PiRNA marker related to colorectal cancer and application thereof

Abstract

The invention discloses a piRNA marker related to colorectal cancer and application of the piRNA marker. The nucleotide sequence of the piRNA is shown as SEQ ID NO: 1. The piRNA molecule provided by the invention can be used as a marker for diagnosing the colorectal cancer, and the colorectal cancer can be accurately detected by detecting the piRNA molecule; meanwhile, by inhibiting expression of piRNA molecules, proliferation, invasion and metastasis of colorectal cancer cells can be effectively inhibited, and a novel powerful molecular biological tool is provided for treatment of colorectal cancer. The method has profound clinical significance and important popularization and application prospects.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a piRNA marker associated with colorectal cancer and an application thereof. Background Art

[0002] Colorectal cancer (CRC) is a malignant lesion of the colon mucosal epithelium caused by a variety of carcinogenic factors such as the environment or genetics. It is a malignant tumor with a very high mortality rate in the world. Globally, colorectal cancer remains one of the tumors with the highest incidence and mortality. Common sites of onset include the rectum, sigmoid colon, cecum, ascending colon, descending colon and transverse colon. According to the site of onset, colorectal cancer is generally divided into three types: right colon (cecum, ascending colon, transverse colon) cancer, left colon (descending colon, sigmoid colon) cancer and rectal cancer.

[0003] piRNA (piwi-interacting RNA) is a new type of non-coding small RNA first discovered in male germ cells in 2006 after siRNA and miRNA. It is usually 26-31nt in length, has a strong uracil preference at the 5' end, and has more than 50,000 species. Past studies once believed that piRNA was unique to germ cells, so they mainly focused on the functional research of piRNA in germ cells. Existing research results show that piRNA is mainly involved in the development of germ cells, the silencing of transposons, the formation of heterochromatin, and the maintenance of germ cell DNA integrity. In 2012, a study published in the journal Cell discovered piRNA expressed in the brain of Aplysia, which regulates the memory function of neurons by regulating the DNA methylation of CREB protein. As a result, researchers have attracted interest in the functional research of piRNA in non-germ cells.

[0004] Currently, there are very few studies on piRNAs associated with colorectal cancer, and therefore there is an urgent need to provide a piRNA associated with colorectal cancer. Summary of the invention

[0005] The present invention aims to solve at least one of the technical problems existing in the above-mentioned prior art. To this end, the present invention proposes a piRNA related to colorectal cancer.

[0006] The present invention also provides a reagent for detecting the above piRNA.

[0007] The present invention also provides the application of the above reagent.

[0008] The present invention also provides a piRNA inhibitor.

[0009] The present invention also provides the application of the above piRNA inhibitor.

[0010] The invention also provides a medicine for treating colorectal cancer.

[0011] According to the first aspect of the present invention, a piRNA related to colorectal cancer is proposed, and the nucleic acid sequence of the piRNA is shown in SEQ ID NO: 1. The piRNA of the present invention, i.e., has-piR-182386 molecule, can be used to accurately detect colorectal cancer, and as a marker for diagnosing colorectal cancer, inhibiting the expression of has-piR-182386 molecule has the effect of inhibiting the proliferation, migration and invasion of colorectal cancer cells, and can effectively treat colorectal cancer.

[0012] According to a second aspect of the present invention, a reagent for detecting the above-mentioned piRNA is provided, wherein the reagent comprises a primer and / or a probe.

[0013] In some embodiments of the present invention, the sequences of the primers are shown in SEQ ID NO:3 and SEQ ID NO:4.

[0014] In some embodiments of the present invention, the reagents further include PCR detection reagents.

[0015] In some embodiments of the present invention, the PCR detection reagent is a real-time fluorescence quantitative PCR detection reagent.

[0016] In some embodiments of the present invention, the PCR detection reagent also includes a reverse transcription primer.

[0017] In some embodiments of the present invention, the sequence of the reverse transcription primer is shown as SEQ ID NO:2.

[0018] According to the third aspect of the present invention, the use of the above-mentioned piRNA or reagent in any one of the following a1) to a3) is proposed:

[0019] a1) Preparation of products for the treatment or adjuvant treatment of colorectal cancer;

[0020] a2) preparing products for detecting colorectal cancer;

[0021] a3) Preparation and screening of products for the treatment or adjuvant treatment of colorectal cancer.

