Application of CmbHLH93 gene in grafting of muskmelon and calabash

Abstract

The invention belongs to the technical field of grafting, and particularly relates to application of a CmbHLH93 gene in grafting of muskmelon and calabash. The invention provides a virus vector for silencing a CmbHLH93 gene, and the CmbHLH93 gene of a muskmelon is silenced on the basis of the vector. The grafting affinity is improved when the muskmelon with the silent gene is grafted with the calabash.

Description

Technical Field

[0001] The present application belongs to the field of grafting technology, and specifically relates to the application of CmbHLH93 gene in melon and gourd grafting. Background Art

[0002] Grafting is a method of asexual plant reproduction, which involves grafting the branch or bud of one plant (called a scion) onto the stem or root of another plant (called a stock), allowing the two to grow together to form a new plant. Grafting is mainly achieved by utilizing the plant's ability to heal after being injured. When the cambium of the scion and the stock are tightly combined, since the cambium cells have the ability to divide, they will continue to divide and produce new cells. These new cells will fill the gap between the scion and the stock, gradually forming callus tissue. As the callus tissue grows and differentiates further, it will connect the conducting tissues of the scion and the stock (such as the xylem and phloem) to each other, thereby achieving the transport of water and nutrients, allowing the scion to grow and develop normally on the stock.

[0003] However, grafting technology has the technical problem of grafting incompatibility. Grafting incompatibility refers to the inability of the scion and the rootstock to heal normally after grafting, or even after healing, the grafted plant shows a series of physiological or morphological abnormalities during the growth process. This incompatibility may lead to grafting failure, or make the grafted plant grow weak, susceptible to diseases and pests, and even eventually die. For example, gourd is an important rootstock for melon crops. In the grafting of melon and gourd, the quality of affinity is directly related to the growth of the grafted seedlings and the subsequent yield and quality. Summary of the invention

[0004] In view of this, the embodiments of the present application disclose at least the following technical solutions:

[0005] In a first aspect, the embodiment discloses a vector for silencing the CmbHLH93 gene, which is a viral vector containing the sequence shown in SEQ ID NO:1.

[0006] In the second aspect, the embodiments disclose an engineered bacterium for silencing the CmbHLH93 gene, which contains the vector described in the first aspect.

[0007] In a third aspect, the embodiment discloses a method for silencing the melon CmbHLH93 gene, comprising the step of introducing the vector described in the first aspect into melon.

[0008] In a fourth aspect, the embodiment discloses a method for preparing a melon with a silenced CmbHLH93 gene. The method comprises: preparing the vector described in the first aspect; transferring the vector into Agrobacterium to obtain an engineered bacterium with a silenced CmbHLH93 gene; transferring the engineered bacterium into infected melon seeds; and screening positive clones from the infected melon offspring, which are melons with a silenced CmbHLH93 gene.

[0009] In a fifth aspect, an embodiment discloses a method for grafting melon and gourd, which comprises: preparing a melon with CmbHLH93 gene silenced; obtaining a branch or bud of the melon as a scion; obtaining a stem or root of a gourd as a rootstock and grafting the scion and the rootstock.

[0010] Compared with the prior art, this application has at least the following technical effects:

[0011] The beneficial effects of this application are:

[0012] Grafting incompatibility seriously affects the quality and yield of melons, and the harm caused is becoming increasingly serious. In melons, there are not many genes that have been reported and applied to improve affinity. The present application has discovered a new function of the CmbHLH93 gene related to melon / cucurbit grafting affinity, providing new options and targets for melon / cucurbit grafting affinity. The present application also provides a method for improving melon / cucurbit grafting affinity using CGMMV viral vectors and VIGS gene silencing technology, laying the foundation for solving melon / cucurbit grafting incompatibility. Next, the CmbHLH93 gene can be knocked out through gene editing technology to obtain a melon grafting affinity resource that can be stably inherited. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is a schematic diagram of the results of PV190 plasmid.

[0014] Figure 2 This is the result of qRT-PCR detection of the relative expression level of the CmbHLH93 gene. In the figure, "PV190" is a melon plant infected with Agrobacterium containing the PV190 plasmid, and "PV190_CmbHLH93" is a melon plant infected with Agrobacterium containing the CmbHLH93 gene silencing vector.

[0015] Figure 3 The plant heights of the melons and gourds provided in the examples at 7, 14 and 21 days after grafting, "PV190" refers to melon plants infected with Agrobacterium containing the PV190 plasmid, and "PV190_CmbHLH93" refers to melon plants infected with Agrobacterium containing the CmbHLH93 gene silencing vector.

