Molecular marker related to soybean hundred-grain weight character and primer composition and application thereof

Abstract

The invention discloses a molecular marker related to a soybean hundred-grain weight character as well as a primer composition and application of the molecular marker. The invention relates to the technical field of biology, in particular to a molecular marker related to the soybean hundred-grain weight character and a primer composition and application of the molecular marker. By detecting the polymorphism or genotype (allele) of an SNP site in a soybean genome to be detected, the soybean hundred-grain weight character is identified or identified in an auxiliary mode according to the genotype, the SNP site is a site on a soybean chromosome 19, the nucleotide type of the SNP site is A or C, and the SNP site is the 20th nucleotide of a sequence 1 in a sequence table. The hundred-grain weight of the soybean with the genotype of AA at the site is higher than that of the soybean with the genotype of CC. The substance for detecting SNP site polymorphism and genotype can be combined with other substances (such as substances for detecting single nucleotide polymorphism or genotype of other molecular markers with soybean hundred-grain weight character) to prepare products for identifying soybean hundred-grain weight character.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a molecular marker related to soybean 100-grain weight trait and a primer composition and application thereof. Background Art

[0002] Soybean (Glycine max (Linn.) Merr.) is an important food and oil crop in my country. With the development of social economy and the continuous improvement of people's living standards, my country's soybean consumption is increasing, which leads to a serious contradiction between soybean supply and demand in my country. China is the world's largest soybean consumer. Faced with huge domestic demand, my country's own soybean production cannot meet it and can only rely on large-scale imports. Since 2000, China has become the world's largest soybean importer, and the import volume of soybeans has increased year by year. Since 2012, my country's soybean dependence on foreign countries has exceeded 80%, and the import volume in 2023 reached 99.4 million tons, accounting for more than 80% of the total domestic consumption (https: / / www.cfsn.cn / ). The huge soybean import volume has caused the entire domestic soybean industry chain to face a huge crisis, which seriously threatens my country's food security. Therefore, increasing soybean yield has always been a serious issue faced by soybean breeders in my country.

[0003] Soybean 100-grain weight is one of the important factors affecting soybean yield. Some genetic loci and candidate genes related to soybean 100-grain weight have been reported, but molecular markers for soybean molecular-assisted breeding need to be further developed. Cultivated soybeans have been selected to make their genetic diversity much lower than that of wild soybeans. By exploring and developing molecular markers for soybean 100-grain weight in wild soybeans and applying them to modern breeding processes, this has important scientific significance for making full use of the excellent genetic information of wild soybeans and then breeding new high-yield and high-quality soybean varieties. Summary of the invention

[0004] The problem to be solved by the present invention is how to identify or assist in identifying the soybean 100-grain weight trait.

[0005] In order to solve the above technical problems, the present invention first provides the use of a substance for detecting the polymorphism or genotype of SNP in the soybean genome in any of the following:

[0006] (1) Identify or assist in identifying the soybean 100-grain weight trait;

[0007] (2) Screening or breeding soybean plants, plant lines, strains or varieties with high 100-grain weight;

[0008] (3) Screening or breeding soybean plants, lines, strains or varieties with low 100-grain weight;

[0009] (4) Soybean breeding;

[0010] (5) Preparing products for identifying or assisting in identifying the soybean 100-grain weight trait;

[0011] (6) preparing products for screening or breeding soybean plants, strains, lines or varieties with high 100-grain weight;

[0012] (7) preparing products for screening or breeding soybean plants, strains, lines or varieties with low 100-grain weight;

[0013] (8) preparing soybean breeding products;

[0014] The soybean Williams 82 (Wm82.a2.v1) genome sequence is used as the reference genome, the SNP is a site on soybean chromosome 19, the nucleotide type is A or C, and it is the 20th nucleotide of sequence 1 in the sequence table.

[0015] The present invention also provides a method for identifying or assisting in identifying the soybean 100-grain weight trait, comprising detecting the genotype of a SNP in the soybean genome to be tested, and identifying or assisting in identifying the soybean 100-grain weight trait based on the genotype, wherein the SNP is a site on soybean chromosome 19, and its nucleotide type is A or C, which is the 20th nucleotide of sequence 1 in the sequence list.

