Method for preparing baohuoside I through whole-cell biotransformation of icariin and application of baohuoside I

Abstract

The invention discloses a method for preparing baohuoside I through whole-cell biotransformation of icariin and application of the baohuoside I, and belongs to the technical field of baohuoside I preparation. By adopting the preparation method provided by the invention, the purity and yield of the target product are high, the yield of baohuoside I is 90.0%, and the purity reaches 93.2%; the provided thermophilic beta-D-glucosidase PfBgl engineered escherichia coli can be used as a biocatalyst for whole-cell biotransformation of baohuoside I; the provided biocatalyst can be repeatedly and circularly used for multiple times, the influence of multiple times of recycling on the conversion rate is small, and the bioconversion cost of baohuoside I can be greatly reduced; reaction conditions are mild, energy consumption and cost are low, and by-products are few; the preparation method is high in safety, does not involve strong acid, strong alkali and heavy metal in the reaction process, reduces the use and emission of harmful substances, and is environment-friendly, green, pollution-free, low-carbon and environment-friendly.

Description

Technical Field

[0001] The present invention relates to the technical field of preparation of baohuoside I, and in particular to a method for preparing baohuoside I by whole-cell biotransformation of icariin and application thereof. Background Art

[0002] Epimedium is one of the important and commonly used tonic Chinese medicines. It was first recorded in Shennong's Herbal Classic. It has the effects of tonifying the kidney and strengthening yang, strengthening muscles and bones, and removing rheumatism. Its main biologically active ingredients are icariin, icariin A, icariin C, baohuoside I and icariin, etc. The composition of baohuoside I is very weak, but baohuoside I not only has pharmacological effects similar to icariin, but also has anti-tumor, anti-prostate cancer, anti-neuritis, and osteoporosis treatment effects. It has a wider pharmacological activity than icariin, and the in vivo bioavailability of baohuoside I is also better than that of icariin. Therefore, it is of great significance to seek a method for the efficient preparation of baohuoside I for its further application.

[0003] According to existing research, the main methods for preparing bahuoside I are acid hydrolysis and enzymatic conversion. However, the acid hydrolysis of icariin often produces undesirable dehydrated aglycones, causing serious environmental pollution, and the enzymatic hydrolysis method is cumbersome and time-consuming. In recent years, with the continuous development of biotechnology, the use of whole-cell biotransformation to transform natural products into high-value compounds has become a research hotspot. The whole-cell biotransformation method uses intact cells or even individuals to complete the metabolic pathway, avoiding the need for cell lysis and purification, and the cells can be reused, greatly reducing the production cost. However, there is no report on the use of whole-cell biotransformation to transform icariin into bahuoside I. Summary of the invention

[0004] The purpose of the present invention is to provide a method for preparing baohuoside I by whole-cell biotransformation of icariin and its application, so as to provide a method for preparing baohuoside I which improves the purity and yield of the target product, is low in cost and is environmentally friendly.

[0005] To achieve the above-mentioned purpose, the present invention provides the use of thermophilic β-D-glucosidase PfBgl Escherichia coli engineering bacteria in the whole-cell biotransformation of icariin to prepare bajuoside I. The preparation method of the thermophilic β-D-glucosidase PfBgl Escherichia coli engineering bacteria is as follows: synthesize the codon-optimized PfBgl gene sequence, then clone it into the pET-28a vector by seamless cloning technology, and transform the recombinant plasmid pET28a-PfBgl with verified correct gene sequence into Escherichia coli BL21 (DE3).

[0006] Preferably, the thermophilic β-D-glucosidase PfBgl Escherichia coli engineered bacteria is used as the biocatalyst in the whole-cell biotransformation of icariin to prepare baohuoside I.