[0016] Figure 4 The fresh weight of the scion of the melon and gourd grafted on the 21st day after the grafting provided in the example. "PV190" is a melon plant infected with Agrobacterium containing PV190 plasmid, and "PV190_CmbHLH93" is a melon plant infected with Agrobacterium containing CmbHLH93 gene silencing vector.

[0017] Figure 5The SPAD values ​​of the melon and gourd grafted on the 21st day after the grafting provided in the example are shown in Table 1. "PV190" is a melon plant infected with Agrobacterium containing PV190 plasmid, and "PV190_CmbHLH93" is a melon plant infected with Agrobacterium containing CmbHLH93 gene silencing vector.

[0018] Figure 6 The pictures of the melon and gourd grafted on the 21st day after the grafting provided in the examples are as follows. "PV190" is a melon plant infected with Agrobacterium containing the PV190 plasmid, and "PV190_CmbHLH93" is a melon plant infected with Agrobacterium containing the CmbHLH93 gene silencing vector. DETAILED DESCRIPTION

[0019] In order to make the purpose, technical scheme and advantages of the present application clearer, the present application is further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to explain the present application and are not intended to limit the present application. The reagents not described separately in detail in the present application are all conventional reagents and can be obtained from commercial channels; the methods not described in detail are all conventional experimental methods and can be obtained from the prior art.

[0020] VIGS (Virus-Induced Gene Silencing) is a technology widely used in plants to study gene function. It uses the plant's defense mechanism against viruses to introduce partial sequences of target genes into plant cells through recombinant viral vectors, triggering the plant's own RNA silencing mechanism, thereby reducing the expression of the target gene or losing its function, and then studying the function of the gene in many physiological processes such as plant growth, development, and disease resistance.

[0021] There is an RNA silencing system in plant cells, which mainly includes Dicer-like (DCL) proteins, Argonaute (AGO) proteins, and RNA-dependent RNA polymerase (RDR) proteins. When a virus invades a plant cell, the virus's double-stranded RNA (dsRNA) will be recognized by the DCL protein and cut into small interfering RNA (siRNA), which is usually about 21-24 nucleotides in length. siRNA will bind to the AGO protein to form an RNA-induced silencing complex (RISC). The siRNA in RISC acts as a guide sequence, which recognizes and binds to viral RNA homologous to its sequence through complementary base pairing. Then the AGO protein exerts the activity of nuclease to degrade the target RNA, thereby inhibiting the replication and spread of the virus.

[0022] Based on this, the VIGS technology can use this mechanism to silence the target gene: In the VIGS technology, a sequence of the target gene (usually 200-1000bp) is inserted into the viral vector to construct a recombinant virus. When this recombinant virus is inoculated into the plant, the plant cells will transcribe the RNA of the recombinant virus. Since it contains the sequence of the target gene, the RNA silencing mechanism of the plant will be activated. These RNAs containing the target gene sequence will be treated as foreign "viral RNA" to produce corresponding siRNA, which will cause the mRNA homologous to the target gene in the plant cell to be degraded, and finally the target gene will be silenced.

[0023] Based on this, the embodiment discloses a vector for silencing the CmbHLH93 gene, which is a viral vector containing the sequence shown in SEQ ID NO:1.

[0024] In some embodiments, the viral vector is a PV190 plasmid.

[0025] Based on this, the embodiment discloses an engineered bacterium for silencing the CmbHLH93 gene, which contains a vector for silencing the CmbHLH93 gene.

[0026] In some embodiments, the engineered bacterium is Agrobacterium containing a vector for silencing the CmbHLH93 gene.

[0027] Based on this, the embodiment discloses a method for silencing the CmbHLH93 gene in melon, comprising the step of introducing a vector for silencing the CmbHLH93 gene into melon.

[0028] In some embodiments, the method comprises infecting melon seeds with Agrobacterium containing a vector for silencing the CmbHLH93 gene; and selecting positive clones from the infected melon progeny, namely, melons with silenced CmbHLH93 gene.

[0029] Based on this, the embodiment discloses a method for preparing a melon with silenced CmbHLH93 gene. The method comprises: preparing the vector described in the first aspect; transferring the vector into Agrobacterium to obtain an engineered bacterium with silenced CmbHLH93 gene; transferring the engineered bacterium into infected melon seeds; and screening positive clones from the offspring of the infected melons, which are melons with silenced CmbHLH93 gene.

