A product based on the combination of dumbbell probe and rca for the detection of KRAS gene and its use

Abstract

The present application relates to a product based on dumbbell-shaped probe and RCA for KRAS gene detection, the product comprises a dumbbell-shaped probe, a DNA ligase and RCA amplification reagents, the dumbbell-shaped probe comprises a stem and two loop parts, the ends of the two loop parts are connected through the stem, one of the loops of the dumbbell-shaped probe contains a G-quadruplex aptamer PW17 complementary sequence, and the other loop contains a G-quadruplex aptamer T30695 complementary sequence, the RCA amplification reagents comprise Phi29 DNA polymerase, dNTPs and Phi29 DNA polymerase reaction buffer, under the mediation of the DNA ligase and the detected gene, the stem of the dumbbell-shaped probe is opened, the nick ligation forms a closed loop structure, and serves as a template for RCA. By adopting the technical scheme, the present application provides a product based on dumbbell-shaped probe and RCA for KRAS gene detection, compared with the traditional method, when testing single nucleotide mutation of the gene, it is more convenient and more efficient.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a product for KRAS gene detection based on dumbbell probe combined with RCA and its use. BACKGROUND

[0002] KRAS is a gene that plays a key role in cell signaling, mainly regulating cell growth, division, and survival. Mutations in the KRAS gene are frequently encountered in various human cancers. In particular, the incidence of KRAS mutations in non-small cell lung cancer (NSCLC) is about 30%, in colorectal cancer (CRC) is 30-50%, and in pancreatic ductal adenocarcinoma is 80%. Mutations usually occur on a single nucleotide substitution at codon 12, G12D is the most common. G12D mutations account for 20-50% of KRAS mutant cancers, depending on the type of cancer. These mutations lead to the persistent activation of the KRAS protein, which can stimulate cell proliferation and inhibit apoptosis, promoting the occurrence and development of tumors. KRAS G12D mutations pose a challenge to traditional treatment, and for colorectal cancer, G12D usually leads to poor response to chemotherapy and high risk of recurrence. G12D patients also cannot benefit from anti-EGFR therapy, which has been shown to benefit CRC patients who are resistant to other therapies.

[0003] Given the key role of KRAS G12D single nucleotide mutations in prognostic evaluation and treatment decisions, polymerase chain reaction (PCR) and next-generation sequencing (NGS) are the most commonly used methods for detecting gene mutations, characterized by high specificity and sensitivity. However, these methods both rely on special cost equipment and professional operators. SUMMARY

[0004] The purpose of the present application: In order to overcome the defects of the prior art, the present application provides a product for KRAS gene detection based on dumbbell probe combined with RCA, which can be judged by the naked eye, without the need for precision instruments, and compared with traditional methods, it is more convenient and efficient when testing single nucleotide mutations of genes.

[0005] The technical scheme of the present application is: a product for KRAS gene detection based on the combination of dumbbell-shaped probes and RCA, the product comprising dumbbell-shaped probes, DNA ligase and RCA amplification reagents, the dumbbell-shaped probes comprising a stem and two loop parts, the end of the two loop parts being connected through the stem, one of the loops of the dumbbell-shaped probes containing a G-quadruplex aptamer PW17 complementary sequence, the other loop containing a G-quadruplex aptamer T30695 complementary sequence, the stem being provided with a nick for recognizing and binding to a mutation site of a detection gene, the RCA amplification reagents comprising Phi29 DNA polymerase, dNTPs and Phi29 DNA polymerase reaction buffer, the stem of the dumbbell-shaped probe being opened under the mediation of the DNA ligase and the detection gene, the nick being connected to form a closed loop structure and serving as a template for RCA, a G-quadruplex sequence being generated, and the G-quadruplex sequence being combined with hematin to imitate horseradish peroxidase.

[0006] Further provided is that the sequence of the dumbbell-shaped probe is CAGCTCCAACTACCCCAACCCGCCCTACCCAAAGTTGGAGCTGTATGGCGTAGGCTTAACCCACCCACCCACCCTTGCCTACGCCAT.

[0007] Further provided is that the stem is a complementary strand composed of reverse complementary base pairs, and is an upper strand and a lower strand, respectively, the upper strand containing the nick.