[0016] In the above application or method, the genotype of the SNP is AA, CC or AC, wherein AA is the homozygous type of the SNP site A, CC is the homozygous type of the SNP site C, and AC is the heterozygous type of the SNP sites A and C.

[0017] In the above application or method, the identification or auxiliary identification of soybean 100-grain weight trait based on the SNP genotype is any of the following methods:

[0018] 1) The soybean to be tested, whose genotype of the SNP is AA, is or is a candidate soybean for the soybean high 100-grain weight trait;

[0019] 2) The soybean to be tested, whose genotype of the SNP is CC, is or is a candidate soybean for the soybean low 100-grain weight trait;

[0020] 3) The 100-grain weight of the soybean to be tested whose genotype of the SNP is AA is higher than that of the soybean to be tested whose genotype of the SNP is CC.

[0021] As an embodiment, the method for identifying or assisting in identifying the soybean 100-grain weight trait may include the following steps:

[0022] The genomic DNA of the soybean to be tested is used as a template, and a primer combination R4866-FAM, R4866-VIC and R4866-R composed of sequence 2, sequence 3 and sequence 4 in the sequence list is used for fluorescence quantitative PCR amplification. Genotyping is performed according to the fluorescence detection result of the obtained amplification product to identify the 100-grain weight of the soybean sample to be tested; the 100-grain weight of the soybean to be tested whose genotype of the SNP is AA is higher than that of the soybean to be tested whose genotype of the SNP is CC.

[0023] The specific determination method is as follows:

[0024] If the fluorescence of the amplified product is consistent with the fluorescence of the fluorescent group labeled by the primer shown in sequence 2 in the sequence table, the genotype of the SNP site is AA, and the soybean sample to be tested is a soybean variety with a higher 100-grain weight;

[0025] If the fluorescence of the amplified product is consistent with the fluorescence of the fluorescent group labeled by the primer shown in sequence 3 in the sequence table, the genotype of the SNP site is CC, and the soybean sample to be tested is a soybean variety with a low 100-grain weight.

[0026] The application of the above-mentioned method for identifying or assisting in identifying the soybean 100-grain weight trait in soybean breeding also falls within the protection scope of the present invention.

[0027] The invention also provides a soybean breeding method.

[0028] The soybean breeding method provided by the present invention can be M1 or M2:

[0029] M1. The method comprises detecting the genotype of the SNP in claim 1 in the soybean genome, selecting soybeans with the genotype of the SNP being AA as parents for breeding, wherein the AA is the homozygous type of the SNP being A, and the breeding purpose of the method comprises breeding soybeans with high 100-grain weight trait;

[0030] M2. The method comprises detecting the genotype of the SNP described in claim 1 in the soybean genome, and selecting soybeans with the genotype of the SNP being CC as parents for breeding, wherein the CC is the homozygous type of the SNP being C. The breeding purpose of the method comprises breeding soybeans with low 100-grain weight trait.

[0031] The present invention also provides a product containing a substance for detecting the polymorphism or genotype of a SNP site in a soybean genome, and the product may be any of the following:

[0032] C1) Products for detecting single nucleotide polymorphisms or genotypes related to soybean 100-grain weight traits;

[0033] C2) Products that identify or assist in identifying the soybean 100-grain weight trait;

[0034] C3) Products used for soybean breeding;

[0035] C4) Screening or breeding soybean plants, lines, strains or varieties with high 100-grain weight;

[0036] C5) Screening or breeding of soybean plants, plant lines, strains or varieties with low 100-grain weight.

[0037] In the above applications, methods and products, the substance may be a reagent and / or instrument required to determine the polymorphism or genotype of the SNP site by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high performance liquid chromatography and SNP chip. Among them, the SNP chip includes a chip based on nucleic acid hybridization reaction, a chip based on single base extension reaction, a chip based on allele-specific primer extension reaction, a chip based on "one-step" reaction, a chip based on primer ligation reaction, a chip based on restriction endonuclease reaction, a chip based on protein DNA binding reaction, and a chip based on fluorescent molecule DNA binding reaction.

[0038] Optionally, the substance may be the following D1), D2) or D3):

[0039] D1) containing a primer composition for amplifying a soybean genomic DNA fragment including the SNP site;

[0040] D2) a PCR reagent containing the primer combination described in D1);

[0041] D3) A kit containing the primer composition described in D1) or the PCR reagent described in D2).