[0030] Based on this, the embodiment discloses a method for grafting melon and gourd, which comprises: preparing a melon with CmbHLH93 gene silenced; obtaining a branch or bud of the melon as a scion; obtaining a stem or root of a gourd as a rootstock and grafting the scion and the rootstock.

[0031] The following will illustrate the implementation of the present application in conjunction with more specific examples, but does not constitute a limitation on the implementation of the present application. 1. Key materials and their descriptions:

[0032] PV190 plasmid (eg Figure 1 (as shown), published in the journal Plant Methods in 2020, paper link: https: / / doi.org / 10.1186 / s13007-020-0560-3.

[0033] Escherichia coli competent DH5α and Agrobacterium tumefaciens GV3101 were purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0034] Reverse transcription kit HiScript IIQ RT SuperMix for qPCR (+gDNAwiper); PCR amplification enzyme 2×TaqMaster Mix; fluorescent quantitative dye ChamQ Universal SYBR qPCR Master Mix were all purchased from Nanjing Novozymes Biotech Co., Ltd.

[0035] All amplification primers used were synthesized by Wuhan Hece Biotechnology Co., Ltd.

[0036] 2. Preparation of vector for silencing CmbHLH93 gene

[0037] 1. Provide target sequence for silencing CmbHLH93 gene based on VIGS technology

[0038] From the Cucurbitaceae genome database, the target sequence shown in SEQ ID NO: 1 was obtained as the target sequence for silencing the CmbHLH93 gene based on VIGS technology.

[0039] 2. Extract melon RNA, reverse transcribe and PCR amplify to obtain the DNA described in SEQ ID NO:4

[0040] Example Total RNA was extracted from the hypocotyl of a melon stem segment, and cDNA was obtained by reverse transcription. PCR amplification was performed using CmbHLH93-F and CmbHLH93-R as a primer pair. The amplified product was subjected to electrophoresis, and the DNA described in SEQ ID NO: 4 was recovered from the electrophoresis band.

[0041] The steps of extracting total RNA from the hypocotyl of melon stem segments include:

[0042] 1) Grinding the hypocotyl of a melon stem segment with liquid nitrogen to obtain ground powder;

[0043] 2) Add the ground powder to Trizol reagent (mixing ratio is 100 mg ground powder to 1 mL Trizol reagent), homogenize, and shake at room temperature for 5 minutes;

[0044] 3) Add 0.2 ml of RNA Extraction Agent per 1 ml of Trizol reagent, shake vigorously for 15 seconds, and incubate at room temperature for 3 minutes;

[0045] 4) Centrifuge at 10,000 rpm, 2-8°C for 15 min. The sample is then separated into three layers: a colorless aqueous phase (upper layer), a middle layer, and a pink organic phase (lower layer). The upper aqueous phase is obtained. RNA is mainly in the aqueous phase.

[0046] 5) Transfer the aqueous phase to a new centrifuge tube, add 0.5 ml of isopropanol for every 1 ml of TransZol, invert to mix, and incubate at room temperature for 10 min.

[0047] 6) Centrifuge at 10,000 rpm at 2-8°C for 10 min, remove the supernatant, and a gelatinous precipitate will form on the side and bottom of the tube.

[0048] 7) Add 1 ml of 75% ethanol (prepared with DEPC-treated water) and vortex vigorously (add at least 1 ml of 75% ethanol for every 1 ml of TransZol used).

[0049] 8) Centrifuge at 7500rpm at 2-8℃ for 5min, dry the precipitate at room temperature (about 5min), dissolve the precipitate in 50-100μL RNA dissolution solution, incubate at 5-60℃ for 10min, and store the sample at -80℃ for long-term use. This is a solution containing total RNA.

[0050] The step of obtaining cDNA by reverse transcription includes:

[0051] 1) Mix the 2 μL total RNA solution, 4 μL 4×g DNA wiper mix and 10 μL RNAse free ddH2O and react at 42°C for 2 min (in PCR instrument)

[0052] 2) Add 4 μL 5× HiseripⅡqRT superMixⅡ to step 1), maintain at 25℃ for 10 min, 50℃ for 30 min, and 85℃ for 5 min to obtain cDNA.

