DsRNA molecule for inhibiting C5 gene expression and application thereof

Abstract

The invention discloses a modified dsRNA (double-stranded ribonucleic acid) molecule and application thereof. Specifically, the invention provides a dsRNA molecule for inhibiting C5 gene expression, the dsRNA molecule comprises a positive-sense strand and an antisense strand which are complementary to form a double-stranded region, the positive-sense strand and / or the antisense strand comprises 15-25 nucleotides or consists of 15-25 nucleotides, and the dsRNA molecule can be used for treating and / or preventing C5 gene mediated diseases.

Description

A dsRNA molecule for inhibiting C5 gene expression and its application

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to a prior application, patent application number 202310603955.5, filed with the State Intellectual Property Office of China on May 26, 2023, entitled “A dsRNA Molecule for Inhibiting C5 Gene Expression and Its Application.” The entire text of this prior application is incorporated herein by reference. Technical Field

[0003] The present invention belongs to the field of molecular biology and relates to a modified dsRNA molecule and its application, and specifically to a dsRNA molecule for inhibiting complement C5 gene expression and its pharmaceutical composition, as well as a method for reducing the expression level of complement C5 gene using the dsRNA molecule or its pharmaceutical composition. Background Art

[0004] RNA interference (RNAi) refers to the highly conserved evolutionary phenomenon of efficient and specific degradation of homologous mRNAs induced by double-stranded RNA (dsRNA). RNAi is a ubiquitous surveillance mechanism in eukaryotes that protects against viral invasion, inhibits transposon activity, and regulates gene expression. Small interfering RNA (dsRNA), a short double-stranded RNA molecule of 19 to 30 bp in length, is a key tool in RNAi technology. In nature, upon entering cells, dsRNA is specifically recognized and cleaved by the enzyme Dicer into small RNA fragments (i.e., 21 to 23 nucleotides in length). The resulting dsRNA fragments unwind into single strands and form complexes with certain proteins (RISC). RISC binds to complementary mRNAs within the cell and cleaves them, degrading them. This prevents protein synthesis and results in gene silencing. In industrial production, chemical synthesis and modification of dsRNA are preferred to further enhance the stability and efficacy of dsRNA therapeutics.

[0005] Complement is a group of heat-labile proteins that acquire enzymatic activity upon activation and are found widely in serum, tissue fluid, and cell membranes. It comprises over 30 soluble and membrane-bound proteins, collectively known as the complement system. Under physiological conditions, the vast majority of complement components exist as inactive enzyme precursors. These components are activated by a series of enzymatic reactions catalyzed by various activators (such as bacteria and antigen-antibody complexes), exhibiting diverse biological activities. These components participate in both specific and nonspecific immune mechanisms, including antimicrobial defense responses, immunomodulation, and injurious responses that mediate immunopathological processes. Overactivation or inhibition of the complement system plays a crucial role in the pathogenesis of numerous diseases, ranging from acute inflammatory conditions such as eye and periodontal diseases to chronic conditions such as cancer, autoimmune diseases, neurodegenerative disorders, kidney disease, and chronic hemolytic disorders. Three known complement activation pathways are the classical pathway, the alternative pathway, and the lectin pathway. Complement protein C5 is at the terminal end of the complement cascade. All pathways of complement activation result in the cleavage of the C5 molecule, generating the anaphylatoxins C5a and C5b. C5a binds to its receptor and exerts its primary proinflammatory activity. C5b combines with four other complement proteins (C6, C7, C8, and C9) to form the complex C5b-9, which induces cell lysis by forming the membrane attack complex (MAC). Sublytic MAC and soluble C5b-9 also possess numerous non-cytolytic immune functions (MAC). The two complement effectors, C5a and C5b-9, generated by C5 cleavage, are key components of the complement system responsible for propagating and / or initiating pathology in diverse diseases, such as: ophthalmic diseases such as age-related macular degeneration (AMD); CNS / PNS diseases such as Alzheimer's disease (AD) and myasthenia gravis (gMG); renal diseases such as atypical hemolytic uremic syndrome (aHUS), C3 glomerulopathy (C3G), and IgA nephropathy; and hematologic diseases such as paroxysmal nocturnal hemoglobinuria (PNH) and thrombotic microangiopathy (TMAs). Therefore, targeting the C5 protein can modulate complement signaling activated by these three distinct complement pathways.