[0022] In some embodiments of the present invention, the product includes at least one of a drug, a kit, a chip or a detection device.

[0023] In some embodiments of the present invention, the treatment or adjuvant treatment of colorectal cancer includes inhibiting cancer cell proliferation and / or inhibiting cancer cell migration and invasion.

[0024] According to a fourth aspect of the present invention, a piRNA inhibitor is provided, wherein the piRNA inhibitor is at least one of a substance that inhibits piRNA activity, a substance that degrades piRNA, or a substance that reduces piRNA expression level;

[0025] The nucleic acid sequence of the piRNA is shown in SEQ ID NO: 1.

[0026] In some embodiments of the present invention, the substance that reduces the expression level of piRNA is at least one of b1)-b3):

[0027] b1) siRNA, dsRNA, miRNA, ribozyme or shRNA targeting piRNA;

[0028] b2) a nucleic acid molecule encoding the siRNA, dsRNA, miRNA, ribozyme or shRNA targeting piRNA described in b1);

[0029] b3) An expression cassette, a vector or a transgenic cell line comprising the nucleic acid molecule described in b2).

[0030] In some embodiments of the present invention, the nucleotide sequence of the substance that reduces the expression level of piRNA is shown as SEQ ID NO:7.

[0031] According to a fifth aspect of the present invention, a use of the above-mentioned piRNA inhibitor in the preparation of a product for the treatment or adjuvant treatment of colorectal cancer is proposed.

[0032] In some embodiments of the invention, the product comprises a pharmaceutical product.

[0033] In some embodiments of the present invention, the treatment or adjuvant treatment of colorectal cancer includes inhibiting cancer cell proliferation and / or inhibiting cancer cell migration and invasion.

[0034] According to a sixth aspect of the present invention, a drug for treating colorectal cancer is provided, comprising the above-mentioned piRNA inhibitor.

[0035] In some embodiments of the present invention, the drug further comprises a pharmaceutically acceptable excipient.

[0036] In some embodiments of the present invention, the pharmaceutically acceptable excipients include at least one of a solvent, an excipient, a diluent, a binder, a disintegrant, a dispersant, a flavoring agent, a suspending agent, a surfactant, an isotonic agent, a thickener, an emulsifier, a preservative, a glidant or a lubricant.

[0037] In some embodiments of the present invention, the dosage form of the drug includes an oral dosage form, an injection dosage form, and an inhalation dosage form.

[0038] In some embodiments of the present invention, the release form of the drug is immediate release, delayed release, sustained release or controlled release.

[0039] According to some embodiments of the present invention, at least the following beneficial effects are achieved: the present invention provides a new piRNA molecule that can be used as a marker for diagnosing colorectal cancer, and colorectal cancer can be accurately detected by detecting piRNA molecules; at the same time, inhibiting the expression of piRNA molecules can effectively inhibit the proliferation, invasion, and metastasis of colorectal cancer cells, providing a new and powerful molecular biological tool for the treatment of colorectal cancer. It has far-reaching clinical significance and important prospects for promotion and application. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0041] Figure 1 This is a diagram showing the results of the has-piR-182386 molecule expression detection in normal colorectal cells and colorectal cancer cells in an embodiment of the present invention;

[0042] Figure 2 This is a diagram showing the results of has-piR-182386 molecule expression detection in normal colorectal cancer adjacent tissue and colorectal cancer tissue in an embodiment of the present invention;

[0043] Figure 3 It is a ROC curve diagram in an embodiment of the present invention;

[0044] Figure 4 This is a diagram showing the detection result of the effect of overexpression on the expression of has-piR-182386 molecules in the embodiment of the present invention, wherein "***" indicates p < 0.001;

[0045] Figure 5 This is a test result diagram of the effect of the inhibitor in the embodiment of the present invention on the expression of has-piR-182386 molecule, wherein "***" indicates p < 0.001;

[0046] Figure 6 This is a graph showing the results of the HCT116 cell scratch healing experiment in an embodiment of the present invention, wherein “***” indicates p<0.001;

[0047] Figure 7 This is a graph showing the results of the HT29 cell scratch healing experiment in an embodiment of the present invention, wherein “**” indicates p<0.01;

[0048] Figure 8 This is a diagram showing the results of a clone-forming cell proliferation experiment in an example of the present invention, wherein "***" indicates p < 0.001. DETAILED DESCRIPTION

[0049] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0050] Example 1 A piRNA marker associated with colorectal cancer

[0051] This embodiment provides a piRNAs marker associated with colorectal cancer, and the screening process is: piRNA molecules are obtained by high-throughput sequencing screening, and the piRNA is named: has-piR-182386, and the sequence is: GTGAATTGTTTAGGACCACTAAAA (as shown in SEQ ID NO: 1).