[0053] The step of using CmbHLH93-F and CmbHLH93-R as a primer pair for PCR amplification includes:

[0054] 1) Prepare a PCR system, which contains 25 μL 2×SuperPfx MasterMix, 2.5 μL CmbHLH93-F, 2.5 μL CmbHLH93-R, 200 ng cDNA and the remainder ddH2O in 50 μL;

[0055] 2) The PCR system was pre-denatured at 98°C for 3 min; one cycle consisted of 98°C denaturation for 10 s, 55°C annealing for 30 s and 72°C extension for 15 s, for a total of 35 cycles; then, the reaction was extended at 72°C for 10 min; and maintained at 12°C.

[0056] Wherein, based on the target sequence, the upstream primer CmbHLH93-F as shown in SEQ ID NO:2 and the downstream primer CmbHLH93-R as shown in SEQ ID NO:3 were synthesized in the embodiment to perform PCR amplification on the target sequence, so that the 5' end of the target sequence as shown in SEQ ID NO:1 has a homology arm ( CGTCAGGACTTTACTTAATGGATCC ) and a homology arm at the 3' end ( GGATCCAGTTATAGGTCTAGGTCG ), the DNA shown in SEQ ID NO: 4 can be amplified.

[0057] CmbHLH93-F: CGTCAGGACTTTACTTAATGGATCC ATAGAACGGCGATTCTGGCA, as in SEQ ID NO: 2, the homology arms are underlined.

[0058] CmbHLH93-R: CGACCTAGACCTATAACTGGATCC GCGAAGTCATTGAAGCAGCT, as in SEQ ID NO: 3, the homology arms are underlined.

[0059] Wherein, the step of performing electrophoresis on the amplified product comprises:

[0060] Weigh 0.8g agarose and place it in a conical flask, add 40mL 1×TAE solution, heat and boil in a microwave until the agarose is completely melted, then add 4μL Ultra GelRed (10000×). Place the inner tank in a horizontal position and place the comb, and pour the agarose gel solution cooled to about 65°C onto the glass plate of the inner tank. Let it stand at room temperature until the gel is completely solidified, and pull the comb vertically to prepare a 1.5% agarose gel. Place the gel and the inner tank in the electrophoresis tank, and use a 10μL micropipette to add DL2000DNAMarker (as a control) and the above PCR amplification product into the small groove of the gel plate. After adding the sample, turn on the power for electrophoresis, and set the voltage to 120V. After the electrophoresis is completed, take out the gel and use a gel imager for UV development. A band of about 300bp can be observed, indicating that the target fragment has been successfully amplified.

[0061] The step of recovering the DNA described in SEQ ID NO: 4 from the electrophoresis band comprises:

[0062] Purification and recovery were performed using a PCR product purification kit (QIAGEN, QIAquick PCR Purification Kit (50), 28104). The operation was performed according to the instructions as follows: Add the PCR product to a 2 mL centrifuge tube, add 5 volumes of Buffer PB of the PCR product, and mix well. Place the adsorption column in a 2 mL centrifuge tube, and add the solution mixed in the previous step to the adsorption column, centrifuge at 12000 rpm for 1 min, and discard the filtrate. Place the adsorption column back into the 2 mL centrifuge tube, add 750 μL of Buffer PE to the adsorption column, centrifuge at 12000 rpm for 1 min, and discard the filtrate. Place the adsorption column back into the 2 mL centrifuge tube, centrifuge at 12000 rpm for 1 min again, and discard the filtrate. Place the adsorption column in a clean 1.5 mL centrifuge tube and leave for 5 min. Add 30 μL of Buffer EB (heated to 65°C to improve elution efficiency) to the center of the adsorption column, let stand at room temperature for 1 min, and centrifuge at 12000 rpm for 1 min. Obtain the PCR liquid recovery product. The concentration of the fragment liquid recovery is 126 ng / μL.

[0063] 3. Homologous recombination of the DNA shown in SEQ ID NO: 4 with the PV190 plasmid

[0064] Example: Single enzyme digestion was performed on PV190 plasmid. The enzyme digestion reaction system contained 1 μg PV190 plasmid, 1 μL BamHI, 2 μL 10×KBuffer and the remainder of double distilled water in 20 μL. The enzyme digestion reaction conditions were incubation at 37° C. for 3 h.

[0065] The embodiment also performs homologous recombination reaction on the PV190 fragment cut by enzyme and the DNA shown in SEQ ID NO: 4. The homologous recombination reaction system comprises 2 μL 5×In-Fusion HD Enzyme Premix, 50 ng of PV190 fragment cut by enzyme, 100 ng of DNA shown in SEQ ID NO: 4 and the remainder of double distilled water in 10 μL. The homologous recombination reaction conditions are incubation at 50° C. for 15 min.