[0006] There is a need in the art for replacement and combination therapies for patients suffering from complement component C5-associated diseases.

[0007] Summary of the Invention

[0008] The present invention provides a dsRNA molecule, reagent, kit, and pharmaceutical composition for inhibiting complement C5 gene expression, as well as methods and uses of the dsRNA molecule, reagent, kit, or pharmaceutical composition for inhibiting or reducing C5 gene expression and preventing or treating complement-mediated diseases or symptoms. The dsRNA molecule promotes sequence-specific degradation of C5 mRNA through RNAi, thereby inhibiting C5 gene expression or reducing C5 gene expression levels.

[0009] In one aspect, the present invention provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of complement component C5, wherein the dsRNA comprises a sense strand and an antisense strand, wherein the sense strand and / or antisense strand comprises at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence of any of the sense sequences and antisense sequences listed in Table 2, Table 6, and Table 9.

[0010] In some embodiments, the present invention provides a dsRNA molecule, the nucleotide sequence of the sense strand of which is as shown in the sequence in Table 2, and the nucleotide sequence of the antisense strand is as shown in the sequence in Table 2. The sense strand and / or the antisense strand comprises or consists of 15-25 nucleotides, the antisense strand is complementary to 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 consecutive nucleotides of a sequence in the sequence listing, the length of the double-stranded region is 15-25 bp, preferably 19-21 bp, and at least one nucleotide in the dsRNA molecule is modified.

[0011] In some embodiments, the sense and antisense strands comprise a sequence selected from the group consisting of the dsRNA molecules designated as 5-E04, 5-E05, 7-E04, 7-E05, 17-E04, 17-E05, 32-E04, 32-E05, 85-E04, 85-E05, GAL-E5, GAL-E17, GAL-E85-1, GAL-E85.

[0012] In some embodiments, the modification is selected from any one or more of the following: locked nucleic acid (LNA) modification, open ring or unlocked (UNA) modification, 2′-methoxyethyl modification, 2′-O-methyl modification, 2′-O-allyl modification, 2′-C-allyl modification, 2′-fluoro modification, 2′-deoxy modification, 2′-hydroxyl modification, thiophosphate backbone modification, DNA modification, fluorescent probe modification and ligand modification.

[0013] In some embodiments, the naked sequence of the sense strand of the dsRNA molecule is as shown in (A1), (A2) or (A3); the naked sequence of the antisense strand of the dsRNA molecule is as shown in (A4) (A5) or (A6):

[0014] (A1)GUGAUUCAAGUUUAUGGAUAC (SEQ ID NO: 5)

[0015] (A2)UGUGUAUUUGGAAGUUGUAUC (SEQ ID NO: 17)

[0016] (A3)GUGAAGAAAUGUUGUUACGAU (SEQ ID NO: 85)

[0017] (A4)GUAUCCAUAAACUUGAAUCACAA (SEQ ID NO: 105)

[0018] (A5)GAUACAACUUCCAAAUACACAUA (SEQ ID NO: 117)

[0019] (A6)AUCGUAACAACAUUUCUUCACUA (SEQ ID NO: 185).

[0020] In some embodiments, the modification methods of the dsRNA molecules provided by the present invention include: (1) the sense strand: 17-21 nt in length, such as 21 nt; composed of alternating 2′-O-methyl modified regions and 2′-fluoro modified regions, each modified region is 1 to 3 nucleotides in length; the modification methods of the 5′ end and the first modified region from the 3′ end are the same; (2) the antisense strand: 19-23 nt in length, such as 23 nt; composed of alternating 2′-O-methyl modified regions, 2′-fluoro modified regions, unmodified regions or DNA regions, each modified region is 1 to 5 nucleotides in length; and the continuous nucleotide region from the 2nd to the 5th position from the 5′ end and the continuous nucleotide region from the 1st to the 3rd position from the 3′ end are both connected by a thiophosphate backbone.