[0052] Example 2 Application of has-piR-182386 in the preparation of reagents for diagnosing colorectal cancer

[0053] 1. Cell expression detection

[0054] Real-time fluorescence quantitative PCR was used to detect the expression of has-piR-182386 molecules in normal colorectal epithelial cells (NCM460 cells) and colorectal cancer cells (LoVo cells, RKO cells, HT29 cells, HCT8 cells, HCT116 cells, CACO2 cells). The specific experimental process is as follows:

[0055] (1) RNA was extracted from normal colorectal epithelial cells and colorectal cancer cells using the Trizol method. The specific process is as follows:

[0056] 1) Add 1 mL of Trizol and pipette down the cells in a six-well plate;

[0057] 2) Add 0.2 mL of chloroform, vortex for 15 seconds, place on ice for 5 minutes, and centrifuge at 12,000 g at 4°C for 15 minutes;

[0058] 3) Place the upper aqueous phase in a new enzyme-free EP tube, add 0.5 mL of isopropanol, place on ice for 10 min, and centrifuge at 12,000 g at 4°C for 10 min;

[0059] 4) Discard the supernatant, add 1 mL of 75% ethanol to wash, vortex to mix, centrifuge at 7500g (2°C-8°C) for 5 min, discard the supernatant, and repeat once;

[0060] 5) Allow the precipitated RNA to dry at room temperature for 6-10 minutes;

[0061] 6) Add 15-30 μL of DECP water to each tube of sample, measure the concentration and then proceed with the subsequent reverse transcription experiment.

[0062] (2) Reverse transcription reaction

[0063] The reverse transcription reaction was carried out using the stem-loop method to reverse transcribe RNA into cDNA. The primer used for reverse transcription was: 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTTTTAG-3' (as shown in SEQ ID NO: 2).

[0064] The reverse transcription reaction system was as follows: RNA: 1 μg, reverse transcription primer (10 μM) 0.5 μL, U6 downstream primer (10 μM) 0.5 μL, 5×miRNA RT (Stem-loop) Buffer 4 μL, miRNA RT Enzyme Mix 2 μL, and enzyme-free water to make up to 20 μL.

[0065] The reverse transcription reaction procedure is shown in Table 1 below.

[0066] Table 1

[0067] temperature Reaction time 25℃ 5min 42℃ 15min 85℃ 5sec 4℃ —

[0068] (3) Real-time quantitative PCR reaction

[0069] The primers for real-time quantitative PCR detection of has-piR-182386 are:

[0070] Upstream primer: 5'-GCGGTGAAATGTTTAGGACCA-3' (as shown in SEQ ID NO: 3);

[0071] Downstream primer: 5'-AGTGCACGCTCCGAGGTATT-3' (as shown in SEQ ID NO: 4).

[0072] The total system of real-time fluorescence quantitative PCR reaction was: 2×SYBR Green MIX 10 μL, upstream and downstream primers (10 mM): 1 μL each, cDNA template obtained by reverse transcription 2 μL, supplemented to 20 μL with enzyme-free water;

[0073] The reaction procedure was: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 60°C for 5 s, and extension at 70°C for 10 s, for a total of 40 cycles, followed by melting curve analysis: fluorescence signals were collected at temperatures of 70°C-95°C.

[0074] The internal reference gene is U6, and the primer sequence for detecting the internal reference gene is:

[0075] Upstream primer: 5'-GGAACGATACAGAGAAGATTAGC-3' (as shown in SEQ ID NO: 5);

[0076] Downstream primer: 5'-TGGAACGCTTCACGAATTTGCG-3' (as shown in SEQ ID NO: 6).

[0077] Test results such as Figure 1 As shown in the figure, it can be seen that the has-piR-182386 molecule is significantly highly expressed in colorectal cancer cells compared with normal colorectal cells.

[0078] 2. Clinical testing and verification

[0079] Sample information: 15 pairs of cancer tissue and adjacent tissue were collected from patients diagnosed with colorectal cancer in the clinic, all of whom provided informed consent.