[0008] Further provided is that the last base at the 3' end of the dumbbell-shaped probe is a thymine nucleotide, which can recognize a mutation site adenine of a detection gene; when the detection gene exists, the base T of the dumbbell-shaped probe is perfectly paired with the mutation site A; the upper strand part and the lower strand part of the dumbbell-shaped probe are separated, and the separated ends are connected and circularized under the action of the DNA ligase to form a closed loop structure; when the dumbbell-shaped probe encounters a wild-type KRAS gene, base mismatch exists, which prevents the stem of the dumbbell-shaped probe from completely hybridizing with the target, so that the upper strand and the lower strand of the stem cannot be effectively separated.

[0009] Further provided is that the RCA reaction process generates a long tandem repeat sequence composed of alternating G-quadruplex sequences; the long tandem repeat sequence is GGGTGGGTGGGTGGGTTAAGCCTACGCCATACAGCTCCAACTTTGGGTAGGGCGGGTTGGGGTAGTTGGAGCTGATGGCGTAGGCAAGGGTGGGTGGGTGGGTTAAGCCTACGCCATACAGCTCCAACTTTGGGTAGGGCGGGTTGGGGTAGTTGGAGCTGATGGCGTAGGCAA.

[0010] Further, the PW17 complementary sequence is CCCAACCCGCCCTACCC; and the T30695 complementary sequence is ACCCACCCACCCACC.

[0011] Further, the stem length is 7-13 nt.

[0012] Further, the concentration of the dumbbell probe is 5-15 μM, and the concentration of dNTPs is 5-15 mM.

[0013] Another purpose of the present application is the use of the above-mentioned detection product in the preparation of a detection product for KRAS gene detection.

[0014] The dumbbell probe is combined with rolling circle amplification (RCA) for visual detection of KRAS G12D, and the detection result can be directly judged by naked eyes without relying on precise instruments, thereby reducing the detection threshold, being suitable for instant detection or detection in a limited resource environment, greatly assisting pathologists in rapid and accurate judgment, and the product has high specificity and high sensitivity. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 The figure is a schematic diagram of the dumbbell probe and the detection method of the embodiment of the present application;

[0016] Figure 2 The figure is the detection result of agarose gel electrophoresis and absorbance and absorption spectrum of the embodiment of the present application;

[0017] Figure 3 The figure is a schematic diagram of the RCA reaction product of different dumbbell probes and the detection result of kinetics, absorbance and absorption spectrum of the embodiment of the present application;

[0018] Figure 4 The figure is the color development result of the RCA reaction product of four dumbbell probes under different KRAS G12D concentrations of the embodiment of the present application;

[0019] Figure 5 The figure is a schematic diagram of the linear probe and the dumbbell probe with different stem lengths and the absorbance detection result of stem length optimization and RCA reaction time optimization of the dumbbell probe of the embodiment of the present application;

[0020] Figure 6 The figure is the color development result after stem length optimization and RCA reaction time optimization of the dumbbell probe of the embodiment of the present application;

[0021] Figure 7 The figure is an analysis chart of colorimetric assay sensitivity of the embodiment of the present application;

[0022] Figure 8Specificity analysis chart of the detection method of the embodiment of the present application;

[0023] Figure 9 Absorbance detection and color development results of the embodiment of the present application at different concentrations, with or without 200nM KRAS G12D gene;

[0024] Figure 10 Flow chart of the detection of the embodiment of the present application and real sample detection results;

[0025] Figure 11 Result summary chart of the blind test of the embodiment of the present application. DETAILED DESCRIPTION

[0026] The technical solutions in the embodiments will be described clearly and completely below with reference to the drawings. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative work fall within the protection scope of the present application.

[0027] In addition, the technical solutions of various embodiments of the present application can be combined with each other, but it must be based on the realization by those of ordinary skill in the art. When the combination of technical solutions appears to be contradictory or unachievable, it should be considered that the combination of technical solutions does not exist and is not within the protection scope required by the present application. EMBODIMENT

[0028] A product for KRAS gene detection based on the combination of dumbbell-shaped probe and RCA, the product comprising a dumbbell-shaped probe, a DNA ligase and RCA amplification reagents, the dumbbell-shaped probe comprising a stem and two loop parts, the ends of the two loop parts being connected through the stem, one of the loops of the dumbbell-shaped probe containing a G-quadruplex aptamer PW17 complementary sequence, the other loop containing a G-quadruplex aptamer T30695 complementary sequence, the stem being provided with a nick for recognizing and binding to the mutation site of the detection gene, the RCA amplification reagents comprising Phi29 DNA polymerase and dNTPs and Phi29 DNA polymerase reaction buffer, under the mediation of the DNA ligase and the detection gene, the stem of the dumbbell-shaped probe is opened, the nick is connected to form a closed loop structure, and serves as a template for RCA, generating a G-quadruplex sequence, the G-quadruplex sequence binds to hemin to mimic horseradish peroxidase, forming a horseradish peroxidase (HRP) and catalyzing the reaction of 2,2'-azobis-3-ethylbenzothiazoline-6-sulfonic acid (ABTS) and hydrogen peroxide (H2O2), generating a visible green color, the detection result can be directly observed by the naked eye without relying on precise instruments, reducing the detection threshold, suitable for instant detection or resource-limited detection scenarios, which can greatly help pathologists to quickly and accurately judge, and the product has high specificity and high sensitivity.