[0021] In some embodiments, the modification methods of the dsRNA molecules of the present invention include: (1) sense chain: 2 nt in length, with 2′-fluoro modifications at positions 7 and 9-11 from the 5′ end, and 2′-O-methyl modifications at the remaining positions, and a continuous nucleotide region from positions 1 to 3 from the 5′ end is connected by a thiophosphate backbone; (2) antisense chain: 23 nt in length; with 2′-fluoro modifications at positions 2, 14, 16 and optionally 6 from the 5′ end, and 2′-O-methyl modifications at the remaining positions, and a continuous nucleotide region from positions 1 to 3 from the 5′ end, and a continuous nucleotide region from positions 1 to 3 from the 3′ end are connected by a thiophosphate backbone.

[0022] In some embodiments, the sense strand of the dsRNA molecule has a modification as shown in modification motif 1; the antisense strand of the dsRNA molecule has a modification as shown in modification motif 3 or modification motif 4; wherein,

[0023] Modification motif 1 is: XmsXmsXmXmXmXmXfXmXfXfXfXmXmXmXmXmXmXmXmXmXmXmXm;

[0024] Modification motif 3 is: XmsXfsXmXmXmXfXmXmXmXmXmXmXmXfXmXfXmXmXmXmXmXmsXmsXm;

[0025] Modification motif 4 is: XmsXfsXmXmXmXmXmXmXmXmXmXmXmXmXfXmXfXmXmXmXmXmXmsXmsXm; wherein, X in each modification motif represents the ribonucleotides from 5' to 3' of the sense chain, respectively, from 5' to 3', Xm represents a 2'-O-methyl modified ribonucleotide; Xf represents a 2'-fluoro modified ribonucleotide; s represents the two nucleotides connected by a thiophosphate backbone.

[0026] In some embodiments, the structure of the sense strand of the dsRNA molecule is as shown in (B1), (B2) or (B3); the structure of the antisense strand of the dsRNA molecule is as shown in (B4), (B5), (B6), (B7), (B8) or (B9):

[0027] wherein (B1), (B2) or (B3) is (A1), (A2) or (A3) having modification motif 1, namely:

[0028] (B1): SEQ ID NO: 5 with modified motif 1

[0029] (B2): SEQ ID NO: 17 with modified motif 1

[0030] (B3): SEQ ID NO: 85 with modified motif 1

[0031] wherein (B4), (B5) or (B6) is (A4), (A5) or (A6) having modification motif 3, and (B7), (B8) or (B9) is (A4), (A5) or (A6) having modification motif 4, that is:

[0032] (B4): SEQ ID NO: 105 with modified motif 3

[0033] (B5): SEQ ID NO: 117 with modified motif 3

[0034] (B6): SEQ ID NO: 185 with modified motif 3

[0035] (B7): SEQ ID NO: 105 with modified motif 4

[0036] (B8): SEQ ID NO: 117 with modified motif 4

[0037] (B9): SEQ ID NO: 185 with modified motif 4

[0038] in,

[0039] Modification motif 1 is XmsXmsXmXmXmXmXfXmXfXfXfXmXmXmXmXmXmXmXmXmXmXm

[0040] Modification motif 3 is XmsXfsXmXmXfXmXmXmXmXmXmXmXfXmXmXmXmXmXmXmsXmsXm

[0041] Modification motif 4 is XmsXfsXmXmXmXmXmXmXmXmXmXmXmXfXmXfXmXmXmXmXmXmsXmsXm;

[0042] In addition, X in each modification motif represents the ribonucleotides from 5' to 3' of the sense chain respectively from 5' to 3', Xm represents a 2'-O-methyl modified ribonucleotide; Xf represents a 2'-fluoro modified ribonucleotide; s represents the two nucleotides connected by a thiophosphate backbone.

[0043] In some preferred embodiments, the dsRNA molecule is selected from the group consisting of:

[0044] 5-E04

[0045] Chain of Justice:

[0046] SEQ ID NO: 5 with modified motif 1;

[0047] Antisense strand:

[0048] SEQ ID NO: 105 with modification motif 3.

[0049] 5-E05

[0050] Chain of Justice:

[0051] SEQ ID NO: 5 with modified motif 1;

[0052] Antisense strand:

[0053] SEQ ID NO: 105 with modification motif 4.

[0054] 7-E04

[0055] Chain of Justice:

[0056] SEQ ID NO: 7 with modified motif 1;

[0057] Antisense strand:

[0058] SEQ ID NO: 107 with modification motif 3.

