A molecular marker tightly linked to wheat fusarium head blight resistance QTL-qFHB3B.2 and its application

Abstract

The present invention belongs to the field of molecular biology and genetic breeding technology, and discloses a molecular marker tightly linked to the wheat fusarium head blight resistance QTL qFHB3B.2 and its application. The present invention discovered a fusarium head blight resistance locus on the long arm of wheat chromosome 3B through genome-wide association analysis. <h2 style=";text-align:left;direction:ltr">qFHB3B.2 The closely linked peak SNP was further mapped to base 571,799,892 on chromosome 3B of the Chinese Spring wheat reference genome, explaining 5.4%-6.7% of the phenotypic variation. PARMS markers designed using this SNP were tested on 132 wheat varieties and found to be simple to use, providing clear typing and a good selection effect against wheat fusarium head blight.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology and genetic breeding, and particularly relates to a molecular marker tightly linked to wheat fusarium head blight resistance QTL-qF HB3B.2 and its application. Background Art

[0002] Wheat scab is a fungal disease of wheat caused by Fusarium graminearum, which occurs frequently in warm, humid climates. In epidemic years, scab can cause severe yield losses in wheat. Furthermore, infected wheat grains contain deoxynivalenol (DON) toxins, which not only harm the health of humans and animals but also seriously affect their edible and feed value. Therefore, scab can cause severe economic losses to wheat production. Although drug control can play a certain role in years when the disease is not serious, it can easily cause environmental pollution. Therefore, analyzing the genetic mechanisms of scab resistance and breeding new scab-resistant wheat varieties are the most economical and effective means of preventing and controlling scab.

[0003] Studies have shown that wheat fusarium head blight resistance is a quantitative trait controlled by multiple genes. Due to the complexity of resistance and the susceptibility of its phenotypic identification to environmental conditions, the discovery of wheat fusarium head blight resistance genes and the study of molecular mechanisms have progressed slowly. At present, wheat germplasms with good fusarium head blight resistance have been discovered in the United States, Japan, Brazil, and Switzerland. The fusarium head blight resistance loci located based on these germplasms are distributed on almost every chromosome of wheat, but the effect values ​​of most gene loci are small. The wheat local varieties Sumai No. 3 and Wangshuibai, originating from Jiangsu Province, my country, are so far recognized as the materials with high fusarium head blight resistance in the world; in both materials, the major effect gene locus Fhb1 located on 3BS was located. In 2019, the team of Professor Ma Zhengqiang from Nanjing Agricultural University and the team of Professor Bai Guihua from Kansas State University in the United States cloned the Fhb1 gene, which encodes the histidine-rich calcium-binding protein TaHR C.

[0004] Although local varieties such as Sumai No. 3 have strong resistance to scab, the presence of unfavorable linkages results in poor agronomic traits in these varieties, making them difficult to use in breeding. Therefore, discovering new scab-resistant varieties and resistance-related gene loci is an important aspect of wheat scab-resistance breeding.

[0005] This study used 240 natural wheat populations to conduct multi-environment QTL detection for fusarium head blight, aiming to identify new QTL sites with an ameliorative effect on wheat fusarium head blight, and to develop practical high-throughput, low-cost molecular markers for selecting wheat fusarium head blight resistance. Summary of the Invention

[0006] The purpose of the present invention is to provide an application of a reagent for detecting bases at positions 571, 799, and 892 on wheat chromosome 3B in wheat fusarium head blight resistance screening and breeding.

[0007] Another object of the present invention is to provide the use of primers for detecting bases 571, 799, and 892 on wheat chromosome 3B in wheat fusarium head blight resistance screening and breeding.

[0008] The last object of the present invention is to provide a method for screening and breeding wheat fusarium resistance.

[0009] In order to achieve the above object, the present invention adopts the following technical measures:

[0010] Obtaining a molecular marker tightly linked to wheat fusarium head blight resistance QTL-qFHB3B.2:

[0011] (1) A population of 240 domestic and foreign wheat varieties (lines) was used to conduct inoculation and identification of Fusarium head blight in the Nanhu experimental field of Hubei Academy of Agricultural Sciences for three consecutive years from 2014 to 2016. The pathogenic fungus strain was Huanggang No. 1.

[0012] (2) Genotyping of 240 wheat populations was performed using a 90K SNP array. Markers with a missing rate exceeding 20% ​​and a minimum allele frequency less than 5% were removed, resulting in a total of 19,803 SNPs remaining for GWAS.