[0007] A method for preparing baohuoside I by whole-cell bioconversion of icariin, using thermophilic β-D-glucosidase PfBgl Escherichia coli engineered bacteria as a biocatalyst, the steps are as follows:

[0008] S1. Prepare a reaction system including pH 6.050 mM phosphate buffer, 3.33 mM icariin solution, and 20 mg / mL thermophilic β-D-glucosidase PfBgl Escherichia coli engineered bacteria resuspension;

[0009] S2. The reaction system was reacted at 37°C and 200 rpm. After the reaction was completed, the supernatant was discarded by centrifugation, methanol was added to dissolve the precipitate, the supernatant was collected by centrifugation, the methanol was rotary evaporated at 50°C, and then dried at 45°C to obtain Baohuoside I.

[0010] Preferably, in the reaction system of step S1, the volume ratio of phosphate buffer: icariin solution: thermophilic β-D-glucosidase PfBgl Escherichia coli engineered bacteria resuspension is 13:6:1.

[0011] Preferably, the icariin solution in step S1 is prepared by dissolving icariin in hot methanol.

[0012] Preferably, in step S2, the reaction system is reacted at 37° C. and 200 rpm for 40-240 min, and the centrifugation conditions are 35° C. and 8000 rpm for 30 min.

[0013] Preferably, the preparation method of the thermophilic β-D-glucosidase PfBgl Escherichia coli engineering bacteria resuspension in step S1 is:

[0014] S11, carry out seed liquid culture, use 2×YT medium to culture overnight at 37°C and 210rpm;

[0015] S12, expand the culture, use 2×YT medium to culture at 37°C, 180rpm until the bacterial solution OD 600 0.9-1.0;

[0016] S13, IPTG-induced expression, after adding IPTG, the expression was induced at 16°C and 180 rpm overnight;

[0017] S14, 4°C, 8000 rpm centrifugation for 10 min to obtain the precipitate, and resuspend it in pH 8.0 50 mM phosphate buffer.

[0018] Preferably, the 2×YT culture medium in step S11 and step S12 contains 50 μg / mL kanamycin sulfate, and the inoculation amount is 1% by volume.

[0019] Preferably, the final concentration of IPTG in step S13 is 0.5 mM.

[0020] A method for preparing baohuoside I by whole-cell biotransformation of icariin as described above is used in the preparation of baohuoside I.

[0021] Therefore, the present invention provides a method for preparing baohuoside I by whole-cell biotransformation of icariin and its application, and its specific technical effects are as follows:

[0022] (1) The yield of baohuoside I in the preparation method provided by the present invention is 90.0%, and the purity is 93.2%, indicating that the use of thermophilic β-D-glucosidase PfBgl Escherichia coli engineered bacteria as a biocatalyst for whole-cell biotransformation of icariin to prepare baohuoside I has high catalytic efficiency and will not hinder the biotransformation of icariin, and can be used for the preparation of whole-cell biotransformation of baohuoside I;

[0023] (2) The biocatalyst used in the preparation method provided by the present invention can be repeatedly recycled and reused, and the multiple recycling has little effect on the conversion rate, which can greatly reduce the bioconversion cost of Baohuoside I;

[0024] (3) The preparation method provided by the present invention has mild reaction conditions and is usually carried out at room temperature and pressure, which can reduce energy consumption and equipment costs, reduce the generation of by-products, and improve the purity and yield of the target product;

[0025] (4) The preparation method provided by the present invention is highly safe, and the reaction process does not involve strong acids, strong bases, and heavy metals, thereby reducing the use and emission of harmful substances. It is environmentally friendly, green, pollution-free, and low-carbon. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0027] Figure 1 This is the molecular structure diagram of icariin and baohuoside I;

[0028] Figure 2 The thermophilic β-D-glucosidase PfBgl Escherichia coli engineering bacteria recombinant plasmid map constructed in Example 1 of the present invention;

[0029] Figure 3 This is a standard curve diagram of icariin ((A)) and baohuoside I ((B)) detected by high performance liquid chromatography in Example 1 of the present invention;