[0080] Real-time fluorescence quantitative PCR was used to detect the expression of has-piR-182386 molecules in cancer tissues and adjacent tissues of colorectal cancer patients and colorectal tissues of healthy subjects. The specific experimental process is as follows:

[0081] (1) RNA extraction was performed using the Trizol method. The specific process is as follows:

[0082] 1) Grind the tissue with a grinder filled with liquid nitrogen, add 1 mL of Trizol, and collect the tissue homogenate;

[0083] 2) Add 0.2 mL of chloroform, vortex for 15 seconds, place on ice for 5 minutes, and centrifuge at 12,000 g at 4°C for 15 minutes;

[0084] 3) Place the upper aqueous phase in a new enzyme-free EP tube, add 0.5 mL of isopropanol, place on ice for 10 min, and centrifuge at 12,000 g at 4°C for 10 min;

[0085] 4) Discard the supernatant, add 1 mL of 75% ethanol to wash, vortex to mix, centrifuge at 7500g (2°C-8°C) for 5 min, discard the supernatant, and repeat once;

[0086] 5) Allow the precipitated RNA to dry at room temperature for 6-10 minutes;

[0087] 6) Add 15-30 μL of DECP water to each tube of sample, measure the concentration and then proceed with the subsequent reverse transcription experiment.

[0088] (2) Reverse transcription reaction

[0089] The reverse transcription reaction was carried out using the stem-loop method to reverse transcribe RNA into cDNA. The reverse transcription primer was: 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTTTTAG-3' (as shown in SEQ ID NO: 2).

[0090] The reverse transcription reaction system was as follows: RNA: 1 μg, reverse transcription primer (10 μM) 0.5 μL, U6 downstream primer (10 μM) 0.5 μL, 5×miRNA RT (Stem-loop) Buffer 4 μL, miRNA RT Enzyme Mix 2 μL, and enzyme-free water to make up to 20 μL.

[0091] The reverse transcription reaction procedure is shown in Table 2 below.

[0092] Table 2

[0093]

[0094]

[0095] (3) Real-time quantitative PCR reaction

[0096] The primers for real-time quantitative PCR detection of has-piR-182386 are:

[0097] Upstream primer: 5'-GCGGTGAAATGTTTAGGACCA-3' (as shown in SEQ ID NO: 3);

[0098] Downstream primer: 5'-AGTGCACGCTCCGAGGTATT-3' (as shown in SEQ ID NO: 4).

[0099] The total system of real-time fluorescence quantitative PCR reaction was: 2×SYBR Green MIX 10 μL, upstream and downstream primers (10 mM): 1 μL each, cDNA template 2 μL, and supplemented to 20 μL with enzyme-free water;

[0100] The reaction procedure was: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 60°C for 5 s, and extension at 70°C for 10 s, for a total of 40 cycles, followed by melting curve analysis: fluorescence signals were collected at temperatures of 70°C-95°C.

[0101] The internal reference gene is U6, and the primer sequence for detecting the internal reference gene is:

[0102] Upstream primer: 5'-GGAACGATACAGAGAAGATTAGC-3' (as shown in SEQ ID NO: 5);

[0103] Downstream primer: 5'-TGGAACGCTTCACGAATTTGCG-3' (as shown in SEQ ID NO: 6).

[0104] The results are as follows Figure 2-3 As shown in the figure, it can be seen that the has-piR-182386 molecule is significantly more expressed in colorectal cancer tissues than in normal colorectal tissues, and can accurately distinguish colorectal cancer tissues from normal tissues. The ROC diagnostic curve AUC = 0.796, CI = 0.635-0.956, the sensitivity is 0.86667, and the specificity is 0.66667. The results show that the has-piR-182386 molecule has diagnostic significance in colorectal cancer.

[0105] Example 3 An expression inhibitor of has-piR-182386 molecule

[0106] This example provides an expression inhibitor of the has-piR-182386 molecule, the sequence of which is as follows:

[0107] has-piR-182386inhibitor sequence: UUUUAGUGGUCCUAAACAUUUCAC (as shown in SEQ ID NO: 7).

