Method for directionally improving yield of active ganoderic acid based on modified membrane anchoring cytochrome P450
By modifying the membrane-anchored cytochrome P450 enzyme, using the structure predicted by AlphaFold2, the problem of low yield of type II Ganoderma lucidum in the prior art was solved, and the catalytic activity and selectivity were significantly improved, and the yield and relative proportion of Chrysinic acid Jb and Ganoderma lucidum Y were improved.
Patent Information
- Application Number
- CN202311303816.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-10-10
- Publication Date
- 2025-04-11
AI Technical Summary
The prior art is difficult to effectively increase the yield of Type II Ganoderma acid, mainly because the catalytic activity and selectivity of membrane-anchored cytochrome P450 enzyme are difficult to improve.
By using the CYP512W2 structure predicted by AlphaFold2, calculation assists in designing key amino acid sites, performing enzyme molecular transformation, improving catalytic efficiency and substrate selectivity, thereby increasing the yield and relative proportion of Chrysinic acid Jb or Ganoderma acid Y.
The yield and proportion of Ganoderma lucidate Y and Chiling acid Jb were significantly improved, and the catalytic activity was significantly improved, achieving efficient biosynthesis of Ganoderma lucidate Y and Chiling acid Jb produced by Ganoderma lucidate HLDOA.
Smart Images
Figure CN119799834A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to a technology in the field of bioengineering, specifically a method for directionally increasing the yield of active ganoderic acid based on the transformation of membrane-anchored cytochrome P450. Background Art
[0002] Type II ganoderic acids (TIIGAs) are a class of masasterane triterpenoid compounds extracted from the traditional Chinese medicinal herb Ganoderma lucidum, which have significant anti-cancer and anti-metastasis biological activities. However, their large-scale synthesis is very difficult due to the complex regulation of the biosynthesis process of TIIGAs, the immature genetic manipulation of medicinal mushrooms, and many unclear cytochrome P450 enzymes (CYPs) in the biosynthetic pathway.
[0003] Studies have shown that CYP512W2 can oxidize ganoderic acid HLDOA to generate ganoderic acid Y and ganoderic acid Jb. At the same time, CYP512W2 can oxidize C-15 in ganoderic acid Y to generate ganoderic acid Jb. Compared with the research hotspot of soluble CYPs protein engineering, there are fewer reports on membrane-anchored P450 protein engineering. Quantitative analysis of active CYPs in membranes is quite challenging, not to mention obtaining the crystal structure of membrane-anchored proteins. In the absence of precise structural guidance, engineering targets for improving catalytic activity and selectivity are mostly limited to amino acids in the substrate recognition site. Summary of the invention
[0004] In view of the above-mentioned deficiencies in the prior art, the present invention proposes a method for directionally increasing the production of active ganoderic acid based on the modification of membrane-anchored cytochrome P450. The structure of CYP512W2 predicted by AlphaFold2 is used as a guide to modify the membrane-anchored promiscuous cytochrome P450 enzyme, thereby improving the catalytic efficiency and substrate selectivity, and at the same time, producing a higher production of gabarenic acid Jb or gabarenic acid Y and a ratio of gabarenic acid Jb / ganoderic acid Y or gabarenic acid Y / ganoderic acid Jb through cytochrome P450 mutant proteins.
[0005] The present invention is achieved through the following technical solutions:
[0006] The present invention relates to a method for optimizing the yield of active ganoderic acid based on modified membrane anchoring. Based on the structure of CYP512W2 predicted by AlphaFold2, several key amino acids are selected by computer-aided design to guide the modification of P450 membrane protein CYP512W2 and enzyme molecule modification, so as to increase the yield of ganoderma triterpenoid compounds.
[0007] The amino acid sequence of the P450 membrane protein CYP512W2 is shown in SEQ ID No.2.
[0008] The key amino acids are selected in the following manner:
[0009] a) The binding free energy decomposition contribution of the amino acid sites calculated by the MMPBSA method was greater than 0.8 kcal / mol, among which the sites with poor conservatism were selected for further experimental verification.
[0010] b) Select the important amino acids located in the substrate entry channel.
[0011] c) Alignment with CYP512A2 and selection of amino acids guided by the CYP512A2 entry channel.
[0012] d) Supplementary selection of residues with low binding energy at the substrate entrance and active site was performed as follows: MD simulations were performed using pmemd.cudaAmber 18 (three copies of 100 ns for each system), the complex structures in all systems were minimized for 5000 cycles according to the conjugate gradient, only the solvent and H atoms were allowed to move, and then run without restrictions for 5000 cycles; heating was performed from 0 K to 300 K within 100 ps, and then equilibrated for 200 ps in constant pressure and constant temperature mode; finally, three 100 ns classical molecular dynamics experiments were performed for each system to obtain the residues with low binding energy at the active site.
