Method for improving citrus yellow vein disease resistance by using ClLHCP gene

Abstract

The invention relates to the technical field of agricultural biological genes, and discloses a method for improving citrus yellow vein disease resistance by using a ClLHCP gene, which comprises the following steps: (1) cloning a VIGS fragment of the citrus ClLHCP gene; (2) constructing two VIGS expression vectors of TRV and CLBV; and (3) transforming the citrus by the VIGS expression vector to obtain a citrus ClLHCP gene silenced VIGS plant. According to the invention, the VIGS vector of the Citrus ClLHCP gene is constructed, and then the Citrus is transformed, so that the obtained Citrus plant can show obvious resistance to the Citrus yellow vein disease, the titer of the Citrus yellow vein clearing virus can be reduced by 47%, the attack degree of the Citrus yellow vein disease is obviously reduced, and the TRV silencing of the Citrus ClLHCP gene does not influence the phenotype of the Citrus plant; the gene can be used as a candidate gene to carry out citrus yellow vein disease resistance breeding together with a plurality of citrus yellow vein disease-resistant and susceptible genes by utilizing the cooperation of VIGS silencing, RNA interference, gene editing and other technologies, and has important application value for citrus yellow vein clearing virus-resistant breeding of citrus.

Description

Technical Field

[0001] The present invention relates to the field of agricultural biological gene technology, and in particular to a method for improving resistance to citrus yellow vein disease by utilizing the ClLHCP gene. Background Art

[0002] Citrus yellow vein clearing disease (CYVCD) is a new disease that seriously harms citrus. Its pathogen is citrus yellow vein clearing virus (CYVCV), which can infect most citrus varieties, causing symptoms such as clear leaf veins and yellow and mottled leaves, leading to tree weakness and reduced yields, which seriously threatens citrus industries such as lemons. When citrus is infected by the disease, the tree will weaken and the yield will drop sharply. Therefore, strengthening research on the prevention and control of citrus yellow vein clearing virus is an urgent need for the development of the citrus industry. At present, the prevention and control of citrus yellow vein disease is relatively difficult, and there is a lack of effective prevention and control agents. Preventive measures such as strict quarantine and strengthened management are the main ones.

[0003] In recent years, research on CYVCV has focused on transmission routes and detection techniques, but its pathogenic mechanism and the mechanism by which host plants respond to infection are still unclear. Studies have shown that chloroplasts in lemon leaf tissues infected with CYVCV appear swollen and deformed, the grana are arranged in disorder, the chloroplast membrane is dissolved, and in severe cases, the chloroplasts disintegrate. Chloroplasts and their chloroplast-associated proteins play a vital role in defending against viral infection. There is an interaction between proteins encoded by plant viruses and chloroplast-associated proteins, which use chloroplasts and their related components to assist in the proliferation and movement of viruses. At the same time, chloroplast proteins can also synthesize certain defense signal molecules to resist viral invasion. Studies have shown that viruses can interfere with the photochemical reactions of host plants by interfering with the abundance of important proteins in the electron transport chain. In this process, the three important targets of the virus are the light-harvesting chlorophyll a / b binding proteins (LHC), the core subunits of photosystem I (PS I) and photosystem II (PS II), and the external proteins of oxygen evolution and NADP. ＋Reductase. Among them, LHC family proteins are critical in the initial steps of photosynthesis. They effectively capture photons and absorb light energy by forming a complex structure in the photosynthetic membrane and quickly transfer the energy to the photoreaction center to start the photochemical reaction. Previously, researchers used RNA-seq technology to detect changes in gene transcripts of Eureka lemon and Simons sweet orange infected with CYVCV. They found that the expression of photosynthetic photosystem I and photosystem II proteins in the CYVCV-sensitive variety Eureka lemon was mostly significantly downregulated, photosynthesis was blocked and the thylakoids were damaged, while the light-harvesting complex chlorophyll a / b binding proteins (LHCB3, LHCB2, LHB1B1) in the CYVCV-resistant variety Simons sweet orange were all upregulated, and it was speculated that they play an active role in the defense response in plant-virus interactions.