[0059] 7-E05

[0060] Chain of Justice:

[0061] SEQ ID NO: 7 with modified motif 1;

[0062] Antisense strand:

[0063] SEQ ID NO: 107 with modified motif 4.

[0064] 17-E04

[0065] Chain of Justice:

[0066] SEQ ID NO: 17 with modified motif 1;

[0067] Antisense strand:

[0068] SEQ ID NO: 117 with modification motif 3.

[0069] 17-E05

[0070] Chain of Justice:

[0071] SEQ ID NO: 17 with modified motif 1;

[0072] Antisense strand:

[0073] SEQ ID NO: 117 with modification motif 4.

[0074] 32-E04

[0075] Chain of Justice:

[0076] SEQ ID NO: 32 with modified motif 1;

[0077] Antisense strand:

[0078] SEQ ID NO: 132 with modification motif 3.

[0079] 32-E05

[0080] Chain of Justice:

[0081] SEQ ID NO: 32 with modified motif 1;

[0082] Antisense strand:

[0083] SEQ ID NO: 132 with modification motif 4.

[0084] 85-E04

[0085] Chain of Justice:

[0086] SEQ ID NO: 85 with modified motif 1;

[0087] Antisense strand:

[0088] SEQ ID NO: 185 with modification motif 3.

[0089] 85-E05

[0090] Chain of Justice:

[0091] SEQ ID NO: 85 with modified motif 1;

[0092] Antisense strand:

[0093] SEQ ID NO: 185 with modification motif 4.

[0094] In some preferred embodiments, the dsRNA molecule is 85-E04, 85-E05, 5-E05, or 17-E05.

[0095] In some embodiments, the dsRNA molecule is ligand-modified. The ligand is a portion taken up by host cells, and ligand modification can improve the cellular uptake, intracellular targeting, half-life, or drug metabolism or kinetics of the dsRNA molecule. In some embodiments, compared to dsRNA without ligand modification, the ligand-modified dsRNA has enhanced affinity or cellular uptake for selected targets (such as specific tissue types, cell types, organelles, etc.), such as hepatocytes. Ligand modification does not interfere with the activity of the dsRNA.

[0096] In some embodiments, the ligand modification is one or more ligand modifications to the 3' end, the 5' end, and / or the middle of the sequence of the dsRNA molecule.

[0097] In some preferred embodiments, the ligand is selected from the group consisting of cholesterol, biotin, vitamins, galactose derivatives or analogs, lactose derivatives or analogs, N-acetylgalactosamine derivatives or analogs, and N-acetylglucosamine derivatives or analogs. The ligand targets a cell surface receptor comprising a galactose, galactosamine, lactose, or N-acetylgalactosamine / glucosamine moiety. The ligand is preferably targeted to the liver, particularly to the parenchymal cells of the liver.

[0098] In some preferred embodiments, the ligand targets the ASGPR receptor.

[0099] In some preferred embodiments, the ligand may also be human serum albumin (HSA), hyaluronic acid, polypeptide, etc.

[0100] In some preferred embodiments, the ligand is L96, and the structure of L96 and its connection with the sense chain nucleotide are as follows:

[0101] In some preferred embodiments, the ligand-modified dsRNA is selected from any one of the following dsRNA molecules:

[0102] GAL-E5

[0103] Chain of Justice:

[0104] SEQ ID NO. 5 having modified motif 1, the 3' end of which is connected to L96.

[0105] Antisense strand:

[0106] SEQ ID NO. 105 with modified motif 4.

[0107] GAL-E17

[0108] Chain of Justice:

[0109] SEQ ID NO. 17 having modified motif 1, wherein the 3' end thereof is connected to L96.

[0110] Antisense strand:

[0111] SEQ ID NO. 117 with modified motif 4.

[0112] GAL-E85-1

[0113] Chain of Justice:

[0114] SEQ ID NO. 85 having modified motif 1, whose 3' end is connected to L96.

[0115] Antisense strand:

[0116] SEQ ID NO. 185 with modified motif 3.

[0117] GAL-E85

[0118] Chain of Justice:

[0119] SEQ ID NO. 85 having modified motif 1, whose 3' end is connected to L96.

[0120] Antisense strand:

[0121] SEQ ID NO. 185 with modified motif 4.