[0013] In the classical molecular dynamics experiment, the SHAKE algorithm is used to constrain the movement of water molecules and maintain a fixed angle between hydrogen atoms.
[0014] In the classical molecular dynamics experiment described above, the particle grid Ewald method is used.
[0015] In the classical molecular dynamics experiment described above, the cutoff distances for Lennard-Jones and electrostatic interactions are
[0016] The key amino acids include: the nucleotide sequence and amino acid sequence of wild-type CYP512W2 and its point mutations: I108A, V112L, M114A, M210A, M213R, L294A, I361G, S362G, I364A, Y482, I108A-Y482F, M114A-M213R, M114A-L294A, M213R-L294A, M114A-M213R-L294A, and its nucleotide sequence and point mutation amino acid sequence are shown in the following table:
[0017] Table 1 name Nucleotide sequence Amino acid sequence Wild-type CYP512W2 Seq ID No.1 Seq ID No.2 Point mutation I108A Seq ID No.3 Seq ID No.4 Point mutation V112L Seq ID No.5 Seq ID No.6 Point mutation M114A Seq ID No.7 Seq ID No.8 Point mutation M210A Seq ID No.9 Seq ID No.10 Point mutation M213R Seq ID No.11 Seq ID No.12 Point mutation L294A Seq ID No.13 Seq ID No.14 Point mutation I361G Seq ID No.15 Seq ID No.16 Point mutation S362G Seq ID No.17 Seq ID No.18 Point mutation I364A Seq ID No.19 Seq ID No.20 Point mutation Y482 Seq ID No.21 Seq ID No.22 Combined mutation I108A-Y482F Seq ID No.23 Seq ID No.24 Combined mutations M114A-M213R Seq ID No.25 Seq ID No.26 Combined mutations M114A-L294A Seq ID No.27 Seq ID No.28 Combined mutation M213R-L294A Seq ID No.29 Seq ID No.30 Combined mutations M114A-M213R-L294A Seq ID No.31 Seq ID No.32
[0018] The enzyme molecule modification refers to: introducing nucleic acid molecules into host cells through homologous recombination, gene editing or other gene recombination techniques known in the art to achieve the transformation or modification of host cells so that they can produce Ganoderma triterpenoid compounds.
[0019] The host cell is a prokaryotic cell or a eukaryotic cell, preferably a Saccharomyces genus cell or an Escherichia coli cell, and more preferably a Saccharomyces cerevisiae cell.
[0020] The ganoderma triterpenoid compounds include: ganoderic acid HLDOA, ganoderic acid Y and ganoderic acid Jb.
[0021] The production of ganoderma triterpenoid compounds refers to: using a heterologous biological expression method, that is, culturing a recombinant brewer's yeast strain that overexpresses ganoderic acid HLDOA, and catalyzing ganoderic acid HLDOA to generate ganoderic acid Y or ganoderic acid Jb, specifically: using CYP512W2 from ganoderma as a template, obtaining various CYP512W2 mutants by PCR amplification, and recombining and connecting the expression vector pRS426, CYP coding region sequence fragment, yeast HXT7p promoter, yeast FBA1t terminator and KanMX gene expression frame containing truncated promoter Ura3 (tP-Ura3) by homologous recombination and other methods to obtain a series of recombinant expression plasmids pRS426-CYP512W2s-G418r, introducing the recombinantly modified brewer's yeast into the fermentation screen, and then fermenting, and the obtained products are subjected to yield screening to determine the high-yield mutant strains, wherein: s represents different point mutations or combination mutation genes of CYP512W2.
[0022] The Saccharomyces cerevisiae strain overexpressing ganoderic acid HLDOA refers to: the genetically engineered SC62 strain (YL-T3-rDNA::eGFP-TRP1-CYP5150L8-iGLCPR), which is a strain with the highest ganoderic acid HLDOA production obtained through homologous recombination-mediated rDNA site integration, FACS and fermentation verification. The construction method adopts but is not limited to the technology described in the literature (Yuan W, et al., Nat Commun, 2022, 13(1):7740).
[0023] The fermentation screening specifically refers to: introducing each expression plasmid into the recombinant Saccharomyces cerevisiae by a standard lithium acetate transformation method (Gietz, RD, et al., Nat Protoc, 2007.2(1):31-4) or a yeast transformation kit (Frozen-EZ Yeast Transformation II, ZYMO RESEARCH), fermenting the yeast by YPD24 medium, then extracting the fermentation product by ethyl acetate, and finally analyzing the extract by HPLC (high performance liquid chromatography) to compare the yield and selectivity of ganoderic acid HLDOA, ganoderic acid Y and ganoderic acid Jb with the wild-type strain, so as to preliminarily determine whether the designed mutant is a high-yield mutant.