[0004] LHC is divided into LHCI associated with PS I and LHCII associated with PS II. In higher plants, LHCI contains four proteins, LHCA1-4, and LHCII contains six proteins, LHCB1-6. Among them, light-harvesting chlorophyll A / B binding protein 151 (LHCP) is the LHCB2 protein in PSII. Studies have shown that when LHCB1 and LHCB2 are missing, the light absorption of plant leaves is reduced, photosynthesis decreases, growth and development are affected, and seed yield decreases. When Nicotiana benthamiana is infected with potato virus X (PVX), Kunitz-type protease inhibitor protein (KPILP), as a regulator of the chloroplast retrograde signaling system, can downregulate the expression of LHCB1 and LHCB2 genes and participate in antiviral immune responses. However, there are few studies on LHC family proteins in citrus, and the role of LHCP in disease infection has not been reported. There is no research and application on using tobacco rattlevirus (TRV)-mediated ClLHCP silencing to improve citrus resistance to citrus yellow vein disease.

[0005] In view of this, this application is hereby filed. Summary of the invention

[0006] The present invention provides a method for improving the resistance of citrus to yellow vein disease by using the ClLHCP gene. The method comprises the following steps: transferring a VIGS vector of the citrus ClLHCP gene into citrus and reducing the transcription level of the citrus ClLHCP, thereby significantly improving the resistance of citrus to the citrus yellow vein disease and reducing the incidence of the citrus yellow vein disease. The method has great application value in citrus breeding and can be used as a candidate gene for resistance breeding together with multiple citrus yellow vein virus resistance and susceptibility genes.

[0007] The present invention is achieved through the following technical solutions: A method for improving resistance to citrus yellow vein disease by using the ClLHCP gene, wherein the resistance of citrus plants to citrus yellow vein disease is improved by regulating the expression level of the ClLHCP gene in citrus plants, wherein the nucleotide sequence of the ClLHCP gene is shown in SEQ ID NO: 1.

[0008] In a specific embodiment, the specific method for regulating the expression level of the ClLHCP gene is: down-regulating the expression level of the ClLHCP gene in citrus plants.

[0009] In a specific embodiment, the specific method of down-regulating the expression level of the ClLHCP gene in citrus plants is: using VIGS silencing technology to reduce the expression level of the ClLHCP gene.

[0010] In a specific implementation, the steps include: (1) Cloning of the VIGS fragment of the citrus ClLHCP gene; (2) Construction of VIGS expression vector; (3) The VIGS expression vector was used to transform citrus to obtain VIGS plants in which the ClLHCP gene of citrus was silenced.

[0011] In a specific embodiment, in step (1), the cloning method of the VIGS fragment of the citrus ClLHCP gene is: extracting total RNA from citrus, reverse transcribing it into cDNA, and using the cDNA as a template to amplify the VIGS fragment of the citrus ClLHCP gene using high-fidelity enzyme PCR.

[0012] In a specific embodiment, the nucleotide sequence of the VIGS fragment of the citrus ClLHCP gene is shown in SEQ ID NO: 2.

[0013] In a specific embodiment, in step (1), the primers used for PCR amplification are ClLHCP-VIGS-F and ClLHCP-VIGS-R, and their nucleotide sequences are SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

[0014] In a specific embodiment, in step (2), the method for constructing the VIGS expression vector is as follows: the VIGS fragment of the citrus ClLHCP gene obtained in step (1) is digested with Xba I and Sca I, recovered, connected with the TRV2 vector digested with the same enzymes and transformed into Escherichia coli competent cells, and the plasmid is extracted to obtain the VIGS expression vector of the ClLHCP gene.

[0015] In a specific embodiment, in step (3), the method for transforming citrus with the VIGS expression vector is: transforming the VIGS expression vector obtained in step (2) into Agrobacterium, preparing an Agrobacterium liquid containing the VIGS expression vector, infecting sterile citrus seedlings, and obtaining VIGS plants in which the ClLHCP gene of citrus is silenced.

[0016] In a specific embodiment, the VIGS plants are verified by PCR, and the primers used are TRV2-ClLHCP Detection-F and TRV2-ClLHCP Detection-R, whose nucleotide sequences are SEQ ID NO: 7 and SEQ ID NO: 8, respectively.