[0108] Example 4 Application of the has-piR-182386 molecule expression inhibitor in the preparation of products for inhibiting colorectal cancer

[0109] This example provides an application of an expression inhibitor of a has-piR-182386 molecule in the preparation of a product for inhibiting colorectal cancer. The specific verification process is as follows:

[0110] (1) Artificially synthesizing mimics of the has-piR-182386 molecule, the nonsense sequence of the mimics, mimics-NC, an inhibitor (the sequence is shown in SEQ ID NO: 7), and the nonsense sequence of the inhibitor, Inhibitor-NC.

[0111] The mimics sequences are: sense: GUGAAAUGUUUAGGACCACUAAAA (as shown in SEQ ID NO: 8); antisense: UUAGUGGUCCUAAACAUUUCACUU (as shown in SEQ ID NO: 9).

[0112] The sequences of mimics-NC are: sense: 5'-UUCUCCGAACGUGUCACGUTT-3' (as shown in SEQ ID NO: 10); antisense: 5'-ACGUGACACGUUCGGAGAATT-3' (as shown in SEQ ID NO: 11).

[0113] The sequence of Inhibitor-NC is: CAGUACUUUUUGUGUAGUACAA (as shown in SEQ ID NO: 12).

[0114] (2) Cell transfection:

[0115] 1) Take human colorectal cancer cells HCT116 and HCT29 with good growth status and a confluence of about 80% and inoculate them into a well plate, culture them in an incubator at 37°C and 5% CO2 for 12-20 hours, and start transfection when the cells grow to a confluence of 40%-50%;

[0116] 2) Add 5 μL of Lipofectamine 3000 reagent and 50 nM mimics or inhibitor to a sterile EP tube and mix well in 200 μL DMEM medium and let stand for 20 minutes;

[0117] 3) While the liposome transfection reagent is still, wash the cells twice with PBS, add 1.80 mL of complete medium (without double antibody), add the above liposome mixture to the well plate, shake well, and culture in a 37°C, 5% CO2 incubator for 36-72 hours.

[0118] (3) Reverse transcription reaction

[0119] Prepare the reverse transcription reaction system: RNA: 1 μg, reverse transcription primer (sequence as shown in SEQ ID NO: 2) (5 μM) 1 μL, 5×RT Mix Buffer 2 μL, RT Enzyme Mix 2 μL, enzyme-free water to 10 μL.

[0120] The reverse transcription reaction procedure is shown in Table 1. After the reaction is completed, the product is taken out and placed on ice for subsequent real-time fluorescence quantitative PCR reaction, and the excess sample is stored at -20°C.

[0121] (4) Real-time quantitative PCR (qRT-PCR)

[0122] The total reaction system was prepared as follows: 10 μL of 2×SYBR Green MIX, 1 μL of each of the upstream and downstream primers (10 mM) (sequences are the same as in Example 2), 2 μL of cDNA template, and the mixture was made up to 20 μL with enzyme-free water;

[0123] The reaction procedure was: 95℃5min pre-denaturation, 95℃30s denaturation, 60℃5s annealing, 70℃10s extension, 40 cycles in total, and then melting curve analysis: the temperature was 70℃-95℃ to collect fluorescence signals. After the reaction was completed, the amplification curve and melting curve of qRT-PCR were confirmed, and the expression intensity of each gene was standardized according to the CT value (threshold cycle values) and the internal reference gene (U6) and then 2 -△△ct Computation of gene expression.

[0124] The results are as follows Figure 4-5 As shown in the figure, it can be seen that the has-piR-182386 molecule was successfully overexpressed or knocked down in colorectal cancer cells.

[0125] (5) Scratch healing assay to verify the effect of has-piR-182386 on the invasion and migration of transfected colorectal cancer cells HCT116 and HCT29

[0126] The steps of the scratch test are as follows:

[0127] 1) In advance, cells with healing rates close to 100% (colorectal cancer cells HCT116 and HT29 transfected with inhibitor, inhibitor-NC and mimics, mimics-NC, respectively, with the same transfection steps as (2) inhibition) were cultured in a medium containing 2% FBS for 12 h;

[0128] 2) Use a 10 μL pipette tip to make a “+” scratch in each well of a 6-well plate, and wash the cells five times with PBS until there are almost no suspended cells under a microscope;

[0129] 3) Remove PBS and add 2 mL of culture medium containing 2% serum to each well;

[0130] 4) Observe the healing of the scratches under an inverted microscope at the same time every day, take photos, and keep records;

[0131] 5) Use Image-Pro Plus image analysis software to analyze the scratch distance and obtain the average width of the scratch.