[0029] Materials and reagents

[0030] Oligonucleotides were synthesized and purified by Shengong Bioengineering (Shanghai) Co., Ltd. The sequences of the oligonucleotides are shown in Table S1

[0031] Table S1

[0032] The underlined part in Table S1 is the recognition region of the target, and the italicized letters represent the mutation site compared with the wild-type KRAS gene.

[0033] All freeze-dried oligonucleotides were dissolved in 1x TE buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH=8.0) and stored at 4 °C for use.

[0034] Phi29 DNA polymerase was purchased from Nanjing Novozyme Biotech Co., Ltd., and 9°N DNA ligase was purchased from New England Biolabs Ltd.

[0035] Deoxynucleotide mixture solution (dNTPs, 10 mM) was purchased from Shengong Bioengineering (Shanghai) Co., Ltd.

[0036] Hemin and ABTS were purchased from Sigma-Aldrich Co. LLC.

[0037] The water used in the experiment was ultrapure water from the Avidity Science water purification system (resistivity ≥18.2 MΩ cm).

[0038] Example 2: Preparation method of the product

[0039] S1. Connection of dumbbell-shaped probe: Dissolve the dumbbell-shaped probe in TE buffer and denature it at 95°C for 5 min, then gradually cool it to room temperature;

[0040] S2. Add 1 μL of the prepared dumbbell-shaped probe (10 μM) and 1 μL of the target KRAS gene to a 1.5 mL centrifuge tube containing 1.5 μL of 10×9°N DNA ligase reaction buffer (100 mM Tris-HCl, 6000 µM ATP, 25 mM DTT, 25 mM MgCl2, 1% Triton X-100, pH 7.5), 0.5 μL of 9°N DNA ligase, and 11 μL of ddH2O. The target concentration is 200 nM. Maintain the resulting solution at 45°C for 15 min. Then, incubate the mixture at 85°C for 10 min to terminate the reaction.

[0041] S3, RCA reaction, i.e., rolling circle amplification; 0.5 μL of Phi29 DNA polymerase, 2.5 μL of dNTPs (10 μM), 2.5 μL of 10×Phi29 DNA polymerase reaction buffer and 4.5 μL of ddH2O were added to the solution obtained in S2. The resulting mixture was incubated at 30 °C for 60 min, and then incubated at 65 °C for 10 min to terminate the reaction; the final volume of the RCA reaction was 25 μL.

[0042] S4. Add 0.5 μL of heme and 80 μL of 2×HEPES buffer (50 mM HEPES, 20 mM KCl, 0.4 M NaCl, 2% DMSO, 0.1% Triton X-100, pH 5.2) to the solution in S3, mix, and incubate the mixture at 37°C for 30 min to form DNase.

[0043] S5. Add 9 μL of 40 mM ABTS and 5 μL of 4 mM H2O2 to the DNase in S4, and react the resulting solution for 30 min.

[0044] like Figure 1 Figure A shows the design of a dumbbell-shaped probe. The stem of the dumbbell-shaped probe is a complementary strand composed of reverse complementary base pairs, namely the upper strand and the lower strand. The upper strand contains a nick that can recognize and bind to the mutation site of the KRAS G12D gene.

[0045] The dumbbell-shaped probe has the sequence CAGCTCCAACTACCCCAACCCGCCCTACCCAAAGTTGGAGCTGTATGGCGTAGGCTTAACCCACCCACCCACCCTTGCCTACGCCAT. One loop of the dumbbell-shaped probe contains the complementary sequence of the G-quadruplex aptamer PW17, and the other loop contains the complementary sequence of the G-quadruplex aptamer T30695. The complementary sequence of PW17 is CCCAACCCGCCCTACCC; the complementary sequence of T30695 is ACCCACCCACCCACCC.

