Application of piR-11510 in diagnosis, treatment and prognostic evaluation of non-small cell lung cancer bone metastasis

Abstract

The invention discloses application of piR-11510 in diagnosis, treatment and prognostic evaluation of non-small cell lung cancer bone metastasis, and belongs to the technical field of biological medicine. Based on the research of the invention, the piR-11510 can be used as a diagnostic marker of non-small cell lung cancer bone metastasis; the piR-11510 can also be used as a treatment target of non-small cell lung cancer bone metastasis, and targeted intervention of the piR-11510 can inhibit proliferation, invasion, metastasis and / or colonization of non-small cell lung cancer cells. Therefore, the piR-11510 is a potential molecular marker for specific diagnosis of non-small cell lung cancer bone metastasis, can be rapidly detected through a blood sample, and has good clinical value for diagnosis of non-small cell lung cancer bone metastasis and development of a clinical precise treatment scheme.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, and particularly relates to application of piR-11510 in diagnosis and treatment and prognosis evaluation of non-small cell lung cancer bone metastasis. BACKGROUND

[0002] Lung cancer is the highest incidence and mortality cancer in the world, and non-small cell lung cancer (NSCLC) is the most common cancer of lung cancer, accounting for about 80-85% of all lung cancer. More than 60% of NSCLC patients are diagnosed as advanced lung cancer, which is one of the most difficult to treat malignant tumors.

[0003] Bone is one of the most common target sites of NSCLC metastasis. NSCLC bone metastasis patients are prone to complications of skeletal related events (SREs), such as severe pain, pathological fracture, spinal compression and hypercalcemia, which will seriously affect the quality of life and survival cycle of patients. The mechanism of occurrence and development of NSCLC bone metastasis is not clear, and there is a dilemma in clinic, such as lack of specific diagnostic biomarkers and targeted NSCLC bone metastasis treatment methods. Finding new biomarkers has important clinical value for early screening and treatment of bone metastasis. Therefore, the prior art still needs to be improved and developed. SUMMARY

[0004] In view of the above deficiencies of the prior art, the present application aims to provide a brand new NSCLC bone metastasis diagnostic marker piR-11510, and realize the treatment effect of NSCLC bone metastasis by interfering with its expression. The present application is beneficial to the accurate diagnosis and targeted treatment of NSCLC bone metastasis, and can be used for preparing treatment drugs for NSCLC bone metastasis, so as to solve the problems of lack of serum biomarkers and imperfect treatment technology of NSCLC bone metastasis.

[0005] The present application first studies and finds that the expression level of piR-11510 in peripheral circulating blood of a non-small cell lung cancer (NSCLC) bone metastasis patient is significantly higher than that of a normal person and a NSCLC non-bone metastasis patient, and the expression difference has statistical significance. The high expression of piR-11510 is highly related to the occurrence and development of NSCLC bone metastasis, and can be used as a new early warning biomarker of the disease, and the expression level is positively correlated with poor prognosis of the patient. The expression of piR-11510 can be detected in serum samples, and the level is significantly increased in NSCLC bone metastasis patients and is positively correlated with tumor tissue expression; the expression of piR-11510 in normal human serum is extremely low and is well distinguished from the patient group. By knocking down the expression of piR-11510, the proliferation, migration and invasion ability of NSCLC cells can be significantly inhibited, and the differentiation of osteoclasts is reduced, thereby relieving bone destruction; in a nude mouse model, the administration of piR-11510 inhibitor antagopiR-11510 can effectively inhibit tumor growth, reduce bone surface area loss, increase bone mass, and reduce the number of osteoclasts. In addition, the expression level of piR-11510 can affect the tumor microenvironment, inhibit angiogenesis, and thus intervene in the process of NSCLC bone metastasis. This provides a new strategy and method for early diagnosis, prognosis evaluation and targeted treatment of NSCLC bone metastasis. The technical scheme of the present application is as follows: In a first aspect of the present application, the use of a reagent for detecting piR-11510 in the preparation of a product for diagnosing non-small cell lung cancer bone metastasis is provided, and the nucleotide sequence of the piR-11510 is TGAGTGACCTACAAAGAGACTTAGAATCCCA (as shown in SEQ ID No. 1).

[0006] Optionally, the product is a detection reagent or a detection kit.

[0007] Optionally, the reagent for detecting piR-11510 is a reagent for detecting the expression amount of piR-11510.