[0122] As described in this application, each modification motif is defined as follows:

[0123] Modification motif 1: XmsXmsXmXmXmXmXfXmXfXfXfXmXmXmXmXmXmXmXmXmXmXmXm;

[0124] Modification motif 2: XmsXmsXfXmXfXmXfXfXfXfXmXfXmXfXmXfXmXfXmXmXmXm;

[0125] Modification motif 3: XmsXfsXmXmXmXfXmXmXmXmXmXmXmXfXmXfXmXmXmXmXmXmsXmsXm;

[0126] Modification motif 4: XmsXfsXmXmXmXmXmXmXmXmXmXmXmXfXmXfXmXmXmXmXmXmsXmsXm;

[0127] Modification motif 5: XmsXfsXfXmXfXmXfXmXfXmXfXmXfXmXfXmXfXmXmXmXmsXmsXmdTdT;

[0128] Wherein, Xm represents a 2′-O-methyl modified ribonucleotide; Xf represents a 2′-fluoro modified ribonucleotide; and s represents that the two nucleotides are connected by a thiophosphate backbone.

[0129] It should be understood that, in the present application, when describing that the sense strand of a dsRNA molecule has a modification as shown in modification motif 1 or 2, or describing that the antisense strand of a dsRNA molecule has a modification as shown in modification motif 3, 4 or 5, it means that X in each modification motif corresponds sequentially from 5' to 3' to the ribonucleotides from 5' to 3' of the sense strand or antisense strand, respectively, wherein the ribonucleotides from 5' to 3' of the sense strand or antisense strand have the same ribonucleotide modification as the X at the same position in the corresponding modification motif. For example, when describing that the sense strand of a dsRNA molecule has a modification as shown in modification motif 1, it means that the ribonucleotides from 5' to 3' of the sense strand of the dsRNA molecule have the same ribonucleotide modifications as the Xs from 5' to 3' in modification motif 1, that is, the sense strand has 2'-fluoro modifications at positions 7 and 9-11 from the 5' end, and the remaining positions have 2'-O-methyl modifications, and the consecutive nucleotide regions from positions 1 to 3 from the 5' end are connected by a thiophosphate backbone; similarly, when describing that the dsRNA molecule has a modification as shown in modification motif 1, it means that the ribonucleotides from 5' to 3' of the sense strand of the dsRNA molecule have the same ribonucleotide modifications as the Xs from 5' to 3' in modification motif 1, that is, the 7th and 9th to 11th positions from the 5' end of the sense strand have 2'-fluoro modifications, and the remaining positions have 2'-O-methyl modifications, and the consecutive nucleotide regions from positions 1 to 3 from the 5' end are connected by a thiophosphate backbone. "The antisense strand of a dsRNA molecule has a modification as shown in modification motif 4," means that the ribonucleotides from 5' to 3' of the antisense strand of the dsRNA molecule each have the same ribonucleotide modifications as the Xs from 5' to 3' in modification motif 4, i.e., the antisense strand has 2'-fluoro modifications at positions 2, 14, and 16 from the 5' end, and 2'-O-methyl modifications at the remaining positions, and the contiguous nucleotide region from positions 1 to 3 from the 5' end, and the contiguous nucleotide region from positions 1 to 3 from the 3' end, are linked by a phosphorothioate backbone. In some embodiments, when the sense strand of a dsRNA molecule is described as having a modification as shown in modification motif 1 or 2, or the antisense strand of a dsRNA molecule is described as having a modification as shown in modification motif 3, 4, or 5, the nucleotides at each position of the dsRNA molecule do not contain other chemical modifications other than the nucleotide modifications corresponding to the Xs in the modification motif. In some embodiments, when the sense strand of a dsRNA molecule is described as having a modification as shown in modification motif 1 or 2, or the antisense strand of a dsRNA molecule is described as having a modification as shown in modification motif 3, 4, or 5, the nucleotides at each position of the dsRNA molecule do not contain other chemical modifications except for the nucleotide modification corresponding to X in the modification motif and the ligand attached to the 3' end of the sense strand.

[0130] In some more preferred embodiments, the ligand-modified dsRNA is selected from the following molecules:

[0131] Chain of Justice:

[0132] SEQ ID NO. 85 having modified motif 1, whose 3' end is connected to L96.

[0133] Antisense strand:

[0134] SEQ ID NO. 185 with modified motif 4.