[0030] Figure 4 This is a curve diagram showing the conversion rate of icariin to baohuoside I in whole-cell bioconversion in Example 2 of the present invention as a function of cell concentration;

[0031] Figure 5 This is the HPLC spectrum of the whole-cell bioconversion of icariin to baohuoside I in Example 3 of the present invention;

[0032] Figure 6 This is a curve diagram showing the change in conversion rate of icariin to baohuoside I in whole-cell bioconversion in Example 3 of the present invention as a function of reaction time;

[0033] Figure 7 This is a bar graph showing the conversion rate of icariin to baohuoside I in whole-cell bioconversion in Example 4 of the present invention as a function of the number of cell cycles;

[0034] Figure 8 This is a bar graph showing the conversion rate of icariin to baohuoside I in whole-cell bioconversion in Example 5 of the present invention as a function of the methanol concentration in the heavy suspension of the bacterial cells;

[0035] Fig. 9 This is a bar graph showing the conversion rate of icariin to baohuoside I in the whole-cell bioconversion in Example 6 of the present invention as a function of the methanol concentration in the reaction system;

[0036] Fig.10 This is a curve diagram showing the change in conversion rate of icariin to baohuoside I during whole-cell bioconversion as a function of reaction time when the amplified reaction system is 1 L in Example 7 of the present invention;

[0037] Fig.11 This is the Baohuoside I powder prepared by the enlarged process in Example 7 of the present invention. DETAILED DESCRIPTION

[0038] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0039] In order to make the purpose, technical scheme and advantages of the present application clearer, more thorough and more complete, the technical scheme of the present invention is clearly and completely described below through the accompanying drawings and examples. The following detailed descriptions are all descriptions of the embodiments, and are intended to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the present application belongs.

[0040] The instruments, equipment, reagents and materials used in the examples were all obtained through commercial channels, wherein icariin was chromatographically pure with a purity of ≥96%.

[0041] Embodiment 1

[0042] A whole-cell biocatalyst for preparing baohuoside I by biotransforming icariin using whole-cell Escherichia coli engineered bacteria is prepared. The molecular structures of icariin (A) and baohuoside I (B) are as follows: Figure 1 As shown, the specific steps are as follows:

[0043] S11, preparation of thermophilic β-D-glucosidase PfBgl Escherichia coli engineering bacteria:

[0044] According to the codon preference of the thermophilic β-D-glucosidase PfBgl amino acid sequence, the optimized sequence information was sent to the company for synthesis to obtain the pUC57 recombinant plasmid containing the optimized gene sequence of thermophilic β-D-glucosidase PfBgl. According to the optimized gene sequence, the upstream and downstream primers PfBgl-F (sequence as shown in SEQ ID NO.1) and PfBgl-R (sequence as shown in SEQ ID NO.2) of the PfBgl gene and the vector pET-28a linearization primers pET-28a-F (sequence as shown in SEQ ID NO.3) and pET-28a-R (sequence as shown in SEQ ID NO.4) were designed.

[0045] SEQ ID NO.1:

[0046] CATCATCATCATCATCACAGCAGCGGCATGAAATTCCCGAAAAACTTC

[0047] SEQ ID NO.2:

[0048] TCAGTGGTGGTGGTGGTGGTGCTCGAGCTATTTACGGGTAACGAATTTC

[0049] SEQ ID NO.3:CTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCT

[0050] SEQ ID NO.4:GCCGCTGCTGTGATGATGATGATGATGGCTGCTGCCCAT

[0051] Gene cloning is performed through seamless cloning technology, as follows:

[0052] The PCR amplification system for amplification of thermophilic β-D-glucosidase gene PfBgl and linearization of vector pET-28a is shown in Table 1. The amplification program is 95°C, 5 min; 95°C, 30 s, 61°C, 30 s, 72°C, 3 min, 30 cycles; 72°C, 10 min; and insulation at 12°C.