[0008] Optionally, the reagent for detecting piR-11510 is a reagent for detecting the expression amount of piR-11510 in serum. That is, piR-11510 refers to piR-11510 in serum, so that detection can be conveniently performed through blood samples.

[0009] In a second aspect of the present application, the use of a reagent for detecting piR-11510 in the preparation of a product for prognosis evaluation of non-small cell lung cancer bone metastasis is provided.

[0010] In a third aspect of the present application, the use of a piR-11510 expression inhibitor or a piR-11510 knockout reagent in the preparation of a drug for treating non-small cell lung cancer bone metastasis is provided.

[0011] Optionally, the drug is capable of inhibiting the proliferation, migration and invasion of non-small cell lung cancer cells, and down-regulating osteoclast differentiation, relieving bone destruction. And / or, the drug is capable of inhibiting tumor local angiogenesis, and interfering with the occurrence and development of non-small cell lung cancer bone metastasis by regulating tumor tissue microenvironment.

[0012] Optionally, the piR-11510 expression inhibitor is antagopiR-11510, and the nucleotide sequence of the antagopiR-11510 is shown in any one of SEQ ID No. 2-4. SEQ ID No. 2: GACCTACAAAGAGACTTAGAATCCCA SEQ ID No. 3: 5'-CUUAUGGGAGUCUAAGUCUCUUUGUAGGUCACUC AACCUmU(2'-O-methylated)-3' SEQ ID No. 4: 5'-CAGUACUUUUGUGUAGUACAAmA(2'-O-methylated)-3'.

[0013] The last uracil (U) at the 3' end of SEQ ID No. 3 is modified by 2'-O-methylation (2'-O-methylated) (annotated as mU in the sequence); The last adenosine (A) at the 3' end of SEQ ID No. 4 is modified by 2'-O-methylation (2'-O-methylated) (annotated as mA in the sequence).

[0014] The application of the piR-11510 expression inhibitor, the effective sequence is the reverse complementary sequence of the original sequence of piR-11510, therefore, any form of modification application based on or as an effective component, is within the protection scope of the present application.

[0015] In a fourth aspect of the present application, a drug for treating non-small cell lung cancer bone metastasis is provided, wherein the drug comprises a piR-11510 expression inhibitor or a piR-11510 knockout reagent.

[0016] The present application has the following effects: The present application first discovers that the expression level of piR-hsa-11510 (piR-11510) in the peripheral circulation of non-small cell lung cancer (NSCLC) bone metastasis patients is significantly higher than that of normal people and NSCLC patients without bone metastasis, and the expression difference has statistical significance. Therefore, piR-11510 can be used as a diagnostic marker for NSCLC bone metastasis for clinical detection of NSCLC bone metastasis.

[0017] The present application verifies the expression of piR-11510 in serum samples, and the expression level is significantly increased in NSCLC bone metastasis patients, and is positively correlated with tumor tissue expression; and the expression of piR-11510 in normal human serum is very low, and the discrimination degree with the patient group is significant. Therefore, early screening and dynamic monitoring of NSCLC bone metastasis can be directly detected by peripheral blood.

[0018] The present application proves by experiments that knocking down piR-11510 can significantly inhibit the proliferation, migration and invasion ability of NSCLC cells, and block the differentiation of osteoclasts; in a nude mouse model, the inhibitor antagopiR-11510 targeting piR-11510 can effectively inhibit tumor growth and relieve bone destruction. Therefore, piR-11510 can be used as a therapeutic target for developing targeted drugs for NSCLC bone metastasis.

[0019] Finally, the present application finds that piR-11510 affects the bone metastasis process by regulating tumor immune microenvironment and angiogenesis related factors. Its expression level is related to tumor microenvironment remodeling, so targeting piR-11510 can be combined with immunotherapy or radiotherapy and chemotherapy as a synergistic treatment strategy for NSCLC bone metastasis. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 The figure is the detection result of piRNA expression in normal people, NSCLC, and NSCLC bone metastasis patients.

[0021] Figure 2 The figure is the verification and piRNA target analysis result of piRNAs in whole blood samples.

[0022] Figure 3 The figure is the result of interfering with the expression level of piR-11510 to affect the proliferation and migration of NSCLC cells.

[0023] Figure 4 The figure is the result of interfering with piR-11510 to affect the activation of osteoclasts and the expression of key genes.

[0024] Figure 5 The figure is the result of interfering with piR-11510 to affect the subcutaneous tumor formation in nude mice.

