), place them in the centrifuge tube containing NBT solution so that they are completely immersed, mark them, place the centrifuge tube on a shaker at 80r / min for uniform staining, and stain for 6-8h away from light.

[0163] Decolorization: Add 75% ethanol and boil for decolorization. Repeat 2-3 times until the leaves are completely decolorized. Finally, store them in ethanol solution, observe the staining and take pictures.

[0164] 1.2.6 Gene expression analysis

[0165] Under the same cultivation and management conditions, the transgenic alfalfa seedlings were subjected to stress treatment when they grew for 40 days; first, the seedlings were subjected to 15% PEG to simulate drought stress, and the leaves were mixed and sampled after 0h (CK), 6h, 12h, and 24h. Three biological replicates were set for all samples. After collection, the samples were quick-frozen in liquid nitrogen and stored at -80℃ for later use. The target genes of msa-miR156e were predicted by the online website and real-time fluorescence quantitative detection was performed. The primer sequences are shown in Table 1, and the Supereal Pre Mix Plus enzyme was used for qRT-PCR.

[0166] 1.3 Data Analysis

[0167] The data in the experiment were analyzed by one-way ANOVA in IBM SPSS Statistics 25.0 software, and the experimental results were presented as mean ± standard deviation (SD). The graphs were drawn using Excel software, and different letters indicated the level of significant difference between the values ​​(P<0.05).

[0168] 2. Results

[0169] 2.1 Analysis of the expression pattern of transgenic alfalfa miR156e

[0170] The alfalfa overexpression plants 1 and 2 (named OE#1 and OE#2) that had been initially verified were selected for analysis. The quantitative results are shown in Fig.11 As shown in the figure, compared with the wild-type plants, the expression levels of the overexpressed plants were significantly increased by 3.24 and 2.64 times, while the target genes showed the opposite expression pattern. In the overexpressed plants, SPL01 was downregulated by 0.6 and 0.62 times, and SPL12 was downregulated by 0.68 and 0.57 times. This indicates that OE-miR156e plants have been successfully obtained, and miR156e participates in the response to drought stress by negatively regulating target genes.

[0171] 2.2 Analysis of water loss rate of detached leaves of transgenic plants

[0172] Plants mainly lose water through their leaves. The water loss state of detached plant leaves can reflect the drought resistance of plants to a certain extent. Therefore, we preliminarily analyzed the drought resistance of transgenic plants by measuring the water loss rate of plant leaves. As time goes by, the water loss rate of detached alfalfa leaves shows an overall upward trend, and the leaves gradually wilt. Fig.12As shown in A (phenotype of detached leaves), there was no significant difference between the wild type and transgenic plants after 10 minutes of detachment; after 60 minutes of detachment, the water loss rates of OE#1 and OE#2 were 11.37% and 12.18%, respectively, which were significantly lower than that of the wild type (16.06%) (P<0.05), and the leaves of the wild type began to shrink; after 120 minutes of detachment, the leaves of the overexpressing plants wilted less than the wild type, with the water loss rates of OE#1 and OE#2 being 20.10% and 21.1%, respectively, and the water loss rate of the wild type leaves being 24.9% (P<0.05). Fig.12 As shown in B (water loss rate of detached leaves), this indicates that OE-miR156e significantly improves the drought tolerance of plants.

[0173] 2.3 Phenotypic analysis of transgenic plants under drought stress by exogenous NO

[0174] In order to understand the ability of transgenic plants and wild-type plants to cope with drought stress under exogenous NO treatment, we applied drought stress treatment after pretreatment with SNP. Fig.13 As shown in the figure, under drought stress, OE-miR156e was greener and had less leaf damage than the wild type. After spraying NO, both the wild type and the overexpression type showed stronger drought tolerance compared with drought conditions, while OE-miR156e showed higher drought tolerance after spraying NO.

[0175] 2.4 Effects of exogenous NO on antioxidant enzyme activities in transgenic plants under drought stress

[0176] Fig.14 A (SOD enzyme activity) showed that under drought stress, compared with wild-type plants, OE-miR156e plants increased by 51.39%. After exogenous application of SNP, the SOD enzyme activity of wild-type alfalfa and OE-miR156e alfalfa under drought treatment was significantly upregulated (P<0.05), among which the SOD enzyme activity of OE-miR156e alfalfa in the NO treatment group increased by 6.73% compared with the drought treatment group alone, and increased by 41.87% compared with the wild type. Fig.14 B (POD enzyme activity) showed that under drought stress, the POD enzyme activity of OE-miR156e alfalfa plants increased by 43.94% compared with wild-type plants. This showed that OE-miR156e improved the drought resistance of alfalfa. After exogenous application of SNP, the POD enzyme activity of wild-type plants and OE-miR156e plants under drought treatment alone was significantly upregulated (P<0.05), among which the POD enzyme activity of OE-miR156e alfalfa increased by 10.4% compared with that under drought stress alone, and increased by 31.46% compared with wild-type. Fig.14C (CAT enzyme activity) shows that the CAT enzyme activity of OE-miR156e alfalfa plants increased by 73.43% compared with wild-type plants. After exogenous application of SNP, the CAT enzyme activity of wild-type alfalfa plants and OE-miR156e plants was significantly upregulated under drought treatment (P<0.05), among which the CAT enzyme activity of OE-miR156e alfalfa increased by 15.04% compared with that under drought stress alone, and increased by 70.42% compared with wild type. In summary, the increase of antioxidant enzyme activity in OE-miR156e plants under NO treatment enhanced its drought resistance.