[0013] (3) Using the genotypic and phenotypic data of the above 240 populations, association analysis was performed using a mixed linear model using GEMMA v0.98 software. When P ≤ 0.001, the marker was considered to be significantly associated with the trait.

[0014] (4) Association analysis revealed a fusarium head blight resistance locus on wheat chromosome 3B, which was significant in both the 2014 and 2016 environments, explaining 5.4%–6.7% of the phenotypic variation. The representative association marker was RFL_Contig6099_1363. The locus was physically located at 571.8 Mb on the Chinese Spring reference genome sequence. Across the three environments, the average FHB index of materials carrying the resistant allele was 12.0%–24.0% lower than that of materials carrying the susceptible allele.

[0015] (5) According to the primer design principles, the PARMS marker detection primer sequences were obtained for the nucleotide sequences before and after the peak SNP marker RFL_Contig6099_1363, which is closely linked to qFHB3B.2: P1363F: GCAGAACGCTGACCTTGCA; P1363Rt: GAAGGTGACCAAGTTCATGCTGGCTTGTCCTTGCCAGCA GT; P1363Rc: GAAGGTCGGAGTCAACGGATTGCTTGTCCTTGCCAGCAGC.

[0016] The protection scope of the present invention includes:

[0017] Application of reagents for detecting bases 571, 799, and 892 on wheat chromosome 3B in wheat fusarium head blight resistance screening and breeding.

[0018] Application of a reagent for detecting bases 571, 799, and 892 on wheat chromosome 3B in the preparation of a wheat fusarium head blight resistance screening kit.

[0019] In the above application, if the bases at positions 571, 799, and 892 on the wheat chromosome 3B are detected to be G, the wheat is determined to be resistant to ergot.

[0020] In the above application, if the bases at positions 571, 799, and 892 on the wheat chromosome 3B are detected to be A, the wheat is determined to be susceptible to ergot disease.

[0021] In the above application, the reagent is preferably a primer.

[0022] The primers described above are preferably PARMS detection primers, and more preferably the primers provided by the present invention: P1363F: GCAGAACGCTGACCTTGCA; P1363Rt: GAAGGTGACCAAGTTCATGCTGGCTTGTCCTTGCCAGCAGT; P1363Rc: GAAGGTCGGAGTCAACGGATTGCTTGTCCTTGCCAGCA GC.

[0023] A wheat fusarium head blight resistance screening and breeding method comprises detecting bases 571, 799, and 892 on wheat chromosome 3B using conventional protocols in the art, wherein the conventional protocols include but are not limited to sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, and mass spectrometry.

[0024] The version number of the wheat Chinese Spring genome used in the present invention is IWGSC RefSeq v1.0, and the website is https: / / www.wheatgenome.org / .

[0025] Compared with the prior art, the present invention has the following advantages:

[0026] (1) The present invention obtained the wheat fusarium scab QTL locus qFHB3B.2, which can be repeatedly detected and can explain 5.4%-6.7% of the phenotypic variation rate.

[0027] (2) The present invention obtains a PARMS marker tightly linked to qFHB3B.2, and its detection method is simple and low-cost, which can improve the selection efficiency and accuracy of wheat fusarium head blight resistance screening. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Frequency distribution of fusarium head blight phenotypes in 240 natural wheat populations in three environments.

[0029] Figure 2 The phenotypic differences of ergot disease in different genotypes of the qFHB3B.2 locus under three environments and BLUE. DETAILED DESCRIPTION

[0030] The technical solutions described in this invention, unless otherwise specified, are conventional techniques in the art; the reagents and materials described, unless otherwise specified, are commercially available. The wheat Chinese Spring genome version used in this invention is IWGSCRef Seq v1.0, available at https: / / www.wheatgenome.org / .

[0031] Example 1:

[0032] SNP molecular markers closely linked to wheat fusarium head blight resistance QTL-qFHB3B.2:

[0033] Test materials: WAPS (Wheat Association Panel for Scab research) population consisting of 240 wheat varieties (lines) from China and abroad. The materials used are described in the literature: Zhu Zhanwang, Xu Dengan, Cheng Shunhe, et al. Identification and traceability of the stripe rust resistance gene Fhb1 in Chinese wheat varieties [J]. Acta Agronomica Sinica, 2018, 44(4): 473–482.