[0017] In a specific embodiment, after the VIGS plants are obtained in step (3), the VIGS plants are evaluated for resistance to citrus yellow vein virus to determine whether silencing the citrus ClLHCP gene can enhance resistance to citrus yellow vein virus.

[0018] Compared with the prior art, the present invention has the following advantages and beneficial effects: 1. A method for improving resistance to citrus yellow vein disease by using the ClLHCP gene provided in an embodiment of the present invention, by constructing a VIGS vector of the citrus ClLHCP gene, and then transforming citrus to reduce the transcription level of ClLHCP, the obtained citrus plants can show obvious resistance to citrus yellow vein disease, and the titer of citrus yellow vein virus can be reduced by 47%, significantly reducing the incidence of citrus yellow vein disease; 2. A method for improving resistance to citrus yellow vein disease by using the ClLHCP gene provided in an embodiment of the present invention can significantly reduce the incidence of citrus yellow vein disease and improve the resistance of citrus to yellow vein disease by VIGS silencing of the ClLHCP gene in citrus, and TRV silencing of the ClLHCP gene in citrus will not affect the phenotype of citrus plants; 3. An embodiment of the present invention provides a method for improving the resistance to citrus yellow vein disease by utilizing the ClLHCP gene. By silencing the ClLHCP gene, the resistance of citrus plants to yellow vein disease can be greatly improved, which has great application value for breeding citrus plants resistant to citrus yellow vein disease. The ClLHCP gene can be used as a candidate gene to collaborate with multiple citrus yellow vein disease-resistant and -susceptible genes to carry out breeding for citrus yellow vein disease resistance using VIGS silencing, RNA interference, gene editing and other technologies. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the drawings required for use in the embodiments will be briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without paying creative work.

[0020] Figure 1 The conserved domain of citrus C1LHCP provided in the embodiments of the present invention; Figure 2 The subcellular localization prediction of citrus ClLHCP provided in the embodiments of the present invention; Figure 3 The transmembrane region prediction of citrus C1LHCP provided in the embodiment of the present invention; Figure 4 The protein secondary structure prediction of citrus ClLHCP provided in the embodiment of the present invention; Figure 5 The electrophoresis diagram of PCR amplification of the VIGS fragment of the citrus ClLHCP encoding gene provided in the embodiment of the present invention: VIGS represents the RNAi fragment of the ClLHCP encoding gene inserted into the viral vector; M represents the DNA molecular weight standard, the same below; Figure 6 The structure diagram of the VIGS vector of citrus ClLHCP provided in the embodiment of the present invention: GFP, green fluorescent protein; RdRp, RNA-dependent RNA polymerase; CP, coat protein; 35S, plant constitutive promoter derived from cauliflower mosaic virus; NOS, opine synthase gene terminator; LB, left homology arm; RB, right homology arm; Figure 7 VIGS plant PCR identification diagram provided in the embodiment of the present invention: M, molecular weight standard; detection result diagram of two vectors TRV2-GFP and TRV2-ClLHCP; the detection primer is the universal primer for TRV1 detection, the band size is 700bp, and the detection TRV vector successfully infiltrates the plant; Figure 8 qRT-PCR detection diagram of ClLHCP expression in VIGS plants provided in the embodiment of the present invention: TRV2-GFP, negative control plants (the same below); TRV2-ClLHCP, plants transformed with VIGS vector of ClLHCP (the same below); **, *** indicate significant differences P<0.01, P<0.001, respectively (the same below); Fig. 9 The VIGS plant phenotype diagram provided by the embodiment of the present invention; Fig.10 The disease condition of the VIGS plant leaves provided in the embodiment of the present invention after 9 days of inoculation with the citrus yellow vein virus; Fig.11 The virus titer of the VIGS plant leaves inoculated with Citrus Yellow Vein Virus 20 days after the implementation of the present invention is determined. DETAILED DESCRIPTION

[0021] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments and drawings. The exemplary embodiments of the present invention and their description are only used to explain the present invention and are not intended to limit the present invention.