[0024] The wild-type strain refers to: the pRS426-HXT7p-CYP512W2-FBA1tG418r yeast expression plasmid containing the CYP512W2 gene is transferred into the recombinantly modified microorganism Saccharomyces cerevisiae SC62 to obtain the strain SC62-WT, and its construction method adopts but is not limited to the technology described in the document Yuan W, et al., Nat Commun, 2022, 13(1):7740.
[0025] The empty plasmid control strain refers to: the pRS426-HXT7p-FBA1t-G418r yeast expression plasmid is transferred into the recombinant microorganism Saccharomyces cerevisiae SC62, thereby obtaining the strain SC62-CK.
[0026] The host cell uses a fermentation medium YPD24 fermentation medium containing geneticin G418.
[0027] The YPD24 medium contains 10 g / L yeast powder, 20 g / L beef peptone, 20 g / L glucose and 40 g / L glycerol. For Saccharomyces cerevisiae containing the yeast expression plasmid pRS426-CYP512W2s-G418r, 100 mg / L or 200 mg / L geneticin G418 is added to the medium at the same time. Technical Effects
[0028] The invention is based on rational design, mutant screening and transformation, and according to the catalytic active site of cytochrome P450 (CYP512W2) and the key sites of its substrate import and export channels, the relevant sites are transformed, so that the catalytic activity of cytochrome P450 is significantly improved; thereby significantly improving the yields of ganoderic acid Y and gabacinic acid Jb and the ratios of ganoderic acid Y / gabacinic acid Jb and gabacinic acid Jb / ganoderic acid Y.
[0029] The invention significantly improves the catalytic activity by mutating the 108th amino acid isoleucine Ile of the wild-type cytochrome P450 (CYP512W2) to alanine Ala. Compared with the wild-type, the amount of ganoderic acid Y generated by catalyzing the substrate ganoderic acid HLDOA is 219.1% of that of the wild-type, the amount of gabapentinic acid Jb generated is 127.9% of that of the wild-type, and the ratio of gabapentinic acid Jb / ganoderic acid Y can be increased to 80.7%.
[0030] The invention significantly improves the catalytic activity of wild-type cytochrome P450 (CYP512W2) by mutating the 114th amino acid methionine Met to alanine Ala and the 213th amino acid arginine Arg. Compared with the wild-type, the ratio of ganoderic acid Y / ganoderic acid Jb generated by catalyzing substrate ganoderic acid HLDOA is increased to 166.4%.
[0031] The invention significantly improves the catalytic activity of wild-type cytochrome P450 (CYP512W2) by mutating one or two amino acids at other sites, such as sites 114 / 294 / 482. BRIEF DESCRIPTION OF THE DRAWINGS
[0032] Figure 1 Schematic diagram of the empty expression plasmid pRS426-HXT7p-FBA1t-G418r of the present invention;
[0033] Figure 2 Schematic diagram of the expression plasmid pRS426-HXT7p-CYP512W2-FBA1t-G418r of the present invention;
[0034] Figure 3 Schematic diagram of the production of ganoderic acid Y and ganoderic acid Jb of the wild type and various mutant strains after 120 hours of test tube fermentation;
[0035] Figure 4 Schematic diagram of the production of ganoderic acid Y and ganoderic acid Jb of the wild type and each single mutant strain after 120 hours of shake flask fermentation;
[0036] Figure 5 Schematic diagram of the shake flask fermentation growth curves of the wild type and each single mutant strain;
[0037] Figure 6 Schematic diagram of the change of HLDOA production of ganoderic acid over time in shake flask fermentation of wild type and single mutant strains;
[0038] Figure 7 Schematic diagram of the change of ganoderic acid Y production over time in shake flask fermentation of wild type and single mutant strains;
[0039] Figure 8Schematic diagram of the change in Jb production over time in shake flask fermentation of the wild type and each single mutant strain.
[0040] Fig. 9 Schematic diagram of the production of ganoderic acid Y and ganoderic acid Jb of the wild type and various mutant combinations after 120 hours of shake flask fermentation;
[0041] Fig.10 Schematic diagram of the shake flask fermentation growth curves of the wild type and various combination mutants;
[0042] Fig.11 Schematic diagram of the change of HLDOA production of ganoderic acid over time in shake flask fermentation of wild type and various mutant combinations;
[0043] Fig.12 Schematic diagram of the change of ganoderic acid Y production over time in shake flask fermentation of the wild type and various mutant combinations;
[0044] Fig.13 Schematic diagram of the change in Jb production over time in shake flask fermentation of the wild type and various mutant combinations. DETAILED DESCRIPTION
[0045] In this embodiment, based on the structure of CYP512W2 predicted by AlphaFold2, several key amino acids are selected, and primers are designed according to the sites selected by computational simulation, and then they are cloned into Saccharomyces cerevisiae expression plasmids, and the Saccharomyces cerevisiae expression plasmids are transformed into recombinant microorganism Saccharomyces cerevisiae for heterologous expression. By fermenting and screening the transformed strains, a rationally designed Saccharomyces cerevisiae strain for catalyzing ganoderic acid HLDOA to efficiently produce ganoderic acid Y and ganoderic acid Jb is finally screened, thereby improving the catalytic activity and selectivity of CYP512W2 in catalyzing ganoderic acid HLDOA to produce ganoderic acid Y and ganoderic acid Jb, and realizing efficient heterologous biosynthesis of ganoderic acid Y and ganoderic acid Jb.