[0046] like Figure 1 Figure B illustrates a schematic diagram of the dumbbell-shaped probe binding to the RCA reaction for the visual detection of KRAS G12D. The last base at the 3' end of the dumbbell-shaped probe is designed as a thymine nucleotide, which can specifically recognize and bind to the mutation site of the KRAS G12D gene, where adenine (A) is present. When the KRAS G12D target is present, the T at the 3' end of the probe perfectly pairs with the A at the mutation site. This specific binding allows the two ends of the dumbbell-shaped probe to separate through intramolecular hybridization to form a stem structure. With the help of DNA ligase, these separated ends can be circularized in the presence of the mutation target, forming a closed circular structure. Once circularized, the probe serves as a template, and the KRAS G12D strand serves as a primer for RCA amplification under the action of phi29 DNA polymerase, which has strong strand displacement activity.

[0047] The RCA reaction produces a long tandem repeat sequence composed of alternating G-quadruplex sequences, namely GGGTGGGTGGGGTGGTTAAGCCTACGCCATACAGCTCCAACTTTGGGTAGGGCGGGTTGGGGTAGTTGGAGCTGATGGCGTAGGCAAGGGTGGGTGGGTGGGTTAAGCCTACGCCATACAGCTCCAACTTTGGGTAGGGCGGGTTGGGGTAGTTGGAGCTGATGGCGTAGGCAA. This sequence can bind to heme to form a DNase with horseradish peroxidase (HRP) activity. This DNase can oxidize the substrate ABTS in the presence of H2O2, resulting in a visible green color, such as... Figure 1 As shown in C.

[0048] In contrast, when the probe encounters the wild-type KRAS gene, the presence of a base mismatch prevents the complete hybridization of the probe stem to the target, and the stem upper and lower strands cannot be efficiently separated; thus, the ligation step cannot efficiently occur, and the subsequent amplification process cannot be initiated; since no G-quadruplex structure is formed, no DNAse with HRP activity is produced, and thus there is no catalytic conversion of ABTS, and there is no color change in the detection solution, which is different from the output of the detection system containing KRAS G12D; this method takes advantage of this property to distinguish between mutant and wild-type KRAS genes with high precision and clear visual discrimination.

[0049] Example 3. Feasibility evaluation by means of agarose gel electrophoresis and colorimetric absorbance of the various reaction mixtures

[0050] As shown in Figure A of Figure 2 , the agarose gel electrophoresis analysis of the various reaction mixtures, tracks b to e represent reaction mixtures lacking one of the necessary components for RCA: DNA ligase (track b), phi29 DNA polymerase (track c), dumbbell probe (track d) and target DNA (KRAS G12D) (track e); in these tracks, no high molecular weight amplification product was observed; track f, which contains all the necessary components, shows a clear band at the top, indicating the production of a high molecular weight product, indicating that these components are necessary for the occurrence of the RCA process; we also performed a colorimetric assay of the final RCA product in each reaction mixture.

[0051] As shown in Figure C of Figure 2 , the absorbance at 420 nm of the various reaction mixtures in Figure A of Figure 2 was determined, error bars represent mean ± standard deviation (n = 3), ***, P < 0.001, one-way ANOVA; only sample f observed a significant color change, which is consistent with the positive RCA reaction detected in the gel electrophoresis of f; Figure 2 Figure B of Figure 2 is the UV-vis spectrum of the various reaction mixtures in Figure A of Figure 2 ; it further confirms the product of the RCA reaction, since it shows a characteristic absorption peak in sample f; further measurement of the absorbance value at 420 nm of the product, the absorbance value of sample f is significantly higher than the other negative controls. The absorbance measurement was performed using a Thermo Scientific Varioskan LUX multifunctional microplate reader for absorbance measurements at 400-440 nm and UV-vis spectrum analysis in the 400-500 nm wavelength range. The kinetic assay was performed in kinetic mode in a Molecular Devices SpectraMax 190 microplate reader.

[0052] Example 4: To improve colorimetric performance, the dumbbell-shaped probes of the experimental group and the three control groups were compared.

[0053] The dumbbell-shaped probes in the experimental group contained complementary double G-quadruplex sequences in both loops; such as Figure 3 As shown in Figure A, this diagram illustrates four dumbbell probes and the products generated by the RCA reaction. Dumbbell probe 11 contains G-quadruplex complementary sequences in both rings, and the product after the RCA reaction is P. Dumbbell probes 11-A and 11-B contain G-quadruplex complementary sequences in only one ring, producing products PA and PB, respectively. Probe 11-C lacks G-quadruplex complementary sequences in both rings, and the product is PC.