[0053] Table 1

[0054]

[0055] After PCR amplification, agarose gel electrophoresis was first used to identify that the PCR product was consistent with the theoretical sequence size, and then 1 μL of restriction enzyme Fast Digest Dpn Ι was added to the PCR system, and the metal bath was incubated at 37 ° C for 2 h to digest the template in the PCR system. After that, the PCR product was purified and recovered, and the DNA concentration was determined using NanoDrop 2000. Finally, the thermophilic β-D-glucose gene PfBgl was recombined with the pET-28a linearized PCR product using a seamless cloning kit, and the reaction conditions were 50 ° C, 20 min. The recombinant system is shown in Table 2.

[0056] Table 2

[0057] pET-28a linearized plasmid 2μL PCR amplification products of PfBgl gene 5.5μL Seamless Cloning Kit Mix 7.5μL Total volume 15μL

[0058] The recombinant reaction product was transformed into competent cells of Escherichia coli DH5α and cultured at 37°C overnight. The positive clones were identified by colony PCR. The colony PCR system is shown in Table 3 and the PCR program is shown in Table 4. The positive clones were then sent to Shanghai Bioengineering for sequencing verification. The gene sequence was correct, indicating that the thermophilic β-D-glucose gene PfBgl was successfully cloned into pET-28a. The recombinant plasmid map is shown in Figure 2 As shown, the recombinant plasmid pET-28a-PfBgl was extracted and transformed into Escherichia coli BL21 (DE3), and the thermophilic β-D-glucosidase PfBgl Escherichia coli engineering bacteria were successfully constructed.

[0059] Table 3

[0060]

[0061] Table 4

[0062]

[0063] S12. Cultivation of test tube seed solution: 5 mL of 2×YT medium containing 50 μg / mL kanamycin sulfate was inoculated with 50 μL (1%, v / v) of the thermophilic β-D-glucosidase PfBgl Escherichia coli culture prepared in step S11, and cultured overnight (about 13 h) at 37°C and 210 rpm in a constant temperature culture shaker.

[0064] S13, Erlenmeyer flask expansion culture: 2 mL (1%, v / v) of the bacterial solution cultured in step S12 was inoculated into 200 mL 2×YT medium containing 50 μg / mL kanamycin sulfate, and cultured in a constant temperature culture shaker at 37°C and 180 rpm until OD 600 It is 0.9-1.0.

[0065] S14. IPTG-induced expression: Add IPTG to a final concentration of 0.5 mM into the flask and induce expression overnight at 16°C and 180 rpm.

[0066] S15. Preparation of whole-cell biocatalyst: The overnight induced culture solution was centrifuged at 4°C and 8000rpm for 10min, and resuspended in pH 8.0 50mM phosphate buffer to a final concentration of 200mg / mL to obtain a resuspended solution of β-D-glucosidase PfBgl Escherichia coli engineered bacteria. The bacterial solution was dispensed into 1.5mL EP tubes, centrifuged at 13000rpm for 5min at room temperature, and the supernatant was discarded. The bacterial cells were stored at -20°C for later use.

[0067] S16. Use DMSO to prepare 20mM icariin and baohuoside I solutions respectively, take their mother liquors according to a certain concentration ratio and mix them evenly, the concentration of icariin decreases, and the concentration of baohuoside I increases, the interval is 0.02mM, and the sum of the two concentrations is 0.2mM. The prepared standard solution is tested by HPLC, the detection conditions are: high performance liquid chromatograph Shimadzu LC-16, chromatographic column Shim-pack GIS C18, detection at 35℃, detection volume 10μL, detection wavelength 270nm, mobile phase 0.5% (v / v) glacial acetic acid / acetonitrile = 58 / 42, flow rate 1.0mL / min. The prepared icariin and baohuoside I standard curves are shown in Figure 3 .