[0046] The method specifically comprises the following steps:
[0047] Step 1: CYP512W2 and CYP512A2 structure prediction
[0048] The structures of CYP512W2 and CYP512A2 were predicted by AlphaFold2 with high plDDT scores (PMID: 34265844). The protonation state of CYP512W2 was determined by the PDB2PQRweb server (pmiid: 15215472). According to the P450 homologous structure of CYP512W2 in the PDB database, the heme group is covalently linked to C445. Ganoderic acid HLDOA was docked into the active cavity of CYP512W2 (PMID: 19399780) using Autodock. The mutant model (Y482F, I108A) was generated by PyMOL software. Compound I and its axial Cys were assigned using the amber compatibility parameters developed by Cheatham et al. (PMID: 21997754). The parameters of the lingzhi acid HLDOA substrate were generated using the Antechamber module, using the General Amber Force Field (GAFF), (PMID: 16458552, PMID: 15116359), and the partial charges were set to fit the electrostatic potential generated by the RESP model (RESP) at the M062X / 6-31G(d) level. Each complex was immersed in a pre-equilibrated box with Each system was neutralized by adding additional ions (Na+).
[0049] Step 2: Selection of CYP512W2 mutation sites
[0050] On the basis of the structural analysis obtained by MD simulation, some key amino acids were selected by computational assisted design. First, the binding free energy decomposition contribution of amino acid sites F104, I108, V112, M114, L123, L294, V295, F297, A298, I361, and S362 was calculated to be greater than 0.8 kcal / mol by the MMPBSA method, among which the amino acid sites I108A, V112L, M114A, L294A, S362G, and I361G with poor conservatism were selected for further experimental verification. Secondly, the amino acid sites M210, M213, I364, and Y482 located in the substrate entrance channel play an important role in affecting enzyme activity, substrates, and even selectivity. CYP512A2 can specifically convert ganoderic acid HLDOA into ganoderic acid Y. Under the guidance of the CYP512A2 entrance channel, the amino acid sites Y482F and M213R were selected. Considering that the larger size of the entrance channel helps to speed up the entry of substrates into the catalytic pocket, amino acid sites M210A and I364A were selected. Combined with residues M210A, M213R, I364A, and Y482F near the substrate entrance, residues I108A, V112L, M114A, L294A, S362G, and I361G with lower binding energy near the active site are believed to help improve the activity and selectivity of CYP512W2.
[0051] Step 3: Construction of CYP512W2 mutant expression plasmid and its Saccharomyces cerevisiae transformation strain
[0052] Plasmid pRS426-CYP512W2-G418r was amplified by PCR using appropriate primers. The DNA sequences of the CYP512W2 gene sequence fragments containing point mutations were obtained by using the PCR cloning kit (Novoprotein, Shanghai, China) according to the manufacturer's instructions, as shown in Seq ID No. 1-No. 32.
[0053] Table 2 Primer sequences used to amplify CYP512W2 gene sequence fragments containing point mutations
[0054] F and R represent forward and reverse primers, respectively.
[0055] Specifically, the cloning and expression of CYP512W2 and its related mutants were constructed by the following methods:
[0056] 3.1) Using pRS426-CYP512W2-G418r as a template, PCR amplification was performed to obtain the following fragments: I108A-U, I108A-D, V112L-U, V112L-D, M114A-U, M114A-D, M210A-U, M210A-D, M213R-U, M213R-D, L294A-U, L294A-D, I361G-U, I361G-D, S362G-U, S362G-D, I364A-U, I364A-D, Y482F-U, Y482F-D. Using pRS426-I108A-G418r as template, Y482F-DF and Y482F-DR, CYP512W2-F and Y482F-UR as primers, the fragments I108A-Y482F-U and I108A-Y482F-D of the mutant I108A-Y482F were obtained by PCR amplification; using pRS426-M114A-G418r as template, CYP512W2-F and M213R-UR, M2 Using 13R-DF and CYP512W2-R as primers, the mutants M114A-M213R fragments M114A-M213R-U and M114A-M213R-D were obtained by PCR amplification; using pRS426-M114A-G418r as template, CYP512W2-F and L294A-UR, L294A-DF and CYP512W2-R as primers, the mutants M114A-L294A were obtained by PCR amplification. The fragments M114A-L294A-U and M114A-L294A-D of the mutant M213R-L294A were obtained by PCR amplification using pRS426-L294A-G418r as template and CYP512W2-F, M213R-UR, M213R-DF and CYP512W2-R as primers; the fragments M213R-L294A-U and M213R-L294A-D of the mutant M213R-L294A were obtained by PCR amplification; the fragments M114A-L294A-U and M114A-L294A-D of the mutant M213R-L294A were obtained by PCR amplification using pRS426-L294 A-G418r was used as a template, CYP512W2-F and M114A-UR, M114A-DF and M213R-UR, M213R-DF and CYP512W2-R were used as primers, and the fragments M114A-M213R-L294A, M114A-M213R-L294A-U, M114A-M213R-L294A-M, and M114A-M213R-L294A-D of the mutant M114A-M213R-L294A were obtained by PCR amplification. The primer sequences used to amplify the CYP512W2 gene sequence fragments containing point mutations and combined mutations are shown in Table 1.