[0066] The embodiment also transforms the product of the homologous recombination reaction into Escherichia coli, screens positive clones from the transformants, and extracts a large number of vectors for silencing the CmbHLH93 gene from the culture of the positive clones. Specifically, it includes:

[0067] In the clean bench, take 5 μL of homologous recombination reaction product into 100 μL of E. coli competent DH5α and flick to mix. Ice bath for 5 minutes, heat shock in a 42°C water bath for 90 seconds, and ice bath immediately after the end for 3 minutes. Add 1 mL of LB solution and mix; culture on a shaker at 37°C and 220 rpm for 30 minutes. Evenly spread about 200 μL of transformation bacterial solution on a solid LB+kan plate, seal the plate and invert it in a 37°C incubator for 12 hours. The growing single colony is the positive clone. Pick a single clone plaque from the positive clone and inoculate it into LB+kan liquid culture medium, culture it on a shaker at 37°C and 220 rpm for 12 hours, and send the bacterial solution of the positive clone to Wuhan Hece Biotechnology Co., Ltd. for sequencing and use NCBI for sequence alignment. Correct alignment means that the VIGS silencing vector is successfully constructed. The vector for silencing the CmbHLH93 gene was extracted from the bacterial solution of the positive clone by conventional methods.

[0068] 4. Preparation of Agrobacterium containing vectors for silencing CmbHLH93 gene

[0069] The embodiment also transferred the vector for silencing the CmbHLH93 gene into Agrobacterium GV3101 to obtain Agrobacterium containing the vector for silencing the CmbHLH93 gene. Specifically, it includes:

[0070] Take 2 μL of the vector for silencing the CmbHLH93 gene in the clean bench, add it to 100 μL of GV3101 Agrobacterium competent cells, and flick to mix. After mixing, place in an ice bath for 5 minutes, freeze in liquid nitrogen for 5 minutes, and then quickly place in a 37°C water bath for 5 minutes. Add 700 μL LB medium and culture on a shaker at 28°C and 220 rpm for 3 hours. Centrifuge at 12000 rpm for 1 minute to collect the bacterial solution, discard the supernatant, add 100 μL LB liquid medium to resuspend, mix, and evenly apply it to the solid medium of LB+Kan+rif, and culture in the dark at 28°C for 2 days. Pick out the Agrobacterium monoclonal plaque and shake it with LB+kan+rif liquid for 12 hours, and store the bacterial solution in a -80°C ultra-low temperature refrigerator for later use.

[0071] 5. Infection of melon with Agrobacterium containing the vector for silencing CmbHLH93 gene

[0072] The embodiment also provides a step of infecting melon with Agrobacterium containing a vector for silencing the CmbHLH93 gene. The step comprises:

[0073] 1) Soak the melon seeds in 55°C warm water for 8 hours, and then culture the soaked melon seeds in dark at 28°C for 24 hours for germination.

[0074] 2) Agrobacterium GV3101 containing the vector for silencing the CmbHLH93 gene was cultured in a shaking incubator for 18 h using LB+kan+rif liquid culture medium (the mass percentage of kan was 0.1%, the mass percentage of rif was 0.1%), and the Agrobacterium culture liquid was collected.

[0075] 3) Centrifuge the Agrobacterium culture at 6000 rpm for 8-10 min, and resuspend the precipitate with the MAA resuspension solution described in the table. Pour a little of the prepared MMA solution into the bacteria, shake it by hand, and use MMA as a control to adjust the OD value to 0.4, and treat it in the dark at room temperature for 2-3 hours.

[0076] 4) Spread the melon seeds with a length of about 1 cm in length in a 9 cm culture dish. Pour 30 ml of the above inoculation solution (OD600 = 0.4) into the culture dish. The inoculation solution should just cover the bud eye but not completely submerge the radicle. Culture in the dark at 20°C to 23°C for 24 hours. Then place the inoculated seeds on sterile filter paper to absorb the excess bacterial solution and sow them. After 20 days of sowing, if the melon leaves show photobleaching, it is a positive clone.

[0077] Table 8 MAA resuspension preparation method

[0078] Reagents concentration volume water 500ml <![CDATA[MgCl2]]> 1M 5ml MES 0.5M 10ml AS 20mg / ml 200μL

[0079] In addition, to verify that the melon plants with photobleaching were positive clones, qRT-PCR was also performed to detect whether the expression of CmbHLH93 was indeed reduced. The qRT-PCR detection process includes:

[0080] 1) Extract RNA from melon tissues according to the above example and obtain cDNA by reverse transcription.

