Method for improving low-temperature resistance of tomato by knocking out SlWRKY80 gene

Abstract

The invention discloses a method for improving low-temperature resistance of tomatoes by knocking out an SlWRKY80 gene, according to the method, the resistance of the tomatoes to low-temperature stress is improved by knocking out the SlWRKY80 gene in the tomatoes, and the coding sequence of the SlWRKY80 gene is shown as SEQ ID NO. 1. The method disclosed by the invention has the advantages that the regulation effect of the SlWRKY80 gene in the low-temperature resistance of the tomato is disclosed for the first time, the low-temperature resistance of the tomato is obviously improved by knocking out the gene, a gene resource is provided for cultivating a new variety of the low-temperature-resistant tomato, a theoretical foundation is laid for researching the resistance of the tomato to a low-temperature stress, and the method has an important significance on energy conservation and consumption reduction in winter and spring in the greenhouse vegetable industry. The method achieves stable, high and high-quality production targets of vegetable products, and has important practical significance in guaranteeing long-term stable and balanced supply of vegetable products in China.

Description

Technical Field

[0001] The present application relates to technical fields such as genetic engineering, molecular biology and physiology, and in particular to a method for knocking out the SlWRKY80 gene to improve the low temperature resistance of tomatoes. Background Art

[0002] Tomato (Solanum lycopersicum L.) is an important vegetable crop cultivated in my country. As a thermophilic crop, the suitable temperature range for tomato growth is 20-28℃, and low temperature and chilling damage severely restricts its growth and development. The main seasons for tomato cultivation in my country are winter and spring. Extreme climate phenomena occur frequently around the world. In addition, there are common problems in my country's tomato production, such as low facility equipment level and poor controllability of temperature environment. Low temperature and chilling damage adversity frequently occurs in tomato production, resulting in stunted plant growth, fruit deformity and poor quality. Therefore, it is of great significance to conduct in-depth research on the physiological and molecular mechanisms of tomato resistance to low temperature adversity. By exploring the mechanisms and key genes of plant resistance to low temperature, it is expected to enhance the low temperature tolerance of tomatoes, thereby reducing the economic losses caused by low temperature and chilling damage.

[0003] Among the many types of transcription factors in plants, the WRKY transcription factor family plays an important role in regulating plant growth and development and defense response. The notable feature of this type of transcription factor is that it contains a WRKY domain that can specifically bind to the W-box element on the promoter of the target gene, thereby inhibiting or promoting the transcription process and regulating the expression of downstream genes, thus playing an important role in the regulatory mechanism of plant response to stress. At present, a large number of WRKY transcription factors have been isolated and identified in a variety of plants such as Arabidopsis, corn, rice, soybean, cucumber, tomato, and poplar. Studies have shown that AtWRKY1 is a key transcription factor in Arabidopsis that responds to both light and nitrogen factors and participates in the transcriptional regulation of a variety of biological processes; in tomatoes, SlWRKY51 mediates proline synthesis and positively regulates tomato low temperature tolerance; the SlWRKY80 gene positively regulates tomato root knot nematode resistance. In addition, SlWRKY80 mediates the jasmonic acid pathway, promotes the synthesis of spermidine and Na+ / K+ homeostasis in tomatoes, and positively regulates tomato resistance to salt-alkali stress.

[0004] However, the role of tomato SlWRKY80 gene in cold stress has not been reported. Summary of the invention

[0005] In view of this, the purpose of the embodiments of the present application is to provide a method for knocking out the SlWRKY80 gene to improve the low temperature resistance of tomatoes.

[0006] According to an embodiment of the present application, a method for knocking out the SlWRKY80 gene to improve the low temperature resistance of tomatoes is provided. The method is to improve the resistance of tomatoes to low temperature adversity by knocking out the SlWRKY80 gene in tomatoes. The coding sequence of the SlWRKY80 gene is shown in SEQ ID NO.1.

[0007] Furthermore, the amino acid sequence of the protein encoded by the SlWRKY80 gene is shown in SEQ ID NO.2.

[0008] The present invention performs sequence analysis on the full length of the DNA of the tomato SlWRKY80 gene (Solyc03g095770) (http: / / solgenomics.net / ), designs a specific guide RNA (single guide RNA, sgRNA). A target containing a protospacer sequence adjacent to a motif PAM structure is selected in the protein coding region of the tomato SlWRKY80 gene, and the first 20 bases thereof are used as the basis to design corresponding primers and construct a CRISPR / Cas9 vector. Agrobacterium containing the CRISPR / Cas9 vector is used to infect tomato cotyledons, and plant tissue culture is performed to screen positive transgenic plants, and transgenic plants with significant low temperature resistance are obtained.

[0009] Furthermore, the nucleotide sequence (sgRNA1, sgRNA2) containing the first 20 bases of the protospacer sequence adjacent to the motif PAM structure is as shown in SEQ ID NO:3.