[0034] (1) Identification of resistance to fusarium head blight: Fusarium head blight inoculation and identification were carried out in the Nanhu experimental field of Hubei Academy of Agricultural Sciences for three consecutive years from 2014 to 2016. The pathogen strain was Huanggang No. 1. The experiment adopted a completely randomized block design with 2 rows, 1 m row length, 0.25 m row spacing, 2 repetitions, and spray inoculation. 20 days after inoculation, the number of diseased ears, the number of spikelets per ear, and the number of diseased spikelets were investigated. The Fusarium head blight index (FHB index) was calculated using the formula: incidence rate × severity, where the incidence rate is the ratio of the number of diseased ears to the total number of ears, and the severity rate is the average ratio of the number of diseased spikelets per ear to the number of spikelets, both expressed as percentages. Then the 3-year FHB index BLUE value (Best linear unbiased estimate) was calculated ( Figure 1 ).

[0035] (2) Genotyping analysis: 240 wheat populations were genotyped using a 90K SNP chip. 22,922 SNPs with good typing results were selected for subsequent analysis. Markers with a missing rate of more than 20% and a minimum allele frequency of less than 5% were removed, resulting in a total of 19,803 SNPs for GWAS.

[0036] (3) GWAS analysis: Association analysis was performed using a mixed linear model using GEMMA v0.98 software. When P ≤ 0.001, the marker was considered to be significantly associated with the trait.

[0037] (4) Acquisition of qFHB3B.2 and its associated SNP markers: Association analysis revealed a fusarium head blight resistance locus on chromosome 3B, which was significant in both the 2014 and 2016 environments, explaining 5.4%-6.7% of the phenotypic variation. The representative associated marker was RFL_Contig6099_1363, with the flanking sequence: 5'-ATTCGGGCGGCGAATGCGGCGTCGCCTACGAGTCCTACTTCCCCATGCCC[A / G]CTGCTGGCAAGGACAAGCCGTGGTATGCCATCGAGCAAG GTAGCATCCAC-3'. The physical location of the marker on the wheat variety Chinese Spring reference genome sequence (IWGSC, http: / / www.wheatgenome.org) was 571.8 Mb (Table 1). Under the three environments, the average FHB in dex of materials containing the resistant allele was 12.0%-24.0% lower than that of materials containing the susceptible allele ( Figure 2 ).

[0038] Table 1qFHB3B.2 and its associated SNP markers

[0039]

[0040] Example 2:

[0041] Development of a PARMS marker tightly linked to wheat scab:

[0042] Based on the nucleotide sequence before and after the peak SNP marker RFL_Contig6099_1363 that is closely linked to qFHB3B.2, the PARMS marker detection primer sequence was obtained according to the primer design principles:

[0043] P1363F: GCAGAACGCTGACCTTGCA;

[0044] P1363Rt: GAAGGTGACCAAGTTCATGCT GGCTTGTCCTTGCCAGCAGT;

[0045] P1363Rc: GAAGGTCGGAGTCAACGGATT GCTTGTCCTTGCCAGCAGC.

[0046] The method for detecting the genotype of the wheat qFHB3B.2 locus using the above PARMS primer set is as follows:

[0047] (1) Extract the genomic DNA of the wheat to be tested.

[0048] (2) Prepare the reaction system. The reaction system, 5 μL, includes 2.5 μL of 2×PARMS PCR reaction mix (product of Wuhan Jingpeptide Biotechnology Co., Ltd.), aqueous solutions of primers P1363F, P1363Rt, and P1363Rc, DNA, and water. In the reaction system, the concentrations of primers P1363Rt and P1363Rc are both 150 nM, and the concentration of primer P1363F is 400 nM.

[0049] (3) Add 5 μL of mineral oil to the reaction system (to prevent sample evaporation) and then perform PCR amplification.

[0050] The reaction program was as follows: 95°C for 15 min; 95°C for 20 s, 65°C for 1 min, decreasing by 0.8°C per cycle until 57°C, for 10 cycles; 95°C for 20 s, 57°C for 1 min, for 32 cycles.

[0051] (4) After completing step (3), the signal is read on the TECAN Infinite M1000, and then the following judgment is made: if it is blue, the corresponding wheat is or is suspected to be susceptible to ergot; if it is green, the corresponding wheat is or is suspected to be resistant to ergot.