[0042] Alternatively, the amplification may be PCR amplification. The primer composition is composed of the primers R4866-FAM, R4866-VIC and R4866-R. In the above-mentioned applications, methods and products, the primer composition may be labeled with a marker or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Labels include, but are not limited to, dyes; radioactive labels, such as 32P; binding moieties, such as biotin; haptens, such as digoxin (DIG); luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The label can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, weight determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The label can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The label can include a nucleic acid or protein sequence or a combination thereof, as long as the sequence containing the label is detectable. In some embodiments, nucleic acids are detected directly (eg, the sequence is read directly) in the absence of a label.

[0043] In the above-mentioned application, method or product, the primer composition can specifically be composed of primers R4866-FAM, R4866-VIC and R4866-R; the primer R4866-FAM is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence list; the primer R4866-VIC is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence list; the primer R4866-R is a single-stranded DNA molecule whose nucleotide sequence is sequence 4 in the sequence list.

[0044] The present invention also provides a DNA molecule, the nucleotide sequence of the DNA molecule is shown in Sequence 1 of the sequence table.

[0045] The application of the above-mentioned DNA molecules also falls within the scope of protection of the present invention. The application is specifically any of the following:

[0046] (1) Identify or assist in identifying the soybean 100-grain weight trait;

[0047] (2) Screening or breeding soybean plants, plant lines, strains or varieties with high 100-grain weight;

[0048] (3) Screening or breeding soybean plants, plant lines, strains or varieties with low 100-grain weight;

[0049] (4) Soybean breeding;

[0050] (5) Preparing products for identifying or assisting in identifying the soybean 100-grain weight trait;

[0051] (6) preparing products for screening or breeding soybean plants, strains, lines or varieties with high 100-grain weight;

[0052] (7) preparing products for screening or breeding soybean plants, strains, lines or varieties with low 100-grain weight;

[0053] (8) Prepare soybean breeding products.

[0054] Optionally, in the above application, the DNA molecule is used as a detection target.

[0055] The material for detecting the polymorphism and genotype of the SNP site can be combined with other materials (such as materials for detecting the single nucleotide polymorphism or genotype of other molecular markers related to the soybean 100-grain weight trait) to prepare a product for identifying the soybean 100-grain weight trait.

[0056] The present invention provides a soybean specific SNP site, which is located at a site on soybean chromosome 19, and the nucleotide type is A or C, which is the 20th nucleotide of sequence 1 in the sequence list, and also provides a set of primer compositions, and a method for identifying or assisting in identifying the soybean 100-grain weight trait using the primer compositions. The method established by the present invention can be used to predict the soybean 100-grain weight trait, can be used for early screening of soybeans to be screened, can be used for soybean molecular marker-assisted breeding, and has important application value in the research of exploring soybean germplasm resources with high 100-grain weight and breeding soybean varieties with high 100-grain weight. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] Figure 1 This is a diagram showing the results of QTL positioning analysis of the 100-grain weight trait of population No. 14025 in Example 1 of the present invention.

[0058] Figure 2 This is the normal distribution of the 100-grain weight of the population numbered 14025 in 2019 and the marker selection efficiency diagram in Example 1 of the present invention.

[0059] Figure 3 This is the normal distribution of the 100-grain weight of the population numbered 14025 in 2021 and the marker selection efficiency diagram in Example 1 of the present invention.

[0060] Figure 4 This is the genotyping result of the KASP marker on the tested soybean in Example 2 of the present invention.

[0061] Figure 5 This is the genotyping result of the tested soybean using the dCAPS marker designed for EcoRV digestion in Example 2 of the present invention. DETAILED DESCRIPTION

[0062] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0063] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0064] The quantitative experiments in the following examples were performed in triplicate unless otherwise specified.