[0010] The specific performance of the method of the present invention in improving the low temperature resistance of tomatoes includes the decrease of relative conductivity, the increase of maximum photochemical efficiency (Fv / Fm) and the improvement of survival rate.

[0011] The beneficial effects of the present invention are as follows: By subjecting tomato SlWRKY80 gene knockout plants to low temperature treatment, it was found that the SlWRKY80 gene knockout plants showed a significant low temperature resistance phenotype under low temperature. The present invention provides gene resources for breeding new low temperature resistant tomato varieties, has high potential application value, and lays a foundation for studying the mechanism of tomato plants' resistance to low temperature adversity. The present invention uses tomato SlWRKY80 gene knockout plants for low temperature treatment for the first time, and finds that the SlWRKY80 gene plays a negative regulatory role in tomato's resistance to low temperature stress. Knocking out this gene can significantly increase the tomato plant's ability to resist low temperature.

[0012] It should be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the present application. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the present application and, together with the description, serve to explain the principles of the present application.

[0014] Figure 1 Schematic diagram of the construction of CRISPR / Cas9 vector for large fragment deletion. A is the location structure of the vector sgRNAs; B is the DNA sequencing results of two sgRNAs in the tomato SlWRKY80 gene knockout strain; Figure 1 The position and sequence on the genome are shown in Figure 2, and the PAM site is outlined with a box.

[0015] Figure 2 is the relative expression level of the SlWRKY80 gene after the wild-type tomato was treated at 25°C and 4°C in Example 3 of the present invention; Figure 3 The phenotype of the tomato SlWRKY80 gene knockout strain after low temperature treatment in Example 3 of the present invention; Figure 4 is the relative conductivity of the tomato SlWRKY80 gene knockout strain after low temperature treatment in Example 3 of the present invention; Figure 5 is the maximum photochemical efficiency (Fv / Fm) of the tomato SlWRKY80 gene knockout strain after low temperature treatment in Example 3 of the present invention; Figure 6 It is the survival rate of the tomato SlWRKY80 gene knockout strain after low temperature treatment in Example 3 of the present invention. DETAILED DESCRIPTION

[0016] The present invention is further described below in conjunction with specific examples, but the present invention is not limited to the following examples. The present invention is intended to cover other changes and modifications within the scope and spirit of the present invention.

[0017] Unless otherwise indicated, the practice of the present invention will use conventional techniques of botany, tissue culture, molecular biology, biophysiology and biochemistry, DNA recombination and bioinformatics that are obvious to those skilled in the art. These techniques are fully explained in the literature.

[0018] Example 1: Construction of SlWRKY80 CRISPR / Cas9 gene knockout vector; Construction of SlWRKY80 gene mutation vector, using CRISPR-P2.0 website to design SlC3H39 gene target sequence, the specific sequence is shown in SEQ ID No: 3 GCCCTGGGTTAAACTATTAT, SEQ ID No: 4 TTTAACCCAGGGCCAGATCG, primer sequence is Target1-F: gcGGTCTCTATTGaacaaagcaccagtggtctagtg, using CRISPR-P2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ) website, U6 promoter is selected, sgRNA of SlWRKY80 gene is screened. Among them, the SlWRKY80 gene CRISPR / Cas9 vector respectively selects two sgRNAs at the exons of its own gene, each sgRNA has a forward primer and a reverse primer, which are used for PCR to obtain a fragment containing sgRNA, wherein the forward primer of the first sgRNA selected by the vector is a universal forward primer, and the PCR primer sequence is shown in Table 1. Figure 1 A in FIG. 1 is a schematic diagram of the construction of a CRISPR / Cas9 vector for large fragment deletion. Figure 1 A in the figure is the location structure diagram of sgRNAs in the vector; Figure 1 B in the figure is the position and sequence of the two gRNAs on the tomato WRKY80 genome. The specific construction process is as follows: using the tRNA vector as a template, using the KOD high-fidelity enzyme, PCR of the two targets was performed separately, and the PCR products were purified. The fragment size was about 200 bp. The Golden Gate Assembly Kit (BsaI-HFv2) (NEB, E1601) was used to complete the multi-fragment recombination. The recombination system contains the Golden Gate Assembly Mix, PHEE401 vector, target PCR purification product and T4 DNAligase buffer, which is filled to 20 μL with ddH2O. The PCR program setting refers to the instructions of the kit. The recombinant product was heat-shocked and transformed into trans5α Escherichia coli competent cells (TransGen, CD201). As described in the instructions, after activation at 37°C shaker at 200 rpm for 1 hour, the supernatant was centrifuged and discarded. The remaining 100-150 μL of liquid was resuspended and evenly coated on solid LB medium containing 50 mg / L kanamycin and cultured overnight at 37°C. Single-plaque small shakes were picked, and positive clones were identified by PCR using universal primers M13-F and M13-R, followed by sequencing. The positive plasmid with correct sequencing was named pHEE401-SlWRKY80.