[0025] Figure 6Figure 1 shows the results of intervention of piR-11510 on osteolytic bone destruction in nude mice.

[0026] Figure 7 Figure 2 shows the results of intervention of piR-11510 on osteoclast activation.

[0027] Figure 8 Figure 3 shows the results of intervention of piR-11510 on tumor epithelial-mesenchymal transition phenotype and abnormal vascular proliferation. DETAILED DESCRIPTION

[0028] The present application is further illustrated by the following description with reference to the accompanying drawings and specific examples. The examples do not limit the present application in any form. Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0029] Example 1 1. Experimental methods Peripheral blood samples of normal persons, NSCLC patients and NSCLC bone metastasis patients were collected, and piRNA expression profiles of NSCLC and NSCLC bone metastasis were established by piRNA microarray chip analysis. Through differential expression analysis of piRNA, prediction of target genes and functional analysis, piRNA highly related to NSCLC bone metastasis was screened. Bioinformatics analysis was performed by Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG).

[0030] The specific experimental steps are as follows: referring to the research of miRNA, combining two experimentally verified databases (miRTarBase and TarBase), using TargetScan and Miranda software to predict the target mRNA of piRNA. The detailed setting parameters of Miranda software are: score threshold: ≥90; energy threshold: ≤100 kcal / mol. The target genes of all species genes and differentially expressed piRNA were annotated and classified, GO analysis was performed, and the characteristics of biological functions of target genes were analyzed in three aspects of cellular component (CC), molecular function (MF) and biological process (BP). KEGG is a database based on the signal pathways in which genes are involved, and KEGG is used to perform enrichment analysis of the signal pathways in which the target genes are located. The enrichment significance of differentially expressed piRNA target genes in each pathway item is calculated using hypergeometric distribution test. Cytoscape is used to construct piRNA-mRNA interaction network diagram.

[0031] 2、Experimental results Principal Component Analysis (PCA) analysis showed that there were significant differences in piRNA expression among normal people (Ctrl), NSCLC (LC), and NSCLC bone metastasis (LCBM) patients. The contribution values of PCA1 and PCA2 were 30.20% and 14.59%, respectively, and the Ctrl group was significantly separated from the LCBM group (see Figure 1 Fig. 2A). There were significant differences in expression levels between the LCMB group and the LC group and between the LCMB group and the Ctrl group, and about 10,000 piRNAs were differentially expressed among the three groups of samples. According to the expression difference fold and statistical analysis, the volcano plot of differentially expressed piRNAs was screened by filtering the difference fold (|log2(FC)|>1) and FDR≤0.1 (see Figure 1 Fig. 2B-D). Through KEGG analysis of the ratio of the number of piRNA target genes enriched in the target pathway genes to the total number of target genes, the results showed that the target genes of piRNA had the most ratio in the tumor-related signal pathway, and the target genes were enriched in the PI3K-Akt signal pathway related to cell proliferation, the Ras signal pathway, and the signal pathway related to cell proliferation and migration (see Figure 1 Fig. 2E-H).

[0032] Example 2 1、Experimental method The changes in the expression levels of the screened piRNAs were verified in clinical samples and cell lines using reverse transcription real-time fluorescent quantitative PCR technology, and the biological function of piR-hsa-11510 (piR-11510) in NSCLC bone metastasis was screened and identified by combining piRNA target function analysis.

[0033] Specific experimental steps are as follows: using QIAzol Lysis Reagent to extract RNA in blood samples and cells. Add 1 mL QIAzol Lysis Reagent lysis solution to 200 μL whole blood samples or a 6 cm cell culture dish, mix well, and stand for 15 min for lysis. According to the ratio of 1 mL QIAzol Lysis Reagent / 0.2 mL chloroform, add 200 μL chloroform, shake for 25 s, extract at room temperature for 3 min, and centrifuge at 4°C at 12000 rpm for 15 min. After centrifugation, the liquid is layered, and the supernatant is aspirated into a new EP tube. According to the ratio of 1:1, add an equal amount of isopropanol, shake well, stand for 30 min for RNA precipitation, and centrifuge at 4°C at 12000 rpm for 15 min. Discard the supernatant, add 500 μL 75% ethanol to wash the precipitated RNA, centrifuge at 4°C at 12000 rpm for 10 min, and discard the supernatant. Dry for 40 min in a clean bench until the precipitate edge is transparent, add 35 μL DEPC water to dissolve the RNA, and stand for 5 min. Measure the RNA concentration using a Nanodrop microspectrophotometer. Use the RNA reverse transcription kit PrimeScriptTM MasterMix to prepare the reverse transcription reaction solution on ice according to the ratio of kit components, and mix well with a pipette gun. The obtained cDNA is used as a template for real-time quantitative PCR (qPCR). Use the miRNA Universal SYBR qPCR Master Mix kit to perform PCR amplification, and use the universal primer in the kit as the downstream primer. Prepare the qPCR reaction system on ice according to the kit components, and perform amplification.