[0068] Embodiment 2

[0069] The optimal cell concentration of whole-cell biotransformation of icariin to prepare baohuoside I by β-D-glucosidase PfBgl Escherichia coli was investigated. The specific steps are as follows:

[0070] 10 μL of 20 mM icariin solution was added to 180 μL of 50 mM phosphate buffer at pH 6.0, and the mixture was kept warm in a constant temperature metal bath at 37°C for 2 min. Then, 10 μL of the β-D-glucosidase PfBgl Escherichia coli engineered bacteria resuspension prepared in Example 1 was added to make the final concentrations of 0, 0.1, 0.2, 0.4, 0.6, 1.0, 1.5, 2.0, 2.5, 3.0, 4.0, and 5.0 mg / mL, respectively. The mixture was reacted in a constant temperature shaking metal bath at 37°C and 800 rpm for 120 min, and then 800 μL of methanol was added to assist dissolution. The mixture was centrifuged at 13000 rpm at room temperature for 5 min, and the supernatant was filtered through a 0.22 μm organic filter membrane.

[0071] HPLC was used to detect the peak areas of substrate and product, and the residual amount of substrate was calculated by substituting into the standard curve formula. The conversion rate was calculated by the following formula:

[0072] Conversion rate (%) = C / C0×100%

[0073] Where C is the concentration of the product icariin I in the reaction system (mM), and C0 is the initial concentration of the substrate icariin (1 mM).

[0074] The results are as follows Figure 4 As shown, when the cell concentration was 0.4 mg / mL, the conversion rate had reached 93.0%. When the cell concentration increased to 1.0 mg / mL, the conversion rate had reached 97.8%. As the cell concentration continued to increase, the conversion rate tended to be flat. Therefore, a cell concentration of 1.0 mg / mL was selected to prepare Baohuoside I.

[0075] Embodiment 3

[0076] The optimal reaction time for preparing Baohuoside I by biotransformation of icariin by whole-cell biotransformation of β-D-glucosidase PfBgl Escherichia coli was investigated. The specific steps are as follows:

[0077] 10 μL of 20 mM icariin solution was added to 180 μL of 50 mM phosphate buffer at pH 6.0, and the mixture was kept in a constant temperature metal bath at 37°C for 2 min. Then, 10 μL of the β-D-glucosidase PfBgl Escherichia coli engineered bacteria resuspension prepared in Example 1 (the final cell concentration was 1.0 mg / mL) was added, and the mixture was reacted in a constant temperature oscillating metal bath at 37°C and 800 rpm for 0, 5, 10, 20, 30, 40, 60, 80, 100, 120, and 150 min. Subsequently, 800 μL of methanol was added to dissolve the mixture, and the mixture was centrifuged at 13000 rpm at room temperature for 5 min. The supernatant was filtered through a 0.22 μm organic filter membrane, and the substrate and product concentrations were detected by HPLC and substituted into the standard curve to calculate the conversion rate. The HPLC detection results are shown in FIG. Figure 5 As shown, the control is the reaction solution without adding whole cell biocatalyst, and the conversion rate calculation results are shown in Figure 6 As shown, the conversion rate reached 83.9% at 20 minutes of reaction. As the reaction time increased, the conversion rate continued to increase. The conversion rate reached the maximum at 40 minutes of reaction, which was 92.8%. The conversion rate remained unchanged as the reaction time was further extended. Therefore, a reaction time of 40 minutes was selected to prepare Baohuoside I.