[0135] Chain of Justice:

[0136] SEQ ID NO. 5 having modified motif 1, the 3' end of which is connected to L96.

[0137] Antisense strand:

[0138] SEQ ID NO. 105 with modified motif 4.

[0139] In some preferred embodiments, each strand of the dsRNA molecule may contain 0% to 100% modified nucleotides, such as 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% modified nucleotides. The modifications may be in the overhang region or the double-stranded region. The modifications may be used to improve the in vitro or in vivo characteristics of the dsRNA molecule, such as stability, biodistribution, inhibitory activity, etc. The above modifications may be used in combination.

[0140] In some preferred embodiments, each end of the dsRNA molecule has an overhang or a blunt end; including 1-8 overhangs, such as 1, 2, 3, 4, 5, 6, 7, or 8 overhangs at the 5' and / or 3' ends of any chain or double chain, and the overhangs are arbitrarily selected from U, A, G, C, T, and dT.

[0141] In some preferred embodiments, the dsRNA molecule is capable of inhibiting the expression of C5 genes in humans and cynomolgus monkeys.

[0142] In another aspect, the present invention also relates to biological materials associated with dsRNA;

[0143] In some embodiments, the dsRNA-associated biological material can be selected from any one of the following:

[0144] (A) a DNA molecule capable of producing the dsRNA;

[0145] (B) a vector capable of expressing the dsRNA;

[0146] (C) a reagent or kit containing the dsRNA or the DNA molecule or the vector;

[0147] (D) A pharmaceutical composition, consisting of the dsRNA molecule and other pharmaceutically acceptable components.

[0148] In some embodiments, the pharmaceutical composition includes a pharmacologically effective amount of the dsRNA molecule of the present invention and other pharmaceutically acceptable components; the "effective amount" refers to the amount of the dsRNA molecule that can effectively produce the desired pharmacological therapeutic effect.

[0149] In some embodiments, "other components" include water, saline, glucose, buffer (such as PBS), excipients, diluents, disintegrants, binders, lubricants, sweeteners, flavorings, preservatives, or combinations thereof.

[0150] In another aspect, the present invention relates to the use of dsRNA or related biological materials for preventing and / or treating diseases mediated by the C5 gene, or for alleviating the symptoms of diseases mediated by the C5 gene. In another aspect, the present invention relates to the use of dsRNA or related biological materials for preparing a preparation or medicament for preventing and / or treating diseases mediated by the C5 gene, or for alleviating the symptoms of diseases mediated by the C5 gene. The diseases mediated by the C5 gene include, but are not limited to, paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), asthma, rheumatoid arthritis (RA), antiphospholipid antibody syndrome, lupus nephritis, ischemia-reperfusion injury, typical or infectious hemolytic uremic syndrome (tHUS), dense deposit disease (DDD), neuromyelitis optica (NMO), multifocal motor neuropathy (MMN), multiple sclerosis (MS), macular degeneration (e.g., age-related macular degeneration (AMD)), hemolysis, elevated liver enzymes, and low platelets (HELLP) syndrome, thrombotic thrombocytopenic purpura (TTP); spontaneous abortion, pauci-immune vasculitis, epidermolysis bullosa, recurrent miscarriage, preeclampsia, traumatic brain injury, myasthenia gravis, cold agglutinin disease, dermatomyositis bullous pemphigoid, Shiga toxin (Shiga coli-associated hemolytic-uremic syndrome, C3 nephropathy, antineutrophil cytoplasmic antibody-associated vasculitis, humoral and vascular transplant rejection, graft dysfunction, myocardial infarction, allogeneic transplantation, sepsis, coronary artery disease, dermatomyositis, Graves' disease, atherosclerosis, Alzheimer's disease, systemic inflammatory response sepsis, septic shock, spinal cord injury, glomerulonephritis, Hashimoto's thyroiditis, type I diabetes mellitus, psoriasis, pemphigus, autoimmune hemolytic anemia (AIHA), ITP, Goodpasture's syndrome, Degos' disease, antiphospholipid syndrome (APS), catastrophic APS (CAPS), cardiovascular disorders, myocarditis, cerebrovascular disease, peripheral vascular disease disease, renovascular disease, mesenteric / intestinal vascular disease, vasculitis, Henoch-Schönlein purpura nephritis, vasculitis associated with systemic lupus erythematosus, vasculitis associated with rheumatoid arthritis, immune complex vasculitis, Takayasu's disease, dilated cardiomyopathy, diabetic vasculopathy, Kawasaki's disease (arteritis), diseases associated with viral infections (such as COVID-19), chronic obstructive pulmonary disease (COPD), acute respiratory distress syndrome (ARDS), C5-related tumors (such as liver cancer, lung cancer, etc.), venous gas embolism (VGE) and restenosis after stent placement, rotational atherectomy, membranous nephropathy, Guillain-Barre syndrome and percutaneous transluminal coronary angioplasty (PTCA).