[0034] 2. Experimental results The qRT-PCR results suggest that the PCR amplification results of piRNA are consistent with the microarray chip data trend. The PCR amplification data shows that there are 10 piRNAs with significant differences in LCBM vs Ctrl and LCBM vs LC, and the trend is consistent with the microarray chip results (see Figure 2 A and B). Analyze the interaction of 24 piRNAs with 453 target genes screened by microarray chip. For example, Figure 2The network consists of interconnected piRNA-mRNAs, as shown in FIG. 6C, and the network diagram shows that piRNAs can regulate multiple target genes. The green nodes represent down-regulated piRNAs, and the up-regulated piRNAs are shown as red nodes. Based on the results of joint verification of clinical samples and cell lines, the expression of piR-has-2389, 11510, 17503, 19424, 27059, 27081, 30696, and 31170 was significantly up-regulated in NSCLC samples and NSCLC bone metastasis samples. Combined with the target prediction interaction data, the prediction results of piR-11510 showed that among its target mRNAs, 26 were involved in the mitogen-activated protein kinase (MAPK) signaling pathway, 22 were involved in the osteoclast differentiation pathway, and were related to tumor immunity, involving genes such as NFKB2, PIK3R2, CSF1R, NOTCH2, RELA, TGFBR2, SIGLEC15, etc. (see FIG. 6D and FIG. 6E). These results suggest that piR-11510 may have an important biological role in the occurrence and development of NSCLC tumors and distant bone metastasis. Figure 2

[0035] Example 3 1. Experimental methods Cloning formation experiment and cell proliferation experiment were used to verify the effect of knocking down piR-11510 on the proliferation of NSCLC cells A549. The scratch experiment and Transwell experiment were used to observe the effect of knocking down piR-11510 on the migration and invasion of NSCLC cells A549. Western blot technology was used to analyze the effect of piR-11510 on the expression of key signal molecules Stat3 and Akt related to cell proliferation and protein MMP3 related to cell migration.

[0036] The specific experimental steps are as follows: logarithmic growth phase A549 cells were inoculated in a 6-well plate, and the cell density was 1 x 10 3 ​Cells were cultured in 37°C, 5% CO2 incubators. Cells were transfected with antagopi R-11510 and antagopi R-NC, respectively. After 4 h of transfection, the culture medium was discarded, and fresh complete culture medium was added. Cells were cultured at 37°C, 5% CO2 for 5 days. After observing cell clones under a microscope, the cell supernatant was discarded, and the cells were washed twice with pre-chilled PBS. Cells were then fixed with 4% paraformaldehyde for 15 min, followed by two washes with PBS. 0.1% crystal violet staining solution was added, and staining was performed at room temperature for 30 min. After rinsing with running water until the background was clear, excess water was aspirated, and the cells were air-dried. The number of clones with more than 50 cells per well was counted under a microscope and photographed. The average number of clones from three replicates was used to calculate the number of clones per well. A549 cells in logarithmic growth phase were seeded in 96-well plates at a cell density of 3 × 10⁶ cells / well. 3 Cells were cultured in wells at 37°C in a 5% CO2 incubator. Cells were transfected with antagopiR-11510 and antagopiR-NC, respectively. CCK-8 reagent was added at 24, 48, and 72 h post-transfection, with 10 μL added to each well in triplicate, and incubated in the dark for 1.5 h. Absorbance at 450 nm was measured using a microplate reader. A blank control was prepared by adding CCK-8 to the same volume of complete culture medium, culturing for the same time, and measuring absorbance at 450 nm along with the experimental groups.