[0078] Embodiment 4

[0079] The effect of cell recycling times on the conversion rate of icariin to baohuoside I by whole-cell bioconversion of β-D-glucosidase PfBgl Escherichia coli engineered bacteria was investigated. The specific steps are as follows:

[0080] 10 μL of 20 mM icariin solution was added to 180 μL of 50 mM phosphate buffer at pH 6.0, and the mixture was kept in a constant temperature metal bath at 37°C for 2 min. Then, 10 μL of the β-D-glucosidase PfBgl Escherichia coli engineered bacteria resuspension prepared in Example 1 (the final cell concentration was 1.0 mg / mL) was added, and the mixture was reacted in a constant temperature shaking metal bath at 37°C and 800 rpm for 40 min. Subsequently, 200 μL of methanol was added to dissolve the product, and the mixture was centrifuged at 13000 rpm at room temperature for 5 min. 320 μL of the supernatant was added to 480 μL of methanol, mixed and filtered through a 0.22 μm organic filter membrane, and the substrate and product concentrations were detected by HPLC and substituted into the standard curve to calculate the conversion rate.

[0081] The remaining supernatant in the EP tube was discarded, and 190 μL of 50 mM phosphate buffer at pH 6.0 was added to the EP tube, which was kept in a constant temperature metal bath at 37°C for 2 min. Then, 10 μL of 20 mM icariin was added to carry out the second reaction, and this was repeated 15 times.

[0082] The conversion rate statistics are as follows: Figure 7 As shown, the conversion rate of PfBgl Escherichia coli engineered bacteria cells was 97.5% for the first use. The conversion rate did not decrease significantly with the increase in the number of cell uses. After repeated use for 14 times, the conversion rate decreased slightly to 89.2%, which was only 8.3% lower than that of the first use. Since methanol was added to dissolve the product after each cycle, it was speculated that methanol may affect the conversion rate, and the enzyme has a strong resistance to organic solvents. Therefore, it is necessary to study whether methanol affects the conversion rate of Baohuoside I.

[0083] Embodiment 5

[0084] The effects of different methanol concentrations of Escherichia coli engineered bacteria resuspensions on the conversion rate of icariin to baohuoside I in whole-cell bioconversion were investigated. The specific steps are as follows:

[0085] 10 μL of 20 mM icariin solution was added to 180 μL of pH 6.0 50 mM phosphate buffer, and the mixture was kept in a constant temperature metal bath at 37° C. for 2 min. Then, 10 μL of the β-D-glucosidase PfBgl Escherichia coli engineered bacteria resuspension prepared in Example 1 (containing methanol at concentrations of 0%, 10%, 20%, 30%, 40%, 50%, 60%, 80% and 100%, respectively, and the final cell concentration was 1.0 mg / mL) was added, and the mixture was reacted in a constant temperature shaking metal bath at 37° C. and 800 rpm for 10 min. Subsequently, 800 μL of methanol was added to dissolve the product, and the mixture was centrifuged at 13000 rpm at room temperature for 5 min. The supernatant was filtered through a 0.22 μm organic filter membrane, and the concentrations of the substrate and product were detected by HPLC and substituted into the standard curve to calculate the conversion rate.

[0086] The results are as follows Figure 8 As shown, when the cell resuspension solution containing no methanol and pH 8.0 50 mM phosphate buffer was used, the conversion rate was 49.8%. As the methanol concentration in the resuspension solution increased, the conversion rate gradually decreased, but the decrease was slow. When the methanol concentration was 60%, the conversion rate still remained at 43.9%.

[0087] Embodiment 6

[0088] The effect of methanol concentration in the reaction system on the conversion rate of icariin to baohuoside I by whole-cell bioconversion of β-D-glucosidase PfBgl Escherichia coli engineered bacteria was investigated. The specific steps are as follows:

[0089] 10 μL of 20 mM icariin solution was added to 180 μL of pH 6.0 50 mM phosphate buffer containing different concentrations of methanol (the final concentrations of methanol were 0%, 9%, 18%, 27%, 36%, and 45%, respectively), and the mixture was kept warm in a constant temperature metal bath at 37°C for 2 min. Then, 10 μL of the β-D-glucosidase PfBgl Escherichia coli engineered bacteria resuspension prepared in Example 1 (the final cell concentration was 1.0 mg / mL) was added, and the mixture was reacted in a constant temperature shaking metal bath at 37°C and 800 rpm for 20 min. 800 μL of methanol was immediately added to dissolve the product, and the mixture was centrifuged at room temperature at 13000 rpm for 5 min. The supernatant was filtered through a 0.22 μm organic filter membrane, and the concentrations of the substrate and product were detected by HPLC and substituted into the standard curve to calculate the conversion rate.