[0022] Example 1 Bioinformatics analysis of citrus ClLHCP like Figure 1-Figure 4 As shown, InterPro (https: / / www.ebi.ac.uk / interpro / ) was used to predict the conserved domain of ClLHCP; WoLFPSORT (https: / / wolfpsort.hgc.jp / ) was used to predict the subcellular localization of ClLHCP; TMHMM (https: / / services.healthtech.dtu.dk / services / TMHMM-2.0 / ) was used to predict the transmembrane region of ClLHCP; and predictProtein (https: / / open.predictprotein.org / ) was used to predict the protein secondary domain of ClLHCP.

[0023] The nucleotide sequence of C1LHCP gene is SEQ ID NO: 1: ATGGCAACCTCTGCTATCCAACAATCAGCATTTGCTGGCCAGACCGCCTTGAGGCAATCCAATGAGTTTGTCCGCAAGGTTGGAGTTGCTGACGGTGGCCGTATCACCATGAGGAGGACTGTCAAATCCGCTCCCCAGAGCATCTGGTACGGCCCAGACCGCCCAAAGTACTTGGGACCATTCTCTGAGCAAACACCAT CATACTTGACTGGTGAGTTCCCTGGTGACTATGGCTGGGATACCGCTGGTTTATCAGCAGACCCCGAGACATTTGCTAAGAACCGTGAGCTAGAGGTGATCCACAGCAGATGGGCAATGCTTGGAGCTCTTGGCTGCGTCTTCCCTGAAATCCTCTCCAAGAATGGAGTGAAGTTCGGCGAAGCAGTTTGGTTCAAGGCT GGCGCTCAAATATTCTCTGAAGGTGGCCTTGACTATTCTGGCAACCCCAACCTCATTCATGCTCAGAGCATTTTGGCTATCTGGGCCTGCCAGGTTGTGCTTATGGGTTTTGTTGAAGGATACAGAATTGGTGGCGGTCCTTGGTGAAGGACTTGACCCACTTTACCCTGGTGGTGCTTTTGACCCACTTGGTTTGG CTGATGACCCCGATCAATTTGCTGAGTTGAAGGTCAAGGAGCTCAAGAATGGCCGTCTGGCTATGTTCTCCATGTTTGGATTCTTTGTTCAGGCTATTGTCACTGGGAAGGGTCCAATTGAGAACCTCTACGACCACATTGCTGATCCTGTGGCCAACAATGCCTGGGCTTATGCCACTAACTTTGTTCCCGGAAAGTGA

[0024] Example 2 This embodiment provides a method for improving resistance to citrus yellow vein disease by using the ClLHCP gene, which reduces the expression level of the ClLHCP gene in citrus plants by using VIGS silencing technology to improve the resistance of citrus plants to citrus yellow vein disease, and specifically includes the following steps: (1) The VIGS fragment of the citrus ClLHCP gene was cloned as follows: 1. RNA Extraction and cDNA Synthesis Total RNA was extracted from citrus (Eureka lemon) leaves using the CTAB method, and its concentration was measured using a concentration meter. cDNA was synthesized using a reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT: RR036A), and the cDNA was stored at -20°C for future use.

[0025] 2. VIGS fragment amplification The VIGS fragment of the ClLHCP encoding gene was cloned from citrus cDNA using primers ClLHCP-VIGS-F (SEQ ID NO: 3) and ClLHCP-VIGS-R (SEQ ID NO: 4) using the high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q). The length of the fragment was determined using the SGN-VIGS website and was 300 bp (SEQ ID NO: 2) (as Figure 5 Under ultraviolet light, cut the agarose gel block containing the target fragment with a clean blade, and use a kit (BioFlux, CAT: BSC02M1) to recover the DNA fragment.

[0026] PCR amplification program: 98°C, 3 min; 98°C, 10 s, 55°C, 30 s, 72°C, 15 s, 35 cycles; extension at 72°C for 10 min.