[0037] 2. Experimental Results Knockdown of piR-11510 significantly inhibited A549 cell proliferation. A549 colony formation assays showed that, compared to the negative control group, knockdown of piR-11510 inhibited colony formation in A549 cells (see...). Figure 3 (A, E); CCK-8 cell proliferation assay results showed that transfection with antagopiR-11510 significantly inhibited A549 cell proliferation (see A, E). Figure 3 (D). Scratch assay results showed that, compared with the negative control group, A549 cell migration was inhibited after knocking down piR-11510 for both 24 h and 48 h (see D). Figure 3 (B, F, G). Meanwhile, transwell assays showed that, compared to the negative control group, knockdown of piR-11510 inhibited the invasion and migration of A549 cells (see [link to study].) Figure 3 (C, H). Western blot results showed that, compared with the negative control group, knockdown of piR-11510 significantly downregulated the expression of key signaling molecules Stat3 and Ak related to lung cancer cell proliferation, downregulated the expression of cell migration-related protein MMP3, and reduced the expression of tumor angiogenesis-related signaling molecule HIF-1α (see C, H). Figure 3 (China IM).

[0038] Example 4 1. Experimental method RAW264.7 cells were used for osteoclast induction experiment to observe the effect of A549 conditioned medium with knockdown of piR-11510 on osteoclast differentiation, and the expression changes of key genes in osteoclast differentiation process were detected by real-time quantitative PCR.

[0039] The specific experimental steps are as follows: A549 cells in logarithmic growth phase were inoculated in a 6-well plate, and antagopiR-11510 and antagopiR-NC were transfected, 6 h after transfection, the complete culture medium was replaced, and the cell culture medium was collected after 24 h of culture, and centrifuged at 1500 rpm for 5 min, and prepared as a conditioned medium for standby. Take the logarithmic growth phase Raw264.7 cells, use the complete culture medium to prepare a RAW264.7 single cell suspension of 1×10 4 6 cells / mL, 100 μL per well was inoculated in a 96-well plate. After the RAW264.7 cells adhered, the prepared A549 cell conditioned medium containing 10 ng / mL RANKL was used to prepare osteoclast induction liquid, and each well was replaced with osteoclast induction liquid, and cultured at 37℃, 5% CO2 for 5 days to induce osteoclast differentiation.

[0040] 2. Experimental results The osteoclast differentiation activity caused by A549 cells with knockdown of piR-11510 was reduced (see Figure 4 A). The expression of key genes in osteoclast differentiation process, Cathepsin K (Ctsk), important transcription factor Nuclear factor-activated T cell 1 (NFATc1), and osteoclast-related receptor (OSCAR), were significantly decreased in the piR-11510 knockdown group compared with the NC group (see Figure 4 B-E).

[0041] Example 5 1. Experimental method The lung cancer cell line A549 which is prone to bone metastasis was used to construct a tumor model in nude mice by injecting tumor cells into the tibial bone marrow cavity, and the effect of piR-11510 on tumor growth and osteoclast activation was verified by local injection of piR-11510 inhibitor antagopiR-11510.

[0042] The specific experimental steps are as follows: Take the logarithmic growth phase A549 cells, when the cell confluence is about 80%, digest the cells, wash them with PBS for 2 times, and then prepare 2×10 7 / mL of cell suspension. A 0.3 mL insulin disposable syringe was used to vertically inject the tibia platform of the mouse, and 10 μL of cell suspension was injected into the tibia marrow cavity of each mouse to construct a lung cancer bone metastasis tumor model of nude mice. After injection, the incidence was observed at regular intervals. The body weight and tumor of the nude mice were observed every 3 days during the period, the body weight of the nude mice was measured by an electronic scale, the length and width of the tumor were measured by a vernier caliper, and the tumor volume was calculated according to the formula: tumor volume = π / 6 x length x width2.

[0043] 2. Experimental results The animal experiment results show that compared with the antagopiR-NC group, the animal weight decrease trend slows down after antagopiR-11510 intervention, and the tumor volume is significantly lower than the negative control group, which indicates that the intervention of antagopiR-11510 can inhibit tumor growth (see Figure 5 ). The antagopiR-NC group can see rich blood vessel formation on the surface of the isolated tissue, and on the contrary, the antagopiR-11510 treatment group has fewer blood vessels on the surface of the isolated tumor. The Micro-CT scanning results show that the control group of the tumor model of nude mice, the tibia part can see obvious osteolytic bone destruction, the cortical bone appears to be dissolved, the bone is not connected, and the tumor tissue near the tibia can see high density shadow; the antagopiR-11510 treatment group significantly alleviates the osteolytic bone destruction (see Figure 6 A). The cortical bone at the distance of 4.5-5.5 mm from the starting point of the tibiofibular junction as the starting point (see Figure 6 B) is the region of interest, the CT results are quantitatively analyzed, and the analysis results show that compared with the antagopiR-NC group, the BS and BS / BV of the antagopiR-11510 treatment group are significantly decreased (see Figure 6 D, E), the BV and BV / TV are significantly improved (see Figure 6 F, G), and the BMD also increases (see Figure 6 C).