[0057] 3.2) The expression vector pRS426-HXT7p-FBA1t-G418r and the CYP512W2 gene sequence fragment containing the point mutation were recombined and connected by homologous recombination and other methods to obtain a series of recombinant expression plasmids pRS426-CYP512W2s-G418r (s represents different CYP512W2 point mutation genes) containing point mutations. Specifically, the plasmids were obtained by the following method:
[0058] i) The pRS426-HXT7p-FBA1t-G418r plasmid was linearized by PmeⅠ, and the pRS426-HXT7p-FBA1t-G418r plasmid was digested by PmeⅠ and SacII. The specific construction method of the pRS426-HXT7p-FBA1t-G418r plasmid can be obtained by referring to (Lan, X., et al., Biotechnol Bioeng, 2019.116(12):3301-3311).
[0059] ii) The pRS426-HXT7p-FBA1t-G418r plasmid linearized with PmeⅠ was amplified and the CYP512W2 gene sequence fragment containing point mutations (I108A-U, I108A-D, V112L-U, V112L-D, M114A-U, M114A-D, M210A-U, M210A-D, M213R-U, M213R-D, L294A-U, L294A-D, I361G-U, I361G-D, S362G-U, S362G-D, I364A-U, I364A-D, M114A-M213R-U, M114A-M213R-D, M114A-L294A-U, M114A-D) was amplified and the CYP512W2 gene sequence fragment containing point mutations (I108A-U, I108A-D, V112L-U, V112L-D, M114A-U, M114A-D 4A-L294A-D, M213R-L294A-U, M213R-L294A-D, M114A-M213R-L294A-U, M114A-M213R-L294A-M, M114A-M213R-L294A-D) were connected by recombinase, wherein the fragments with the same sequence number were in the same reaction system; the pRS426-HXT7p-FBA1t-G418r plasmid digested by PmeⅠ and SacII was connected with the amplified CYP512W2 gene sequence fragment containing the point mutation (Y482F-U, Y482F-D, I108A-Y482F-U, I108A-Y482F-D) by recombinase, and the specific steps are as follows:
[0060] a) Ligation system: 0.03 pmol of pRS426-HXT7p-FBA1t-G418r plasmid linearized with PmeⅠ or pRS426-HXT7p-FBA1t-G418r plasmid double digested with PmeⅠ and SacII, 0.06 pmol of the amplified CYP512W2 gene sequence fragment containing point mutations, 4 μL of CE II Buffer, 2 μL of Exnase II, and sterile water to 20 μL. Mix gently to avoid bubbles, then react and ligate at 37℃ for 30 minutes and ice bath for 5 minutes.
[0061] b) Take out 50 μL of DH5α competent cells stored at -80°C and place on ice until completely thawed, which takes about 5 minutes.
[0062] c) Transfer the ligation product to 50 μL DH5α competent cells, mix well to avoid bubbles, place on ice for 20 minutes, heat shock at 42°C for 60 seconds, then place on ice for 2 minutes, add 900 μL LB medium, and incubate at 37°C for 60 minutes. Then apply LB plates containing 100 μg / mL Amp resistance and culture inverted in a 37°C incubator overnight.
[0063] d) After a single colony grows on the plate, select a single clone and transfer it to 3 mL of liquid LB medium containing 100 μg / mL Amp resistance, and culture it at 37°C, 220 rpm overnight.