[0065] The cultivated soybean Jidou 12 in the present invention has been recorded in: Yang Chunyan, Zhang Mengchen, Zhao Shuangjin, Wang Wenxiu. Research on breeding of high-yield and high-protein soybean Jidou No. 12, Journal of Hebei Agricultural University, Issue 4, 2004. The public can obtain it from the Institute of Cereals and Oil Crops of Hebei Academy of Agricultural and Forestry Sciences (i.e., the applicant). The biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0066] The wild soybean ZYD02738 in the present invention has been recorded in: Li Man, Shi Xiaolei, Di Rui, Liu Zhifang, Meng Qingmin, Fu Cai, Yang Chunyan, Wang Dongmei, Zhang Mengchen, Zhang Jie, Yan Long. Development and application of soybean long fragment insertion / deletion markers "Journal of North China Agricultural University" 2022 No. 1. The public can obtain it from the Institute of Cereals and Oil Crops of Hebei Academy of Agricultural and Forestry Sciences (i.e., the applicant). The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0067] The following examples were processed using SPSS 11.5 statistical software, and the experimental results were expressed as mean values. The t-test was used for the analysis, and P < 0.001 (***) indicated a highly significant difference.

[0068] Example 1: Discovery of the SNP site Chr19_43194866 associated with soybean 100-grain weight

[0069] The soybean material in the present embodiment is derived from: using cultivated soybean Jidou 12 (a variety with high 100-grain weight) as the female parent and wild soybean ZYD02738 (a variety with low 100-grain weight) as the male parent, hybridization is performed to establish a RIL population. In 2012, Jidou 12 was the female parent, and the RIL population was the male parent, backcrossing was performed, and the BC1F1 population obtained in 2013. In 2014, Jidou 12 was the female parent, and the BC1F2 of Jidou 12 and ZYD02738 was the male parent, and backcrossing was performed; the BC2F1 population was obtained in 2015. Self-pollination was performed 4 times to obtain a BC2F4:5 population, which was numbered as 55 strains of the 14025 population.

[0070] In December 2018, leaves of BC2F4:5 were collected from Sanya, DNA was extracted by BioMed, and genome resequencing was performed on each line to construct a genotype map based on SLAF technology ( Figure 1 ). According to the genetic loci and SNP markers, combined with the Williams 82 reference genome sequence (Glycine max Wm82.a2.v1), sequencing analysis screened out a SNP site related to soybean 100-grain weight, Chr19_43194866_A_C, a di-allelic polymorphic SNP site located on chromosome 19 of soybean, which is the 20th nucleotide of sequence 1 in the sequence table, and its nucleotide type is A or C. There are three genotypes of this SNP site: AA or CC or AC. Chr19_43194866 with genotype AA is homozygous for nucleotide A, Chr19_43194866 with genotype CC is homozygous for nucleotide C, and Chr19_43194866 with genotype AC is heterozygous for A and C. In sequence 1, m is c or a. The genotype identification results of the soybean material Chr19_43194866 in this embodiment are shown in Table 1.

[0071] The phenotypic detection method of soybean 100-grain weight is as follows: the number of grains per plant and the weight of grains per plant of each family of wild bean substitution line population 14025 are counted, and the calculation formula of 100-grain weight is: 100-grain weight = (grain weight per plant / number of grains per plant) × 100. The results of soybean 100-grain weight of 55 lines of population No. 14025 are shown in Table 1.

[0072] Table 1. Corresponding results of 100-grain weight of tested soybean materials and their genotypes

[0073]

[0074]

[0075]

[0076] The genotyping results of soybean 100-grain weight at Chr19_43194866 of 55 strains of population No. 14025 are shown in Table 1. The 100-grain weight of 55 BC2F4:5 soybean materials was measured and counted. The results are as follows: Figure 2 and Figure 3 As shown. Combined with the genotyping results in Table 1, in 2019, the average 100-grain weight of the AA genotype and CC genotype families were 14.92g and 13.45g, respectively. The genetic variation rate that can be explained by this marker in the population is 35.20%. Compared with the average 100-grain weight of the CC genotype family, the average 100-grain weight of the AA genotype family is significantly higher by 10.95% (P < 0.001); in 2021, the average 100-grain weight of the AA genotype and CC genotype families were 18.81g and 16.67g, respectively. The genetic variation rate that can be explained by this marker in the population is 30.70%. Compared with the average 100-grain weight of the CC genotype family, the average 100-grain weight of the AA genotype family is significantly higher by 12.80% (P < 0.001). The above results show that it is reliable and effective to identify the high and low soybean 100-grain weight by the marker Chr19_43194866_A_C.