[0044] Example 6 1. Experimental method Hematoxylin-eosin staining (HE), Safranin O fast green staining, and tartrate resistant acid phosphatase (TRAP) staining were used to evaluate the influence of antagopiR-11510 treatment on bone destruction and osteoclast number.

[0045] The specific experimental steps are as follows: Before staining, the tissue section was baked at 65℃ for 2 hours. The following steps were used to deparaffin and rehydrate the tissue section: xylene I→xylene II, each for 15 min, for deparaffin; then 100% ethanol I→100% ethanol II, each for 5 min, 95% ethanol→90% ethanol→80% ethanol→70% ethanol→50% ethanol→ultra-pure water, each for 2 min.

[0046] Hematoxylin-eosin staining (HE) can determine cell morphology and identify tissue cells from different sources. The cell nucleus was dyed with hematoxylin dyeing solution, and the paraffin section was sequentially placed in hematoxylin dyeing solution for 4 min, distilled water for 1 min, and hydrochloric acid ethanol for 30 s, and then washed with distilled water for 30 s. The cytoplasm was dyed with eosin dyeing solution, and the paraffin section was placed in eosin dyeing solution for 3 min and then washed with distilled water for 30 s. The stained section was dehydrated, 95% ethanol I→95% ethanol II→anhydrous ethanol I→anhydrous ethanol II, each for 10 s, and then xylene I→xylene II, transparent for 1 min, dried, and then neutral resin was added dropwise, and the cover glass was sealed.

[0047] The TRAP staining kit was used for staining, and the TRAP staining solution was prepared according to the kit instructions. The TRAP staining solution was added dropwise on the deparaffinized tissue section, and the staining was performed in the dark for 60-90 min, and the coloring degree was observed under a microscope during the period. After complete coloring, the section was taken out, and the residual staining solution was washed away with distilled water. The cell nucleus was dyed with the nuclear dye in the TRAP staining kit for 5 min, the section was taken out, the residual staining solution was washed away with distilled water, and the glycerol gelatin sealing agent was used for sealing.

[0048] The paraffin section was soaked in fast green dyeing solution, and dyed for about 10 min, and then washed with distilled water for 2-3 times to wash away the residual dyeing solution. The section was soaked in safranin dyeing solution for 3 min, and then washed with distilled water for 2-3 times to wash away the residual dyeing solution. The dyed section was dehydrated, and the steps were the same as above. After the tissue section was dehydrated and transparent, it was dried, and then neutral resin was added dropwise for sealing.

[0049] 2. Experimental results The results of HE and safranin O-fast green staining showed that the normal tibial cortical bone was complete, the lateral muscle was clearly visible, and the tissue arrangement was neat. The bone destruction was obvious in the antagopiR-NC group of the tumor model, and a large number of tumor cell infiltrations were visible. In the antagopiR-11510 treatment group, the osteolytic destruction of the tibial site was significantly improved (see Figure 7Figure 6. TRAP results. Figure 6A shows the TRAP results of the tumor model. Figure 6B shows the TRAP results of the tumor model. Figure 6C shows the TRAP results of the tumor model. Figure 7 Figure 6. TRAP results. Figure 6A shows the TRAP results of the tumor model. Figure 6B shows the TRAP results of the tumor model. Figure 6C shows the TRAP results of the tumor model.

[0050] Example 7 1. Experimental method The expression of proteins related to tumor phenotype, such as Cytokeratin (CK) and Vimtenin, and proteins related to angiogenesis, such as Vascular endothelial growth factor (VEGF) and Pigment Epithelium-derived Factor (PEDF), were detected by immunohistochemistry (IHC) technique.