[0177] 2.5 Effect of exogenous NO on MDA content in transgenic plants under drought stress

[0178] MDA is one of the end products of membrane lipid peroxidation. In experiments, MDA content is often used to reflect the level of plant membrane lipid peroxidation and the degree of cell membrane damage. Fig.14 D (MDA content) The MDA of OE-miR156e plants under drought stress was significantly lower than that of the wild type. Under exogenous SNP treatment, the MDA content of transgenic plants and wild-type spiders decreased. The MDA content of OE-miR156e decreased by 29.25% compared with drought stress alone, and the MDA content of OE-miR156e plants decreased by 43.66% compared with the wild type. This shows that OE-miR156e plants improve their drought resistance by reducing MDA content.

[0179] 2.6 Effects of exogenous NO on H2O2 content in transgenic plants under drought stress

[0180] The tissue localization of H2O2 was detected by DAB staining. Fig.15 ), under drought stress treatment, the overexpression plants were lighter in color than the wild type, indicating that alfalfa overexpressing miR156e accumulated less H2O2 under drought stress. After spraying SNP, OE-miR156e had the lightest leaf color and the least H2O2 content compared with the wild type.

[0181] 2.7 Effect of exogenous NO on O2 .- The influence of content

[0182] The more severe the stress damage to the plant, the more O2 accumulated in the body .- The more. NBT staining results show ( Fig.16 ), under drought stress, OE-miR156e had lighter leaves than wild-type plants and had less O2 .- The wild-type and transgenic plants had less O2 .-, while the leaves of OE-miR156e were lighter in color, indicating that exogenous NO combined with the overexpression strain, O2 .- The content is reduced, making alfalfa more drought-tolerant.

[0183] In summary, the use of exogenous NO can positively regulate the drought resistance of alfalfa by regulating msa-miR156e.

Claims

1. Application of NO-regulated msa-miR156e gene in regulating plant drought resistance, characterized in that: The mature sequence of the msa-miR156e gene is shown in SEQ ID No.1, and the precursor sequence of the msa-miR156e gene is shown in SEQ ID No.

2.

2. The use of NO-regulated msa-miR156e gene in regulating plant drought resistance according to claim 1, characterized in that: The primer pair for amplifying the msa-miR156e gene as described in claim 1 includes I miR-s and II miR-a, III miR*s and IV miR*a, A and B; wherein the nucleotide sequence of I miR-s is shown in SEQ ID No.3; the nucleotide sequence of II miR-a is shown in SEQ ID No.4; the nucleotide sequence of III miR*s is shown in SEQ ID No.5; the nucleotide sequence of IV miR*a is shown in SEQ ID No.6; the nucleotide sequence of A is shown in SEQ ID No.7; and the nucleotide sequence of B is shown in SEQ ID No.

8.

3. The use of NO-regulated msa-miR156e gene in regulating plant drought resistance according to claim 1, characterized in that: Overexpression of the msa-miR156e gene improves plant drought resistance.

4. The use of NO-regulated msa-miR156e gene in regulating plant drought resistance according to claim 1, characterized in that: The construction of a cloning vector to achieve efficient expression of the amiR156e gene, thereby studying its drought resistance function in transgenic plants, includes the following steps: (1) Nested PCR was used to replace the original 20 nucleotides of miR319a in the pRS300 plasmid with the mature sequence (21 bp) of the desired alfalfa miR156e. The 5' arm a fragment, the central loop b fragment and the 3' arm c fragment were amplified respectively. The mixture of a, b and c fragments was used as a template, and the d fragment was amplified using universal primers A and B. The cloning vector was used to connect with the d fragment to generate the recombinant plasmid pMD18T-amiR156e. The plasmid was then connected with the expression vector pCPBI121. The overexpression vector pCPBI121-amiR156e was constructed by the reaction of two restriction enzymes KpnⅠ and SacⅠ and the action of T4 ligase. (2) The constructed pCPBI121-amiR156e overexpression vector was transformed into Agrobacterium GV3101, and then the vector was transferred into the hypocotyl of the plant through the Agrobacterium-mediated method to achieve the expression of the msa-miR156e gene, thereby obtaining transgenic plants overexpressing msa-miR156e.

5. The use of NO-regulated msa-miR156e gene in regulating plant drought resistance according to claim 1, characterized in that: The msa-miR156e gene improves plant drought resistance by regulating the activity of plant-related antioxidant enzymes.

6. The use of NO-regulated msa-miR156e gene in regulating plant drought resistance according to claims 1 to 4, characterized in that: The plant is alfalfa.

Images