[0090] The results are as follows Fig. 9 As shown, adding methanol to the reaction system can significantly increase the conversion rate of PfBgl Escherichia coli engineered bacteria whole cell biotransformation of icariin to baohuoside I. When there is no methanol, the conversion rate is only 40.7%. When the methanol concentration is increased to 18%, the conversion rate is increased to the highest, which is 69.5%, an increase of 28.8% over the conversion rate in the absence of methanol. When the methanol concentration continues to increase, the conversion rate decreases. When the methanol concentration in the reaction system is 45%, the conversion rate is only 9.5%.

[0091] Embodiment 7

[0092] Process scale-up and preparation of Baohuoside I. Although DMSO has the best solubility, it is highly toxic and cannot be removed by rotary evaporation. Therefore, methanol is used as the solvent in the scale-up process for preparing Baohuoside I, as follows:

[0093] Dissolve 0.6778 g of substrate icariin in 300 mL of 70°C hot methanol, add to 650 mL of pH 6.0 20 mM phosphate buffer, keep warm at 37°C on a temperature-controlled magnetic stirrer, then add 1 g of PfBgl Escherichia coli engineered bacteria resuspended in 50 mL of pH 6.0 20 mM phosphate buffer, and react on a temperature-controlled magnetic stirrer at 37°C and 200 rpm. At different reaction times, take 200 μL of sample and add to 800 μL of methanol, pass through a 0.22 μm organic filter membrane, detect the substrate and product concentrations by HPLC, and calculate the conversion rate until the reaction ends after 4 hours.

[0094] The results are as follows Fig.10 As shown, the conversion rate reached 91.6% after 30 minutes of reaction, 99.3% after 80 minutes of reaction, and greater than 99.9% after 150 minutes of reaction. After the reaction, the reaction solution was centrifuged at 35°C and 8000rpm for 30 minutes, the supernatant was discarded, 200mL of methanol was used to fully dissolve the precipitate, and the bacterial precipitate was discarded after centrifugation at 35°C and 8000rpm for 30 minutes. The supernatant was rotary evaporated at 50°C, and then dried in a 45°C oven. The resulting powder was the product of Baohuoside I, a total of 0.498±0.003g (the total Baohuoside I obtained from 3 parallel experiments is shown in the photo). Fig.11 shown).

[0095] Methanol was used as a solvent to prepare a powder solution of the Baohuoside I product with a concentration of 20 mg / mL. After dilution to 0.05 mg / mL, the concentration was detected by HPLC. The purity and yield of Baohuoside I were calculated using the following formula.

[0096] Purity (%) = Baohuoside I detection concentration / 1000 × molecular weight / 0.05 × 100 Yield (%) = Baohuoside I powder mass × purity / theoretical product mass × 100

[0097] Results The yield of Baohuoside I was 90.0% and the purity was 93.2%.

[0098] Therefore, by adopting the preparation method provided by the present invention, the purity and yield of the target product are high, the yield of baohuoside I is 90.0%, and the purity is 93.2%; the provided thermophilic β-D-glucosidase PfBgl Escherichia coli engineered bacteria can be used as a biocatalyst for whole-cell bioconversion of baohuoside I; the provided biocatalyst can be repeatedly recycled and used multiple times, and the multiple recycling has little effect on the conversion rate, which can greatly reduce the bioconversion cost of baohuoside I; the reaction conditions are mild, the energy consumption and cost are low, and the by-products are small; the preparation method is highly safe, the reaction process does not involve strong acids, strong bases and heavy metals, reduces the use and discharge of harmful substances, is environmentally friendly, green, pollution-free, and low-carbon and environmentally friendly.