[0132] The results are as follows Figure 6-7 As shown in the figure, it can be seen that the scratch healing experiment shows that overexpression of has-piR-182386 molecules promotes the invasion and migration of colorectal cancer cells; inhibition of has-piR-182386 molecule expression inhibits the invasion and migration of colorectal cancer cells.

[0133] (5) Effects of overexpression or inhibition of has-piR-182386 on the proliferation of colorectal cancer cells

[0134] Experimental methods:

[0135] 1) Inoculate 6-well plates with inhibitor-transfected colorectal cancer cells HCT116 and mimics-transfected colorectal cancer cells HT29 prepared by cell transfection in (2) above, with 1×10 3 Each well has 2 mL of cell suspension, and each group has 4 replicate wells. The cells are evenly seeded in a 6-well plate, and the 6-well plate with cells is placed in a cell culture incubator at 37°C with 5% CO2 for culture;

[0136] 2) Detect clone formation after 10 days of culture.

[0137] The results of the effects of overexpression or inhibition of has-piR-182386 on the proliferation of colorectal cancer cells are as follows Figure 8 As shown in the figure, it can be seen that overexpression of has-piR-182386 promotes the proliferation of colorectal cancer cells HT29, and NC is the blank control; inhibiting the expression of has-piR-182386 molecules can effectively inhibit the proliferation of colorectal cancer cells HCT116.

[0138] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A piRNA associated with colorectal cancer, characterized in that: The nucleic acid sequence of the piRNA is shown in SEQ ID NO:

1.

2. A reagent for detecting the piRNA according to claim 1, characterized in that: The reagents include primers and / or probes; Preferably, the sequences of the primers are shown in SEQ ID NO: 3 and SEQ ID NO: 4; More preferably, the reagents further include PCR detection reagents; More preferably, the PCR detection reagent also includes a reverse transcription primer.

3. Use of the piRNA according to claim 1 or the reagent according to claim 2 in any one of the following a1) to a3): a1) Preparation of products for the treatment or adjuvant treatment of colorectal cancer; a2) preparing products for detecting colorectal cancer; a3) Preparation of products for screening, treatment or adjuvant treatment of colorectal cancer; Preferably, the product includes at least one of a drug, a test kit, a chip or a detection device; Preferably, the treatment or adjuvant treatment of colorectal cancer includes inhibiting cancer cell proliferation and / or inhibiting cancer cell migration and invasion.

4. A piRNA inhibitor, characterized in that The piRNA inhibitor is at least one of a substance that inhibits piRNA activity, a substance that degrades piRNA, or a substance that reduces piRNA expression level; The nucleic acid sequence of the piRNA is shown in SEQ ID NO:

1.

5. The piRNA inhibitor according to claim 4, characterized in that The substance that reduces the expression level of piRNA is at least one of b1)-b3): b1) siRNA, dsRNA, miRNA, ribozyme or shRNA targeting piRNA; b2) a nucleic acid molecule encoding the siRNA, dsRNA, miRNA, ribozyme or shRNA targeting piRNA described in b1); b3) An expression cassette, a vector or a transgenic cell line comprising the nucleic acid molecule described in b2).

6. The piRNA inhibitor according to claim 4, characterized in that The nucleotide sequence of the substance that reduces the expression level of piRNA is shown in SEQ ID NO:

7.

7. Use of the piRNA inhibitor according to any one of claims 4 to 6 in the preparation of a product for the treatment or adjuvant treatment of colorectal cancer.

8. The use according to claim 7, characterized in that: The products include pharmaceutical products; And / or, the treatment or adjuvant treatment of colorectal cancer includes inhibiting cancer cell proliferation and / or inhibiting cancer cell migration and invasion.

9. A drug for treating colorectal cancer, characterized in that: Containing the piRNA inhibitor according to any one of claims 4 to 6.

10. The drug according to claim 9, characterized in that The drug also includes pharmaceutically acceptable excipients; Preferably, the pharmaceutically acceptable excipients include at least one of a solvent, an excipient, a diluent, a binder, a disintegrant, a dispersant, a flavoring agent, a suspending agent, a surfactant, an isotonic agent, a thickener, an emulsifier, a preservative, a glidant or a lubricant; And / or, the dosage form of the drug includes oral dosage form, injection dosage form, and inhalation dosage form.

Images