[0054] Then, kinetic measurements were performed on the four RCA products at a wavelength of 420 nm; such as Figure 3 As shown in Figure B, the kinetics of the four RCA products were measured at a wavelength of 420 nm. The dumbbell probe 11 had the highest reaction rate among the four dumbbell probes. This is because the dumbbell probe 11 can generate more G-quadruplex sequences in the same RCA reaction time. The dumbbell probe 11-C could not generate any G-quadruplex sequences, so there was no significant increase in absorbance even in the presence of a specific target.

[0055] UV-vis spectra of four RCA products were detected at 200 nM, 100 nM, and 0 nM KRAS G12D. Figure 3 (C) and absorbance at 420 nm ( Figure 3 The dumbbell-shaped probe 11 showed the highest absorbance values ​​at both 200 nM and 100 nM KRAS G12D concentrations; as shown in Figure 1. Figure 4 As shown, the dumbbell-shaped probe 11 exhibited the best colorimetric effect. Furthermore, signal-to-noise ratio (S / N) analysis further confirmed the probe's advantage, with the dumbbell-shaped probe 11 producing the highest S / N value among the tested probes. Figure 3 E).

[0056] In summary, the strategy of placing two complementary G-quadruplex sequences in the dumbbell-shaped probe significantly improves the colorimetric performance of KRAS G12D detection. By generating more G-quadruplexes, the color development effect is enhanced, making it easier for the tester to observe.

[0057] Example 5: The effect of dumbbell-shaped probe stem length on detection results

[0058] The design of dumbbell-shaped probes, especially the stem length, plays a crucial role in the specificity and sensitivity of detection methods in distinguishing between KRAS G12D mutant and wild-type sequences. Shorter stems facilitate probe hybridization with the target but may increase background noise from non-specific interactions; conversely, longer stems require more energy to open the probe stem to bind with the target, which reduces non-specific signals but may affect the output of specific signals.

[0059] like Figure 5 As shown in Figure A, a linear probe and four dumbbell-shaped probes with different stem lengths were designed. A series of probes with different stem lengths were designed while keeping the total probe length and recognition area consistent. The colorimetric performance of each probe was evaluated using the absorbance ratio of G12D to WT.

[0060] Linear probes without a stem showed the lowest AG12D / AWT ratio; the AG12D / AWT ratio gradually increased with increasing probe stem length, with Stem-11 reaching the highest ratio; however, as Figure 5 As shown in Figure B, the AG12D / AWT ratio decreased when the stem length increased to Stem-13. Therefore, Stem-11 performed best in distinguishing between KRAS G12D and KRASWT and was used throughout the subsequent experiments, such as... Figure 6 The figure at the top center shows the results of the dumbbell-shaped probe stem length optimization after RCA reaction in the presence of KRAS G12D or KRAS wild type. When the stem length is 11 bases, the color contrast between G12D and WT is the most obvious.

[0061] Optimize the RCA reaction time during the detection process

[0062] like Figure 5 As shown in Figure C, the optimal time for the RCA reaction is observed; the AG12D / AWT ratio increases with increasing incubation time and reaches a plateau after 60 minutes, indicating that this duration optimally allows the target to bind to the probe, achieving sufficient amplification without over-amplifying potential nonspecific products; Figure 6 The figure at the bottom center shows the optimized RCA reaction time and the color development results of different RCA reaction times in the presence of KRAS G12D or KRAS wild type. At 60 min, the color development of G12D and WT was the most obvious.

[0063] Example 6, Sensitivity of colorimetric determination

[0064] The sensitivity of the measurement was further evaluated under the above optimized conditions. Figure 7 The UV-vis spectra in B showed an increase in absorbance intensity after the addition of different concentrations of the KRAS G12D gene.Figure 7 A demonstrates a linear increase in absorbance intensity with varying KRAS G12D gene concentration from 10 nM to 100 nM at 420 nm wavelength. The linear regression equation is A = 0.24586 + 0.00925C (R 2 = 0.9884), indicating a positive correlation between absorbance (A) and KRAS G12D DNA concentration (C). The sensitivity of this detection method is high enough to detect as low as 10 nM of KRAS G12D gene signal compared to the blank control. From Figure 7 C, it can be seen that the lowest concentration that can be visually distinguished by color is also 10 nM. Therefore, 10 nM is defined as the limit of detection (LOD).

[0065] Example 7, Colorimetric assay specificity

[0066] Seven common single nucleotide mutations on human KRAS gene 12 and 13 codons were used to validate the specificity of the system together with KRAS wild type.