[0077] In summary, soybeans with the genotype AA of Chr19_43194866 have high 100-grain weight, soybeans with the genotype CC have low 100-grain weight, and the 100-grain weight of soybeans with the genotype AA is higher than that of the tested soybeans with the genotype CC. When selecting superior varieties of soybean 100-grain weight, soybeans with the genotype AA of the Chr19_43194866 locus were selected for breeding and improvement.

[0078] Example 2. Development and identification of KASP molecular markers

[0079] Molecular markers were developed for the SNP site Chr19_43194866 associated with soybean 100-grain weight discovered in Example 1, and KASP molecular markers were developed based on the base sequence of its complementary chain.

[0080] According to the fluorescence signal, varieties with high 100-grain weight (genotype AA) and varieties with low 100-grain weight (genotype CC) can be clearly distinguished. The specific design is as follows (the primer sequence is synthesized by Shanghai Sangon Biotechnology Co., Ltd.):

[0081] R4866-FAM: 5'-gaaggtgaccaagttcatgctACAAACCAACACAATATTAA-3' (sequence 2);

[0082] R4866-VIC: 5'-gaaggtcggagtcaacggattACAAACCAACACAATATTAC-3' (sequence 3);

[0083] R4866-R: 5'-CCAATTAAGTTGGCCATCAGGC-3' (SEQ ID NO: 4).

[0084] According to the use of this marker, the above-extracted DNA was used as a template to perform PCR detection and analysis on the test soybean material. The PCR system is shown in Table 3, wherein KASP Assay Mix was prepared by itself (1.2 μL each of R4866-FAM and R4866-VIC, 3 μL of R4866-R, 4.6 μL of ddH2O), and the reaction program was: 94°C for 15 min; 94°C for 20 s, 61-55°C for 30 s, 10 cycles, with a decrease of 0.6°C in each cycle; 94°C for 20 s, 55°C for 1 min, 26 cycles, and finally 30°C for 1 min.

[0085] Table 3. PCR reaction system of the test population

[0086] name Volume (μL) 2×KASP Master Mix 2.5 KASP Assay mix 0.07 DNA template (100ng / μL) 2.5 Total volume 5.07

[0087] The marker was used to amplify and genotype 55 soybean materials. The marker can well divide the population into three genotypes: AA, CC and AC. Among them, 26 soybean materials with genotype AA showed yellow fluorescence, 20 soybean materials with genotype CC showed blue fluorescence, 9 soybean materials with AC heterozygous genotype showed green fluorescence, the parent Jidou 12 (high 100-grain weight) showed yellow fluorescence, and the wild soybean ZYD02738 (low 100-grain weight) showed blue fluorescence, which was consistent with the genotype sequencing results ( Figure 4 ).

[0088] In the early stage, dCAPS markers were designed for the SNP site Chr19_43194866. RsaI, EcoRV, and TaqI restriction sites were selected, and the following primers were designed for detection:

[0089] RsaI-F: TCCAGCTTTATTGGTCAAAT;

[0090] RsaI-R: ATCATTCAAGCACAAACCAACACAATAGTA;

[0091] EcoRV-F: GACCAAACAAGATTCTATTTGTATACAGA;

[0092] EcoRV-R:CACGAAAGAAGATCGTGGGT;

[0093] TaqI-F: GGACCAAACAAGATTCTATTTGTATACATC;

[0094] TaqI-R:CTGGCCCTGCATGATTTTAG;

[0095] Test results( Figure 5 ) showed that some target fragments were not well digested by enzymes, and the genotyping results after enzyme digestion were inconsistent with the sequencing results.

[0096] The present invention designs a variety of molecular markers and primer sequences to ultimately obtain the Chr19_43194866 site KASP molecular marker primer combination that is stable in testing, accurate in typing and closely linked to the phenotype.

[0097] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Application of a substance for detecting polymorphism or genotype of a SNP site in a soybean genome in any of the following: (1) Identify or assist in identifying the soybean 100-grain weight trait; (2) Screening or breeding soybean plants, lines, strains or varieties with high 100-grain weight; (3) Screening or breeding soybean plants, lines, strains or varieties with low 100-grain weight; (4) Soybean breeding; (5) Preparing products for identifying or assisting in identifying the soybean 100-grain weight trait; (6) preparing products for screening or breeding soybean plants, strains, lines or varieties with high 100-grain weight; (7) preparing products for screening or breeding soybean plants, strains, lines or varieties with low 100-grain weight; (8) preparing soybean breeding products; The SNP site is a site on soybean chromosome 19, the nucleotide type is A or C, and is the 20th nucleotide of sequence 1 in the sequence list.