[0027] Nucleotide sequence of the VIGS fragment of Citrus C1LHCP gene SEQ ID NO: 2: ATGGCAACCTCTGCTATCCAACAATCAGCATTTGCTGGCCAGACCGCCTTGAGGCAATCCAATGAGTTTGTCCGCAAGGTTGGAGTTGCTGACGGTGGCCGTATCACCATGAGGAGGACTGTCAAATCCGCTCCCCAGAGCATCTGGTAC GGCCCAGACCGCCCAAAGTACTTGGGACCATTCTCTGAGCAAACACCATCATACTTGACTGGTGAGTTCCCTGGTGACTATGGCTGGGATACCGCTGGTTTATCAGCAGACCCGAGACATTTGCTAAGAACCGTGAGCTAGAGGTGATC The nucleotide sequence of primer ClLHCP-VIGS-F is SEQ ID NO: 3: AAGGTTACCGAATTCTCTAGAATGGCAACCTCTGCTATCCAAC The nucleotide sequence of primer ClLHCP-VIGS-R is SEQ ID NO: 4: GGCCTCGAGACGCGTGAGCTCGATCACCTCTAGCTCACGGTTCTT (2) Construction of VIGS expression vector, as follows: The VIGS vector TRV2 was digested with Xba I and Sca I, and the two fragments were recovered by gel. Then, the two fragments were connected by homologous recombination and transformed into Escherichia coli competent cells. The plasmid was extracted to obtain the VIGS expression vector TRV2-ClLHCP (eg Figure 6 As shown). Among them, GFP: green fluorescent protein; RdRp: RNA-dependent RNA polymerase; CP: coat protein; 35S: plant constitutive promoter from cauliflower mosaic virus; NOS: opine synthase gene terminator; LB: left homology arm; RB: right homology arm. The vector TRV2-ClLHCP was transformed into Agrobacterium by electroporation to prepare the Agrobacterium bacterial solution containing the VIGS expression vector of the ClLHCP gene.

[0028] (3) The VIGS expression vector was used to transform citrus to obtain VIGS plants in which the ClLHCP gene of citrus was silenced, as follows: 1. Activation of Agrobacterium tumefaciens Take 500 μL TRV1, 500 μL TRV2-GFP (negative control), and 500 μL TRV2-ClLHCP Agrobacterium culture liquid and add them to 50 mL liquid LB medium (containing 50 mg / L kanamycin and 20 mg / L rifampicin antibiotics) and culture at 28°C and 200 r / min until OD 600 =1; resuspend in MMA (10 mM MgCl2, 10 nM MES, 100 μM acetosyringone) liquid and adjust OD 600 =1.0; TRV1 was mixed with TRV2-GFP and TRV2-ClLHCP vectors at a volume ratio of 1:1, and incubated at room temperature in the dark for 1 h.

[0029] 2. Agrobacterium infection Immerse sterile seedlings with radicles growing to 3 cm in Agrobacterium solution and evacuate with a vacuum pump for 1 min; rinse with sterile water 3 to 5 times, insert into seed culture medium and culture in the dark at room temperature for 2 to 3 days. If green fluorescence is observed, it is a positive seedling, which is transferred to soil for culture at 25°C with a light / dark cycle of 16 h / 8 h and watered regularly to obtain VIGS plants with silenced citrus ClLHCP gene.

[0030] Example 3 Identification and phenotypic observation of VIGS plants 1. PCR Identification One month later, tissues were collected to extract total RNA, and PCR verification was performed using two pairs of primers, TRV2-GFP detection-F (SEQ ID NO: 5) / TRV2-GFP detection-R (SEQ ID NO: 6) and TRV2-ClLHCP detection-F (SEQ ID NO: 7) / TRV2-ClLHCP detection-R (SEQ ID NO: 8): The primer pairs TRV2-GFP detection-F / R and TRV2-ClLHCP detection-F / R could amplify bands of about 700 bp in TRV2-GFP and TRV2-ClLHCP positive plants, respectively (e.g. Figure 7 As shown). Among them, 8 plants of TRV1 and TRV2-GFP negative control were successfully infiltrated with TRV vector, and 6 plants with CYVCV were successfully infiltrated and produced CYVCV symptoms; 5 plants of TRV1 and TRV2-ClLHCP were successfully infiltrated, and 7 plants with CYVCV bacterial solution were successfully infiltrated with TRV vector. M: DNA Marker.