[0099] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. Application of thermophilic β-D-glucosidase PfBgl Escherichia coli engineered bacteria in whole-cell biotransformation of icariin to prepare baohuoside I, characterized in that: The preparation method of thermophilic β-D-glucosidase PfBgl Escherichia coli engineered bacteria is as follows: synthesize the codon-optimized PfBgl gene sequence, then clone it into the pET-28a vector by seamless cloning technology, and transform the recombinant plasmid pET28a-PfBgl with verified correct gene sequence into Escherichia coli BL21 (DE3).

2. The use of the thermophilic β-D-glucosidase PfBgl Escherichia coli engineering bacteria according to claim 1 in the preparation of Baohuoside I by whole-cell biotransformation of icariin, characterized in that: The thermophilic β-D-glucosidase PfBgl Escherichia coli engineering bacteria is used as a biocatalyst in the preparation of baohuoside I by whole-cell biotransformation of icariin.

3. A method for preparing baohuoside I by whole-cell biotransformation of icariin, using the thermophilic β-D-glucosidase PfBgl Escherichia coli engineered bacteria described in claim 1 as a biocatalyst, characterized in that: Here are the steps: S1. Prepare a reaction system including pH 6.050 mM phosphate buffer, 3.33 mM icariin solution, and 20 mg / mL thermophilic β-D-glucosidase PfBgl Escherichia coli engineered bacteria resuspension; S2. The reaction system was reacted at 37°C and 200 rpm. After the reaction was completed, the supernatant was discarded by centrifugation, methanol was added to dissolve the precipitate, the supernatant was collected by centrifugation, the methanol was rotary evaporated at 50°C, and then dried at 45°C to obtain Baohuoside I.

4. The method for preparing baohuoside I by whole-cell biotransformation of icariin according to claim 3, characterized in that: In the reaction system of step S1, the volume ratio of phosphate buffer: icariin solution: thermophilic β-D-glucosidase PfBgl Escherichia coli engineering bacteria resuspension is 13:6:

1.

5. The method for preparing baohuoside I by whole-cell biotransformation of icariin according to claim 3, characterized in that: The icariin solution in step S1 is prepared by dissolving icariin in hot methanol.

6. The method for preparing baohuoside I by whole-cell biotransformation of icariin according to claim 3, characterized in that: In step S2, the reaction system is reacted at 37° C. and 200 rpm for 40-240 min, and the centrifugal conditions are 35° C. and 8000 rpm for 30 min.

7. The method for preparing baohuoside I by whole-cell biotransformation of icariin according to claim 3, characterized in that: The preparation method of the thermophilic β-D-glucosidase PfBgl Escherichia coli engineering bacteria resuspension in step S1 is: S11, carry out seed liquid culture, use 2×YT medium to culture overnight at 37°C and 210rpm; S12, expand the culture, use 2×YT medium to culture at 37°C, 180rpm until the bacterial solution OD 600 0.9-1.0; S13, IPTG-induced expression, after adding IPTG, the expression was induced at 16°C and 180 rpm overnight; S14, 4°C, 8000 rpm centrifugation for 10 min to obtain the precipitate, and resuspend it in pH 8.0 50 mM phosphate buffer.

8. The method for preparing baohuoside I by whole-cell biotransformation of icariin according to claim 7, characterized in that: The 2×YT culture medium in step S11 and step S12 contains 50 μg / mL kanamycin sulfate, and the inoculation amount is 1% by volume.

9. The method for preparing baohuoside I by whole-cell biotransformation of icariin according to claim 7, characterized in that: The final concentration of IPTG in step S13 is 0.5 mM.

10. Use of the method for preparing Baohuoside I by whole-cell biotransformation of icariin as claimed in any one of claims 3 to 9 in the preparation of Baohuoside I.

Images