[0064] e) After the bacterial solution grows to a stable period, the plasmid is extracted, and PCR verification is performed using sequencing primers, and then the plasmid that may be correct is selected for sequencing, and the sequencing results are compared, so that the correct point mutation recombinant plasmid pRS426-CYP512W2s-G418r can be obtained. The sequencing primers used are shown in Table 2:
[0065] Table 3 Sequence list of sequencing primers for verifying the correctness of the recombinant plasmid pRS426-CYP512W2s-G418r containing point mutations and combined mutations Primer name Serial Number Sequence(5'to3') 512W2-Seq-F SEQ ID No.55 GCCAATACTTCACAATGTTC 512W2-Seq-R SEQ ID No.56 TCATTTTGTCATTGACCTTC
[0066] 6.3) The correctly sequenced recombinant plasmid pRS426-CYP512W2s-G418r obtained above was transformed into the recombinantly modified Saccharomyces cerevisiae cells SC-62 by the lithium acetate method (Gietz, RD, et al., Nat Protoc, 2007.2(1):31-4) (the same effect can be achieved by using the yeast transformation kit (Frozen-EZYeast Transformation II, ZYMO RESEARCH)), and the transformed yeast was spread on SC-His-Ura-Trp (SC-HUT) solid medium (SC Dropout Medium without Ura-His-Leu-Trp, 7.9 g / L; glucose, 20 g / L; leucine, 0.1 g / L agar powder, 20 g / L) for culture at 30°C for 1.5 to 3 days. When transformants appeared, single clones were picked to obtain Saccharomyces cerevisiae strains SC62-I108A, SC62-V112L, SC62-M114A, SC62-M210A, SC62-M213R, SC62-L294A, SC62-I361G, SC62-S362G, SC62-I364A, SC62-Y482F, SC62-I108A-Y482F, SC62-M114A-M213R, SC62-M114A-L294A, SC62-M213R-L294A, and SC62-M114A-M213R-L294A.
[0067] Step 4: Screening of mutants using fermentation of Saccharomyces cerevisiae transformants
[0068] The yeast transformants of the CYP512W2 gene containing point mutations and combined mutations were fermented, and the empty plasmid strain without the CYP512W2 gene was used as a control. By comparing the differences in metabolites after fermentation, the mutants that may have good catalytic activity and selectivity were preliminarily screened. The specific operation is as follows:
[0069] 4.1) Test tube fermentation
[0070] 4.1.1) The yeast transformants of the CYP512W2 gene containing point mutations and combined mutations constructed in Example 3 were transferred to 15 mL test tubes containing 3 mL SC-His-Ura-Trp (SC-HUT) liquid medium (SC Dropout Medium without Ura-His-Leu-Trp, 4.9 g / L; glucose, 20 g / L; leucine, 0.1 g / L agar powder, 20 g / L) and cultured at 30°C and 220 rpm until OD 600 About 2.5-3.5;
[0071] 4.1.2) The cultured bacterial solution was diluted with an initial OD 600 =0.05 liquid was transferred to a test tube containing 3 mL of YPD24 fermentation medium (yeast powder 10 g / L, beef peptone 20 g / L, glucose 20 g / L, glycerol 40 g / L) containing antibiotic G418 at a concentration of 200 mg / L, and cultured at 30°C and 220 rpm for 120 hours;
[0072] 4.1.3) After 5 days of fermentation, 1 mL of fermentation broth was mixed with an equal volume of ethyl acetate for extraction, shaken by Votex for 3 min, centrifuged at 12,000 rpm for 10 min, the supernatant was taken, evaporated, and redissolved in methanol. The supernatant was filtered through a 0.22 μm syringe filter to obtain the crude extract of the recombinant strain after fermentation, and the fermentation product was then detected and analyzed by HPLC.
[0073] 4.1.4) The catalytic activity and selectivity of the mutant strain were preliminarily determined by observing the contents of ganoderic acid HLDOA, ganoderic acid Y and ganoderic acid Jb in the HPLC spectrum of the fermentation product.
[0074] 4.2) Shake flask fermentation
[0075] 4.2.1) The yeast transformants of the CYP512W2 gene containing point mutations and combined mutations constructed in Example 3 were transferred to 15 mL test tubes containing 3 mL SC-His-Ura-Trp (SC-HUT) liquid medium (SC-HUT medium without Ura-His-Leu-Trp, 4.9 g / L; glucose, 20 g / L; leucine, 0.1 g / L agar powder, 20 g / L) and cultured at 30°C and 220 rpm until OD 600 About 2.5-3.5;
[0076] 4.2.2) The cultured bacterial solution was diluted to the initial OD 600=0.05 liquid was transferred to a 250 mL conical flask containing 50 mL YPD24 fermentation medium (10 g / L yeast powder, 20 g / L beef peptone, 20 g / L glucose, 40 g / L glycerol) containing 100 mg / L antibiotic G418, and cultured at 30 ° C and 220 rpm for 120 hours;
[0077] 4.2.3) Record OD every 24 hours 600 , and 1 mL of fermentation broth at 48, 72, 96, and 120 hours of fermentation was taken, mixed with an equal volume of ethyl acetate for extraction, Votex shaken for 3 minutes, centrifuged at 12,000 rpm for 10 minutes, the supernatant ethyl acetate layer was taken, and the lower layer was repeatedly extracted with ethyl acetate, and then the ethyl acetate after the two extractions was combined, evaporated with a nitrogen blower or evaporated at room temperature, the residue was dissolved with chromatographic grade methanol, and the supernatant was filtered through a 0.22 μm syringe filter to obtain the crude extract after fermentation of the recombinant strain, and then the fermentation product was detected and analyzed by HPLC.