[0031] PCR reaction conditions: 98°C, 3 min; 98°C, 10 s, 55°C, 30 s, 72°C, 15 s, 35 cycles; extension at 72°C for 10 min.

[0032] The nucleotide sequence of primer TRV2-GFP detection-F is SEQ ID NO: 5: TGGTCAAGGTACGTAGTAGAGTCCCA The nucleotide sequence of primer TRV2-GFP detection-R is SEQ ID NO: 6: CTCGTCAGTGTACTGATATAAG The nucleotide sequence of primer TRV2-C1LHCP detection-F is SEQ ID NO: 7: CAATGCACGAATTACTTAGGAAGTG The nucleotide sequence of primer TRV2-C1LHCP detection-R is SEQ ID NO: 8: CGTCTGTACTTATATCAGTACACTG

[0033] 2. qRT-PCR Analysis Primers ClLHCP-RT-F (SEQ ID NO: 9) and ClLHCP-RT-R (SEQ ID NO: 10) were used for qRT-PCR to verify whether ClLHCP was successfully silenced. The gene expression level of TRV1 and TRV2-GFP vector plants was set to 1. If the ClLHCP gene expression level of the plant containing the target fragment vector was less than 1, gene silencing occurred. Three sets of parallel samples were set for each of the TRV2-GFP and TRV2-ClLHCP vector plants of the present application. After identification, the expression levels of ClLHCP gene in TRV2-GFP vector plants were 0.982275826, 0.944953697, and 0.976551247, respectively; in TRV2-ClLHCP vector plants, the expression levels of ClLHCP gene were 0.428040660, 0.540331993, and 0.370893771, respectively. The transcription level of ClLHCP in TRV2-ClLHCP vector plants decreased by 44% (e.g. Figure 8 as shown).

[0034] qRT-PCR reaction conditions: 95°C for 3 min, 95°C for 15 s; 60°C for 15 s, 72°C for 15 s, 40 cycles.

[0035] The nucleotide sequence of primer ClLHCP-RT-F is SEQ ID NO: 9: CAGTTTGGTTCAAGGCTGGC The nucleotide sequence of primer ClLHCP-RT-R is SEQ ID NO: 10: GGACCGCCACCAATTCTGTA

[0036] 3. Phenotypic Observation The phenotype of the VIGS plants expressing the ClLHCP gene was observed, and no obvious abnormalities were found in appearance and growth (e.g. Fig. 9 This indicates that silencing of ClLHCP did not significantly affect the phenotype and development of the plant.

[0037] Example 4 Evaluation of resistance of VIGS plants After silencing the ClLHCP gene for 30 days, three plants were selected for injection and inoculation with Citrus Yellow Vein Virus, and three plants were inoculated with empty vector control, i.e., TRV2-GFP and TRV2-ClLHCP vector plants, and three groups of parallel samples were set up.

[0038] 1. Phenotypic Observation Because CYVCV usually causes disease 7-10 days after seedling inoculation, this application observed symptoms 9 days after inoculation, and set up three groups of parallel samples for TRV2-GFP and TRV2-ClLHCP vector plants. It was found that the leaves of plants with ClLHCP gene silenced and inoculated with CYVCV showed less yellowing (local mesophyll cells yellowing, not the whole leaf yellowing) and veins than those of the control group (such as Fig.10 as shown).

[0039] 2. Virus titer detection In this application, 20 days after the VIGS plant leaves were inoculated with Citrus Yellow Vein Virus, qRT-PCR was performed using primers CYVCV CP-RT-F (SEQ ID NO: 11) and CYVCV CP-RT-R (SEQ ID NO: 12) to verify the titer of Citrus Yellow Vein Virus. Because the leaves were too small 9 days after inoculation and did not reach the sampling volume, and TRV silencing may lose its effect in about 45 days, this application detected the virus content when the leaf volume reached 20 days and within the TRV silencing time. Three sets of parallel samples were set for each TRV2-GFP and TRV2-ClLHCP vector plant in this application. After identification, the accumulation of CYVCV in TRV2-GFP vector plants was 0.889062476, 1.105953210, and 1.004984314, respectively, and in TRV2-ClLHCP vector plants, the accumulation of CYVCV was 0.446031281, 0.431400014, and 0.548797722, respectively. Therefore, the accumulation of CYVCV in ClLHCP-silenced plants was significantly lower than that in TRV2-GFP-infiltrated plants, and the virus content decreased by 47% (e.g. Fig.11 as shown).