[0067] As shown in A, where the underlined bases represent the mutation point; only the specific target KRAS G12D can effectively trigger the opening of the dumbbell-shaped probe, thus enabling the RCA reaction and generating a significant colorimetric signal. In contrast, as shown in B and C, the presence of KRAS wild type or other single nucleotide mutation analytes at a concentration of 200 nM, the signal generated by non-targets is very weak and almost indistinguishable from the blank signal. This selective response is crucial for accurate detection of mutations, and the detection method exhibits excellent discrimination and visualization properties in detecting KRAS G12D from other single nucleotide mutations. Figure 8 Figure 8 Example 8, Real sample detection and blind test

[0068] To evaluate the potential of the detection method in practical applications, the target was first detected in different concentrations of fetal bovine serum, as shown in ; the detection method still has the ability to detect KRAS G12D when the system contains 10% FBS.

[0069] Figure 9 Next, detection was performed in real human serum samples, as shown in the program flowchart in A, detection was performed by collecting peripheral blood samples from healthy donors and G12D patients. After centrifuging the blood samples, the serum was added to the detection system.

[0070] As shown in A, the program flowchart, detection was performed by collecting peripheral blood samples from healthy donors and G12D patients. After centrifuging the blood samples, the serum was added to the detection system. Figure 10

[0071] As shown in A, the program flowchart, detection was performed by collecting peripheral blood samples from healthy donors and G12D patients. After centrifuging the blood samples, the serum was added to the detection system. Figure 10 ​​Figure 6 shows the absorbance signal of the G12D patient samples (No. 5 to 8) is stronger than that of the samples from healthy donors (No. 1 to 4), as shown in panel B. The corresponding scatter plot and significance analysis are shown in panel C, indicating that our detection method can clearly distinguish G12D patients from healthy individuals. Figure 10

[0072] To further evaluate the reliability and accuracy of the detection, a blind test evaluation was performed by separating the sample coding from the sample detection process. In addition, the personnel performing the detection were kept unaware of the coding information. As shown in panels A-C of Figure 7, the results of the blind test are consistent with the expectations, Figure 11 Figure 11 panel A of Figure 8 is a representative color development picture, Figure 11 panel B of Figure 8 is a single blind test result, Figure 11 panel C of Figure 8 is a blind test result repeated three times for KRAS G12D and other single nucleotide mutations.

[0073] In summary, the dumbbell probe combined with rolling circle amplification (RCA) is used for visual detection of KRAS G12D, which takes advantage of the specificity of the dumbbell probe, the amplification ability of the RCA reaction, and the visual detection based on G-quadruplex / hemin DNAzyme to detect specific targets, with the main highlights being its excellent target recognition ability and visualization ability. Through experimental optimization, we significantly reduced the non-target signal, maximizing the specificity of target detection. This detection system has high specificity for KRAS G12D, and the presence of KRAS G12D can be judged by observing the color change with the naked eye, without the need for precise instruments, making it suitable for point-of-care testing or resource-limited testing scenarios.​​

Claims

1. A product for KRAS gene detection based on the combination of dumbbell probe and RCA, characterized in that, The product comprises a dumbbell-shaped probe, a DNA ligase and RCA amplification reagents, the dumbbell-shaped probe comprises a stem and two loop parts, the ends of the two loop parts are connected through the stem, one of the loops of the dumbbell-shaped probe contains a G-quadruplex adaptor PW17 complementary sequence, and the other loop contains a G-quadruplex adaptor T30695 complementary sequence, a nick is provided on the stem, the RCA amplification reagents comprise Phi29 DNA polymerase and dNTPs and Phi29 DNA polymerase reaction buffer, under the mediation of the DNA ligase and the detection gene, the stem of the dumbbell-shaped probe is opened, the nick is connected to form a closed loop structure, and serves as a template for RCA, a G-quadruplex sequence is generated, the G-quadruplex sequence is combined with hemin to imitate horseradish peroxidase, and the sequence of the dumbbell-shaped probe is CAGCTCCAACTACCCCAACCCGCCCTACCCAAAGTTGGAGCTGTATGGCGTAGGCTTAACCCACCCACCCACCCTTGCCTACGCCAT.

2. The product for KRAS gene detection based on the combination of dumbbell-shaped probe and RCA according to claim 1, characterized in that, The concentration of the dumbbell-shaped probe is 5-15 μM, and the concentration of dNTPs is 5-15 mM.

3. Use of the product according to claim 1 or 2 in the preparation of a product for detecting a KRAS gene.

Images