[0051] The specific experimental steps are as follows: wash the section with PBS for 3 times, immerse the section in citric acid antigen repair solution, boil under high pressure, then continue to heat for 2 min, stop heating and let the section cool to room temperature naturally. Put the section into a glass jar containing 3% H2O2 solution, immerse for 15 min. Take out the section, immerse in distilled water for 3 min, repeat for 3 times. Then immerse in PBS for 5 min, repeat for 3 times, and absorb the residual liquid. Add 5% goat serum and block for 30 min, then discard the blocking solution. Add the diluted primary antibody, and incubate in a wet box at 4°C overnight. The next day, place the sample at room temperature, and reheat for 10-15 min. Wash with PBS for 3 times, each for 5 min. Incubate the secondary antibody at room temperature for 60 min, wash with PBS for 3 times, each for 5 min. Add 100 μL of freshly prepared DAB working solution, observe the coloration under the microscope, and wash with PBS for 3 times until the reaction is appropriate. Then, re-stain with hematoxylin, dehydrate in gradient alcohol, and seal with neutral resin.

[0052] 2. Experimental results The IHC results show that in the antagopiR-NC group of the tumor model, the tumor tissue is CK positive, and the positive rate is as high as 90% (see Figure 7A). Figure 8CK positive cells were significantly decreased after antagopiR-11510 intervention. Further observed by IHC staining of Vimentin, a marker of mesenchymal cells, the area of Vimentin positive cells was increased after antagopiR-11510 intervention, and the CK negative cells were positive for Vimentin staining after antagopiR-11510 intervention (see Figure 8 VEGF was highly expressed in the tumor model antagopiR-NC group, and the expression of VEGF was significantly decreased after antagopiR-11510 intervention (see Figure 8 At the same time, PEDF, which can inhibit angiogenesis, was expressed at a higher level in the antagopiR-11510 intervention group than in the tumor model tissue (see Figure 8 The results showed that knocking down piR-11510 can inhibit the proliferation of tumor cells, improve the osteolytic bone destruction caused by tumors, inhibit the local angiogenesis of tumors, and intervene in the occurrence and development of NSCLC bone metastasis by regulating the tumor tissue microenvironment.

[0053] In summary, the application provides the use of piR-11510 in the diagnosis, treatment and prognosis evaluation of non-small cell lung cancer bone metastasis. Based on the research of the application, it is found that piR-11510 can be used as a diagnostic marker for non-small cell lung cancer bone metastasis; it can also be used as a therapeutic target for non-small cell lung cancer bone metastasis, and targeted intervention of piR-11510 can inhibit the proliferation, invasion, metastasis and / or colonization of non-small cell lung cancer cells. Therefore, piR-11510 is a potential molecular marker for specific diagnosis of non-small cell lung cancer bone metastasis, and can be quickly detected through blood samples, which has good clinical value for the diagnosis of non-small cell lung cancer bone metastasis and the development of precise clinical treatment programs.

[0054] It should be understood that the application is not limited to the above examples, and those skilled in the art can make improvements or changes according to the above description, and all these improvements and changes shall belong to the protection scope of the appended claims of the application.

Claims

1. The use of a reagent for detecting piR-11510 in the preparation of a product for diagnosing bone metastases in non-small cell lung cancer, wherein the nucleotide sequence of piR-11510 is shown in SEQ ID No.

1.

2. The application according to claim 1, characterized in that, The product is a testing reagent or testing kit.

3. The application according to claim 1, characterized in that, The reagent used to detect piR-11510 is the same reagent used to detect the expression level of piR-11510.

4. The application according to claim 3, characterized in that, The reagent used to detect piR-11510 is a reagent used to detect the expression level of piR-11510 in serum.

5. Application of reagents for detecting piR-11510 in the preparation of products for prognostic evaluation of bone metastases in non-small cell lung cancer.

6. Application of piR-11510 expression inhibitors or piR-11510 knockout agents in the preparation of drugs for the treatment of bone metastases in non-small cell lung cancer.

7. The application according to claim 6, characterized in that, The drug can inhibit the proliferation, migration and invasion of non-small cell lung cancer cells, and downregulate osteoclast differentiation to alleviate bone destruction. And / or, the drug can inhibit local angiogenesis in the tumor and intervene in the occurrence and development of bone metastasis in non-small cell lung cancer by regulating the tumor tissue microenvironment.

8. The application according to claim 6, characterized in that, The piR-11510 expression inhibitor is antagopiR-11510, and the nucleotide sequence of antagopiR-11510 is shown in any one of SEQ ID No. 2-4.

9. A drug for treating bone metastases from non-small cell lung cancer, characterized in that, This includes piR-11510 expression inhibitors or piR-11510 knockout agents.

Images