[0040] The nucleotide sequence of primer CYVCV CP-RT-F is SEQ ID NO: 11: TCCAACTCACAAACCCAGCG The nucleotide sequence of primer CYVCV CP-RT-R is SEQ ID NO: 12: ATGGGCTCTTGGTTTTCCTT It can be seen that the interference of ClLHCP can greatly reduce the accumulation of citrus yellow vein virus and alleviate the incidence of citrus yellow vein disease. This gene can be used independently for disease resistance molecular breeding, or it can be used together with other disease resistance or disease susceptibility genes for citrus yellow vein disease resistance molecular breeding.

[0041] The specific implementation methods described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above description is only a specific implementation method of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A method for improving resistance to citrus yellow vein disease using the C1LHCP gene, characterized in that: The expression level of the ClLHCP gene in citrus plants is reduced by adopting VIGS silencing technology, thereby improving the resistance of citrus plants to citrus yellow vein disease. The nucleotide sequence of the ClLHCP gene is shown in SEQ ID NO:

1.

2. The method for improving resistance to citrus yellow vein disease using the C1LHCP gene according to claim 1, characterized in that: The specific steps include: (1) Cloning of the VIGS fragment of the citrus ClLHCP gene; (2) Construction of VIGS expression vector; (3) The VIGS expression vector was used to transform citrus to obtain VIGS plants in which the ClLHCP gene of citrus was silenced.

3. The method for improving resistance to citrus yellow vein disease using the C1LHCP gene according to claim 2, characterized in that: In step (1), the cloning method of the VIGS fragment of the citrus ClLHCP gene is: extracting total RNA from citrus, reverse transcribing it into cDNA, and using the cDNA as a template to amplify the VIGS fragment of the citrus ClLHCP gene using high-fidelity enzyme PCR.

4. The method for improving resistance to citrus yellow vein disease using the C1LHCP gene according to claim 3, characterized in that: The nucleotide sequence of the VIGS fragment of the citrus ClLHCP gene is shown in SEQ ID NO:

2.

5. The method for improving resistance to citrus yellow vein disease using the C1LHCP gene according to claim 4, characterized in that: In step (1), the primers used for PCR amplification are ClLHCP-VIGS-F and ClLHCP-VIGS-R, whose nucleotide sequences are SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

6. The method for improving resistance to citrus yellow vein disease using the C1LHCP gene according to claim 3, characterized in that: In step (2), the method for constructing the VIGS expression vector is as follows: the VIGS fragment of the citrus ClLHCP gene obtained in step (1) is digested with XbaI and ScaI, recovered, connected with the TRV2 vector digested with the same enzymes, and transformed into Escherichia coli competent cells, and the plasmid is extracted to obtain the VIGS expression vector of the ClLHCP gene.

7. The method for improving resistance to citrus yellow vein disease using the C1LHCP gene according to claim 3, characterized in that: In step (3), the method for transforming citrus with the VIGS expression vector is as follows: the VIGS expression vector obtained in step (2) is transformed into Agrobacterium, an Agrobacterium liquid containing the VIGS expression vector is prepared, and the Agrobacterium liquid is infected with sterile citrus seedlings to obtain VIGS plants in which the ClLHCP gene of citrus is silenced.

8. The method for improving resistance to citrus yellow vein disease using the C1LHCP gene according to claim 7, characterized in that: The method also includes verifying the VIGS plants by PCR, using primers TRV2-ClLHCP Detection-F and TRV2-ClLHCP Detection-R, whose nucleotide sequences are SEQ ID NO: 7 and SEQ ID NO: 8, respectively.

Images