2. A method for identifying or assisting in identifying the soybean 100-grain weight trait, characterized in that: The method includes detecting the genotype of a SNP site in the soybean genome to be tested, and identifying or assisting in identifying the soybean 100-grain weight trait based on the genotype. The SNP site is a site on soybean chromosome 19, and its nucleotide type is A or C, which is the 20th nucleotide of sequence 1 in the sequence table.

3. The use according to claim 1 or the method according to claim 2, characterized in that: The genotype of the SNP is AA, CC or AC, the AA genotype is the homozygous type of the SNP being A, the CC genotype is the homozygous type of the SNP being C, and the genotype AC is the heterozygous type of A and C; the identification or auxiliary identification of the soybean 100-grain weight trait based on the SNP genotype is any of the following methods: 1) The soybean to be tested, whose genotype of the SNP is AA, is or is a candidate soybean with high 100-grain weight; 2) The soybean to be tested, whose genotype of the SNP is CC, is or is a candidate soybean with low 100-grain weight; 3) The 100-grain weight of the soybean to be tested whose genotype of the SNP is AA is higher than that of the soybean to be tested whose genotype of the SNP is CC.

4. Application of the method according to claim 2 or 3 in soybean breeding.

5. A method for soybean breeding, characterized in that: The method is M1 or M2, M1, the method comprises detecting the genotype of the SNP in claim 1 in the soybean genome, selecting soybeans with the genotype of the SNP being AA as parents for breeding, wherein the AA is the homozygous type of the SNP being A, and the breeding purpose of the method comprises breeding soybeans with high 100-grain weight trait; M2. The method comprises detecting the genotype of the SNP described in claim 1 in the soybean genome, and selecting soybeans with the genotype of the SNP being CC as parents for breeding, wherein the CC is the homozygous type of the SNP being C. The breeding purpose of the method comprises breeding soybeans with low 100-grain weight trait.

6. A product containing a substance for detecting polymorphism or genotype of a SNP site in a soybean genome, characterized in that: The product is any of the following, C1) Products for detecting single nucleotide polymorphisms or genotypes related to soybean 100-grain weight traits; C2) Products that identify or assist in identifying the soybean 100-grain weight trait; C3) Products for soybean breeding; C4) Screening or breeding soybean plants, lines, strains or varieties with high 100-grain weight; C5) Screening or breeding of soybean plants, plant lines, strains or varieties with low 100-grain weight.

7. The use according to claim 1 or the product according to claim 6, characterized in that: The substance is the following D1), D2) or D3): D1) containing a primer composition for amplifying a soybean genomic DNA fragment including the SNP site; D2) a PCR reagent containing the primer combination described in D1); D3) A kit containing the primer composition described in D1) or the PCR reagent described in D2).

8. The use, method or product according to claim 7, characterized in that: The primer composition consists of primer R4866-FAM, primer R4866-VIC, and primer R4866-R; The primer R4866-FAM is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence list; The primer R4866-VIC is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence list; The primer R4866-R is a single-stranded DNA molecule whose nucleotide sequence is sequence 4 in the sequence list.

9. A DNA molecule, characterized in that: The nucleotide sequence is shown in Sequence 1 of the Sequence Listing.

10. Use of the DNA molecule according to claim 9 in any of the following: (1) Identify or assist in identifying the soybean 100-grain weight trait; (2) Screening or breeding soybean plants, plant lines, strains or varieties with high 100-grain weight; (3) Screening or breeding soybean plants, plant lines, strains or varieties with low 100-grain weight; (4) Soybean breeding; (5) Preparing products for identifying or assisting in identifying the soybean 100-grain weight trait; (6) preparing products for screening or breeding soybean plants, strains, lines or varieties with high 100-grain weight; (7) preparing products for screening or breeding soybean plants, strains, lines or varieties with low 100-grain weight and high 100-grain weight; (8) Prepare soybean breeding products.

Images