[0052] The above primers were used to detect the genotypes of Jingzhou 66 and Xinong 9871. In the fusarium resistant wheat Jingzhou 66, the sequence amplified by the primers was:

[0053] GCAGAACGCTGACCTTGCACTCTTCACCGCCAATTGATCTCGAGCTAACAATAGCTGAT

[0054] GAAGGAAATGTTATGTGTCCCTTTCCAGGGATTATGCAGGGTCTGGGTCTGTGTACGTG

[0055] ACCCCGGATTCGGGCGGCGAATGCGGCGTCGCCTACGAGTCCTACTTCCCCATGCCCG

[0056] CTGCTGGCAAGGACAAGCC

[0057] In the wheat Xinong 9871 susceptible to fusarium spores, the sequence amplified by this primer is:

[0058] GCAGAACGCTGACCTTGCACTCTTCACCGCCAATTGATCTCGAGCTAACAATAGCTGAT

[0059] GAAGGAAATGTTATGTGTCCCTTTCCAGGGATTATGCAGGGTCTGGGTCTGTGTACGTG

[0060] ACCCCGGATTCGGGCGGCGAATGCGGCGTCGCCTACGAGTCCTACTTCCCCATGCCCA

[0061] CTGCTGGCAAGGACAAGCC

[0062] Example 3:

[0063] Universality of PARMS markers in wheat fusarium head blight resistance selection:

[0064] The PARMS primer set designed in Example 2 was used to detect the genotype and genetic effect of the qFHB3B.2 locus in the wheat to be tested. The wheat to be tested consisted of 132 domestic and foreign wheat varieties (lines) (collected by the applicant). Fusarium head blight inoculation and identification were carried out in Ezhou and Jingzhou, Hubei Province, from 2021 to 2022, according to the method used in Example 1. The Fusarium head blight index (FHBindex) was calculated.

[0065] The results showed that among the 132 wheat varieties (lines), 49 accessions were identified with the AA / TT genotype and 83 with the GG / CC genotype (Table 2). The FHB index differences between the AA and GG genotypes were highly significant in all three environments, ranging from 7.2% to 16.8%, with a mean of 11.2%. These results indicate that the qFHB3B.2 locus segregates among the 132 domestic and international wheat varieties (lines) and exhibits a stable and reliable genetic effect.

[0066] Table 2 Fusarium head blight phenotypes of two genotypes of PARMS marker qFHB3B.2 in 132 wheat cultivars

[0067] genotype 2021EZ 2022EZ 2022JZ AA (n=49) 45.9％ 20.7％ 29.6％ GG (n=83) 29.1％ 13.5％ 20.0％ AA-GG 16.8％ 7.2％ 9.6％ Pt-test 7.2E-04 3.2E-03 6.7E-3

[0068] The above results indicate that the prepared PARMS molecular marker qFHB3B.2 has a significant effect on wheat fusarium resistance and has a good screening effect.

Claims

1. Use of a reagent for detecting the genotype at base 571,799,892 on chromosome 3B of the wheat genome in selective breeding for scab resistance. If the reagent detects that base 571,799,892 on chromosome 3B is G, the wheat is determined to be scab-resistant wheat; if the reagent detects that base 571,799,892 on chromosome 3B is A, the wheat is determined to be scab-susceptible wheat. The wheat genome is IWGSC RefSeq v1.

0.

2. Use of a reagent for detecting bases 571, 799, and 892 on wheat chromosome 3B in preparing a kit for screening wheat scab resistance. If the reagent detects a G at base 571, 799, and 892 on wheat chromosome 3B, the wheat is determined to be scab-resistant; if the reagent detects an A at base 571, 799, and 892 on wheat chromosome 3B, the wheat is determined to be scab-susceptible. The wheat genome is IWGSC RefSeq v1.

0.

3. The use according to claim 1 or 2, characterized in that: The reagent is a primer.

4. The use according to claim 3, wherein the primers are: P1363F: GCAGAACGCTGACCTTGCA; P1363Rt: GAAGGTGACCAAGTTCATGCTGGCTTGTCCTTGCCAGCAGT and P1363Rc: GAAGGTCGGAGTCAACGGATTGCTTGTCCTTGCCAGCAGC.

5. A wheat scab resistance screening and breeding method, comprising detecting bases 571, 799, and 892 on wheat chromosome 3B; if base 571, 799, and 892 on wheat chromosome 3B is detected as G, the wheat is determined to be scab-resistant wheat; if base 571, 799, and 892 on wheat chromosome 3B is detected as A, the wheat is determined to be scab-susceptible wheat, wherein the wheat genome is IWGSC RefSeq v1.

0.

6. The method according to claim 5, wherein the method is PCR detection, and the primers for the PCR detection are P1363F: GCAGAACGCTGACCTTGCA; P1363Rt: GAAGGTGACCAAGTTCATGCTGGCTTGTCCTTGCCAGCAGT and P1363Rc: GAAGGTCGGAGTCAACGGATTGCTTGTCCTTGCCAGCAGC.

Images