[0081] 2) Using qPCR-CmbHLH93-F as shown in SEQ ID NO: 5 and qPCR-CmbHLH93-R as shown in SEQ ID NO: 6 as primer pairs, PCR amplification of cDNA was performed, CmADP was used as the reference gene, and 2- ΔΔCt The relative expression of CmbHLH93 in positive clones and melon plants infected with Agrobacterium containing PV190 empty plasmid was detected by the method. The PCR amplification system contained 0.5 μL 10 μM upstream primer, 0.5 μL 10 μM downstream primer, 1 μL cDNA, 5 μL ChamQUniversal SYBR qPCR Master Mix and the balance of double distilled water in 10 μL. The primers of the reference gene were: CmADP-F (as shown in SEQ ID NO: 7) and CmADP-R (as shown in SEQ ID NO: 8).

[0082] like Figure 2The relative expression level of the CmbHLH93 gene in the positive clone was significantly lower than that in the melon plants infected with Agrobacterium containing the PV190 empty plasmid, indicating that the CmbHLH93 gene was successfully silenced.

[0083] 6. Grafting

[0084] Take the branches and leaves of the positive cloned melon and graft them onto the gourd (one leaf and one heart) rootstock, cover to keep moisture, observe the phenotype, and use the melon plants infected with Agrobacterium containing PV190 empty plasmid as a control. Identify the phenotype of the grafted plants. Figure 3 As shown, from 7 to 21 days after grafting, the CmbHLH93 gene silenced plants grew better and the plant height continued to increase significantly compared with the PV190 empty-load control. Figure 6 It was shown that the CmbHLH93 gene silenced plants were taller at day 21.

[0085] like Figure 4 and Figure 5 As shown, 21 days after grafting, the fresh weight and SPAD value of the scion of the CmbHLH93 gene silenced plants also increased significantly.

[0086] In summary, the vector for silencing the CmbHLH93 gene, the engineered bacteria for silencing the CmbHLH93 gene, the method for silencing the melon CmbHLH93 gene, the method for preparing the melon with silenced CmbHLH93 gene, and the method for grafting melon and gourd provided in the present application can improve the grafting affinity between melon and gourd.

[0087] The above is only a preferred specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed in the present application should be covered within the protection scope of the present application.

Claims

1. A vector for silencing the CmbHLH93 gene, which is a viral vector containing the sequence shown in SEQ ID NO:

1.

2. The vector as claimed in claim 1, wherein the viral vector is a PV190 plasmid.

3. An engineered bacterium for silencing the CmbHLH93 gene, comprising the vector as claimed in claim 1. The engineered bacteria according to claim 1 , which is Agrobacterium containing a vector for silencing the CmbHLH93 gene.

5. A method for silencing the CmbHLH93 gene in melon, comprising the step of introducing the vector as claimed in claim 1 into melon.

6. The method of claim 5, comprising: Infecting melon seeds with Agrobacterium containing a vector for silencing the CmbHLH93 gene; Positive clones were screened from the offspring of the infected melons, which were melons with CmbHLH93 gene silenced.

7. A method for preparing a melon with CmbHLH93 gene silenced, comprising: Prepare the carrier as claimed in claim 1; The vector is transferred into Agrobacterium to obtain an engineered bacterium with a silenced CmbHLH93 gene; transferring the engineered strain into melon seeds for infection; Positive clones were screened from the offspring of the infected melons, which were melons with CmbHLH93 gene silenced.

8. The method of claim 7, wherein the preparation of the carrier of claim 1 comprises: The DNA shown in SEQ ID NO: 4 was subjected to homologous recombination reaction with PV190 plasmid.

9. The method according to claim 8, wherein the homologous recombination reaction system comprises, in 10 μL, 2 μL 5×In-FusionHD Enzyme Premix, 50 ng of the enzyme-cut PV190 fragment, 100 ng of the DNA shown in SEQ ID NO: 4, and the remainder of double distilled water. 10.Melon and gourd grafting method, comprising: Prepare the melon with CmbHLH93 gene silenced by the method according to claim 7 or 8; Obtain branches or buds of the melon as scions; as well as The stem or root of the bottle gourd is obtained as a rootstock and the scion and the rootstock are grafted.

Images