[0078] Step 5: HPLC detection of fermentation products of Saccharomyces cerevisiae mutants
[0079] 5.1) HPLC analysis of fermentation products:
[0080] Instrument: Agilent 1260 Infinity II HPLC analysis system, DAD (Diode array detector) detector.
[0081] Chromatographic column: Kinetex Biphenyl analytical column (2.6μm, 150mm×4.6mm, Phenomenex, Torrance, CA).
[0082] Column temperature: 30°C; flow rate: 1 mL / min; injection volume: 20 μL, detection wavelength: 210 nm.
[0083] Phase A: ultrapure water, phase B: methanol (containing 0.1% acetic acid).
[0084] The gradient elution program was as follows: the proportion of mobile phase B increased from 80% to 100% within 30 min, and then eluted with 100% mobile phase B for 5 min.
[0085] 5.2) By comparing the HPLC peaks of the fermentation products with those of the empty plasmid control strain and the wild-type strain, the contents of ganoderic acid HLDOA, ganoderic acid Y and ganoderic acid Jb in the HPLC spectrum of the fermentation products were observed to preliminarily determine the catalytic activity and selectivity of the point mutant strain.
[0086] The selectivity, conversion rate and yield of ganoderic acid Jb and ganoderic acid Y of each single mutant Saccharomyces cerevisiae strain obtained above compared with WT are shown in Table 4:
[0087] Table 4
[0088] Selectivity (Jb / Y) [a]
[0089] Conversion Rate % [b]
[0090] Comparison of yield between Jb / Y and SC62-WT%
[0091] aSelectivity refers to the ratio of the titer of ganoderic acid Jb or ganoderic acid Y to the total titer of ganoderic acid Jb or ganoderic acid Y; bConversion rate refers to the ratio of the consumed ganoderic acid HLDOA (the difference between the ganoderic acid HLDOA titer of strain SC62-CK and the ganoderic acid HLDOA titer of the corresponding mutant) to the total titer of ganoderic acid HLDOA (ganoderic acid HLDOA produced by strain SC62-CK). Significance: *p<0.05; ** p<0.01.
[0092] The selectivity, conversion rate and yield of ganoderic acid Jb and ganoderic acid Y of each combined mutant Saccharomyces cerevisiae strain obtained above compared with WT are shown in Table 5:
[0093] Table 5
[0094] Selectivity (Jb / Y) [a]
[0095] Conversion Rate % [b]
[0096] Comparison of yield between Jb / Y and SC62-WT%
[0097] aSelectivity refers to the ratio of the titer of ganoderic acid Jb or ganoderic acid Y to the total titer of ganoderic acid Jb or ganoderic acid Y; bConversion rate refers to the ratio of the consumed ganoderic acid HLDOA (the difference between the ganoderic acid HLDOA titer of strain SC62-CK and the ganoderic acid HLDOA titer of the corresponding mutant) to the total titer of ganoderic acid HLDOA (ganoderic acid HLDOA produced by strain SC62-CK). Significance: *p<0.05; ** p<0.01.
[0098] In summary, the membrane-anchored promiscuous cytochrome P450 was rationally designed, and point mutations were designed from two aspects: the substrate active pocket and the import and export channels. The plasmid of the CYP512W2 gene containing the designed point mutation site was obtained by cloning and construction, and by expressing it in cerevisiae, some mutants that can efficiently biosynthesize gingival linguistic acid Jb or ganoderic acid Y were screened. The present invention is expected to continue to explore the transformation of membrane-anchored promiscuous cytochrome P450 and lay the foundation for the large-scale production of ganoderic acid. Therefore, the present invention is a rational design engineering technology for membrane-anchored promiscuous cytochrome P450 with production and scientific research prospects.
[0099] The above-mentioned specific implementation can be partially adjusted in different ways by those skilled in the art without departing from the principle and purpose of the present invention. The protection scope of the present invention shall be based on the claims and shall not be limited by the above-mentioned specific implementation. Each implementation scheme within its scope shall be subject to the constraints of the present invention.
Claims
1. A method for optimizing the yield of active ganoderic acid based on modified membrane anchoring, characterized in that: Based on the structure of CYP512W2 predicted by AlphaFold2, several key amino acids were selected by computer-aided design to guide the modification of P450 membrane protein CYP512W2 and enzyme molecular modification to increase the production of triterpenoid compounds in Ganoderma lucidum; The amino acid sequence of the P450 membrane protein CYP512W2 is shown in SEQ ID No.
2.