[0019] Table 1 PCR primer sequences for constructing CRISPR / Cas9 vectors: CRISPR WRKY80-F1 CTGGTCTCTATTGaacaaagcaccagtggtctagtg CRISPR WRKY80-R1 CTGGTCTCTATAATAGTTTAACCCAGGGCtgcaccagccgggaa CRISPR WRKY80-F2 GCTGGTCTCTTTATgttttagagctagaaatagcaagtta CRISPR WRKY80-R2 GCTGGTCTCTAAACCGATCTGGCCCTGGGTTAAAtgcaccagccgggaatcg Example 2: Construction and detection of tomato SlWRKY80 transgenic material The gene editing vector was transformed into Agrobacterium GV3101 and infected into tomato cotyledons. Tissue culture seedlings were obtained by inducing callus, inducing differentiation with hygromycin resistance and rooting culture. The positive SlWRKY80 mutant plants were verified by PCR and next-generation sequencing technology, and propagated for two generations until they were homozygous with no Cas9 residues. It was found that SlWRKY80#1 lacked two bases, SlWRKY80#2 lacked five bases, and another base mutated from A to T. After the mutation, the TGA stop codon appeared prematurely, which directly led to the premature termination of translation.

[0020] Example 3: Detection of low temperature resistance of SlWRKY80 gene editing material First, five-leaf, one-heart wild-type tomato seedlings were treated at 25°C and 4°C. The results showed that low temperature for 6 hours could induce the expression of SlWRKY80 gene ( Figure 2 ), which indicates that the tomato SlWRKY80 gene responds to low temperature stress.

[0021] The five-leaf, one-heart wild-type tomato seedlings and the SlWRKY80 mutant strain obtained in Example 2 were treated at 25°C and 4°C in an artificial climate incubator. After 7 days of low-temperature treatment, the low-temperature stress treatment group (4°C treatment) was compared with the control group (25°C) that was not treated with low temperature under the same conditions to observe the changes in the phenotype, conductivity, and maximum photochemical quantum yield (Fv / Fm) of the wild-type and mutant tomato plants. After 9 days of low-temperature treatment, the plants were restored to 25°C for 3 days to calculate the survival rate, and necrosis of the top growth point was considered death. The results showed that the SlWRKY80 gene knockout tomato plants can significantly improve the low-temperature tolerance of tomatoes ( Figure 3 ), the relative electrolyte permeability was significantly lower than that of wild-type (WT) plants ( Figure 4 In addition, the Fv / Fm ( Figure 5 ) was also higher than that of wild-type tomatoes (WT), and the survival rate of gene knockout plants increased significantly ( Figure 6 ). This shows that the tomato SlWRKY80 gene negatively regulates the plant's cold tolerance. Knocking out the SlWRKY80 gene can significantly improve the cold tolerance of tomatoes.

[0022] Based on the above embodiments, the nucleotide sequence shown in SEQ ID NO: 1 is mutated by replacing, deleting and / or adding one or more nucleotides without changing the function of the original nucleotide sequence using gene editing technology, and then transformed into Agrobacterium. The transformed Agrobacterium is then used to infect tomato cotyledons, and plant tissue culture is performed to screen positive mutant plants, and cold-resistant mutant tomatoes can also be obtained.

[0023] Based on the above examples, the nucleotide sequence with the same function obtained by hybridizing with the sequence shown in SEQ ID NO: 1 under stringent conditions was mutated in tomatoes using gene editing technology, and then transformed into Agrobacterium. The transformed Agrobacterium was then used to infect tomato cotyledons, and plant tissue culture was performed to screen positive mutant plants, and cold-resistant mutant tomatoes were also obtained.

[0024] Based on the above embodiments, a nucleotide sequence having more than 90% homology with the nucleotide sequence of 1), 2) or 3) and encoding a protein with the same function is mutated in tomatoes using gene editing technology, and then transformed into Agrobacterium. The transformed Agrobacterium is then used to infect tomato cotyledons, and plant tissue culture is performed to screen positive mutant plants, and cold-resistant mutant tomatoes can also be obtained.

[0025] Although the present invention has been described in detail above with general descriptions and specific embodiments, the present invention is not limited to the above embodiments, and many modifications or improvements are possible, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all belong to the scope of protection claimed by the present invention.

Claims

1. A method for knocking out the SlWRKY80 gene to improve the low temperature resistance of tomatoes, characterized in that: The method is to improve the resistance of tomatoes to low temperature stress by knocking out the SlWRKY80 gene in tomatoes, and the coding sequence of the SlWRKY80 gene is shown in SEQ ID NO.

1.

2. The method according to claim 1, characterized in that The amino acid sequence of the protein encoded by the SlWRKY80 gene is shown in SEQ ID NO.2.

Images