2. The method for optimizing the yield of active ganoderic acid based on modified membrane anchoring according to claim 1, characterized in that: The key amino acids are selected in the following manner: a) The binding free energy decomposition contribution of the amino acid site calculated by the MMPBSA method is greater than 0.8 kcal / mol, among which the sites with poor conservatism are selected for further experimental verification; b) selecting the important amino acids located in the substrate entry channel; c) comparing with CYP512A2 and selecting amino acids under the guidance of the CYP512A2 entry channel; d) Supplementary selection of residues with low binding energy at the substrate entrance and active site was performed as follows: MD simulation was performed using pmemd.cudaAmber 18, the complex structures in all systems were minimized for 5000 cycles according to the conjugate gradient, only the solvent and H atoms were allowed to move, and then run without restrictions for 5000 cycles; heating was performed from 0 K to 300 K within 100 ps, and then equilibrium was performed for 200 ps in constant pressure and constant temperature mode; finally, three 100 ns classical molecular dynamics experiments were performed for each system to obtain the residues with low binding energy at the active site.
3. The method for optimizing the yield of active ganoderic acid based on modified membrane anchoring according to claim 2, characterized in that: In the classical molecular dynamics experiment, the SHAKE algorithm is used to constrain the movement of water molecules and maintain a fixed angle between hydrogen atoms.
4. The method for optimizing the yield of active ganoderic acid based on modified membrane anchoring according to claim 2, characterized in that: In the classical molecular dynamics experiment described above, the particle grid Ewald method is used.
5. The method for optimizing the yield of active ganoderic acid based on modified membrane anchoring according to claim 2, characterized in that: In the classical molecular dynamics experiment described above, the cutoff distances for Lennard-Jones and electrostatic interactions are 6. The method for optimizing the yield of active ganoderic acid based on modified membrane anchoring according to any one of claims 1 to 5, characterized in that: The key amino acids include: the nucleotide sequence and amino acid sequence of wild-type CYP512W2 and its point mutations: I108A, V112L, M114A, M210A, M213R, L294A, I361G, S362G, I364A, Y482, I108A-Y482F, M114A-M213R, M114A-L294A, M213R-L294A, and M114A-M213R-L294A, and its nucleotide sequence and point mutation amino acid sequence are shown in Seq ID No.1-Seq ID No.
32.
7. The method for optimizing the yield of active ganoderic acid based on modified membrane anchoring according to claim 6, characterized in that: The enzyme molecule modification refers to: introducing nucleic acid molecules into host cells through homologous recombination, gene editing or other gene recombination techniques known in the art to achieve the transformation or modification of host cells so that they can produce Ganoderma triterpenoid compounds; The host cell uses a fermentation medium YPD24 fermentation medium containing geneticin G418.
8. The method for optimizing the yield of active ganoderic acid based on modified membrane anchoring according to claim 6, characterized in that: The method for increasing the yield of triterpenoid compounds of Ganoderma lucidum refers to: adopting a heterologous biological expression method, that is, culturing a recombinant Saccharomyces cerevisiae strain that overexpresses ganoderic acid HLDOA, and catalyzing ganoderic acid HLDOA to generate ganoderic acid Y or ganoderic acid Jb, specifically: using CYP512W2 from Ganoderma lucidum as a template, obtaining various mutants of CYP512W2 by PCR amplification, and recombining and connecting the expression vector pRS426, CYP coding region sequence fragment, yeast HXT7p promoter, yeast FBA1t terminator and KanMX gene expression frame containing truncated promoter Ura3 (tP-Ura3) by homologous recombination and other methods to obtain a series of recombinant expression plasmids pRS426-CYP512W2s-G418r, introducing the recombinantly modified Saccharomyces cerevisiae into the fermentation after fermentation screening, and performing yield screening on the obtained products to determine the high-yield mutant strains, wherein: s represents different point mutation genes of CYP512W2.
9. The method for optimizing the yield of active ganoderic acid based on modified membrane anchoring according to claim 8, characterized in that: The fermentation screening specifically refers to: after introducing each expression plasmid into the recombinantly modified Saccharomyces cerevisiae through a standard lithium acetate transformation method or a yeast transformation kit, fermenting through YPD24 medium, then extracting the bacterial precipitate of the fermentation product through ethyl acetate, and finally analyzing the extract through HPLC method to compare the yield and selectivity of ganoderic acid HLDOA, ganoderic acid Y and ganoderic acid Jb with the wild-type strain, so as to preliminarily determine whether the designed mutant is a high-yield mutant.
10. The method for optimizing the yield of active ganoderic acid based on modified membrane anchoring according to claim 9, characterized in that: The YPD24 culture medium comprises 10 g / L yeast powder, 20 g / L beef peptone, 20 g / L glucose and 40 g / L glycerol. For the saccharomyces cerevisiae containing the yeast expression plasmid pRS426-CYP512Ws-G418r, 100 mg / L or 200 mg / L geneticin G418 is added to the culture medium at the same time.