[0151] In another aspect, the present invention relates to the use of dsRNA or related biological materials for preparing a method for preventing and / or treating IgA nephropathy.

[0152] In some embodiments, the present invention further provides any of the following uses:

[0153] Use of the dsRNA or the biological material in inhibiting C5 gene expression or preparing a product for inhibiting C5 gene expression.

[0154] Inhibiting C5 gene expression means inhibiting or reducing the expression level of the C5 gene in humans or monkeys in vivo or in vitro cells; inhibiting C5 gene expression means inhibiting or reducing the expression level of the C5 gene by at least 95%, 90%, 85%, 80%, 75%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, or 5%. Detection of target gene, target RNA, or target protein levels can be used to predict or evaluate activity, efficacy, or therapeutic outcomes.

[0155] In some embodiments, the cells are mammalian cells expressing C5, such as primate cells or human cells. More preferably, the target cells express high levels of the C5 gene. More preferably, the cells are derived from the brain, lung, liver, kidney, or tumor. Even more preferably, the cells are hepatocellular carcinoma cells.

[0156] In some embodiments, the cells are selected from HepG2, HEP3B, Huh7, MHCC97H, Hela, cynomolgus monkey primary cells, and human primary cells.

[0157] In some embodiments, the final cellular concentration of the dsRNA molecule is 0.001-1000 nM, such as 0.001-10 nM, 10-500 nM, 25-300 nM or 50-100 nM.

[0158] In some embodiments, the dsRNA or related biological materials can be administered by any suitable means, such as parenteral administration, including intramuscular, intravenous, intraarterial, peritoneal, or subcutaneous injection; administration modes include but are not limited to single administration or multiple administrations.

[0159] In some preferred embodiments, the dosage range is 0.1 mg / kg to 100 mg / kg, 0.5 mg / kg to 50 mg / kg, 3 mg / kg to 36 mg / kg, 2.5 mg / kg to 20 mg / kg, 5 mg / kg to 15 mg / kg, for example: 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg, 10 mg / kg, 11 mg / kg, 12 mg / kg, 13 mg / kg g, 14mg / kg, 15mg / kg, 16mg / kg, 17mg / kg, 18mg / kg, 19mg / kg, 20mg / kg, 21mg / kg, 22mg / kg, 23mg / kg, 24mg / kg, 25m g / kg, 26mg / kg, 27mg / kg, 28mg / kg, 29mg / kg, 30mg / kg, 31mg / kg, 32mg / kg, 33mg / kg, 34mg / kg, 35mg / kg, 36mg / kg.

[0160] In some embodiments, a single dose of the pharmaceutical composition can be long-lasting, with the reduction in C5 expression lasting for at least 3, 5, 7, 10, 14, or more days.

[0161] In some embodiments, the dsRNA or the biological material is used to reduce C5 in serum or to prepare a product for reducing C5 in serum.

[0162] Wherein, the lowering of the C5 concentration in serum is to lower the C5 concentration in human or monkey serum; for example, the concentration or content of serum C5 is reduced by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 98%.

[0163] In some embodiments, the use of the dsRNA or the biological material in preventing and / or treating a disease mediated by the C5 gene or in preparing a product for preventing and / or treating a disease mediated by the C5 gene;

[0164] In some embodiments, the dsRNA or the biological material is used to alleviate the symptoms of a disease mediated by the C5 gene or to prepare a product for alleviating the symptoms of a disease mediated by the C5 gene.

[0165] In some embodiments, the disease mediated by the C5 gene is preferably an immune-related, blood-related, or metabolic-related disease.

[0166] In some embodiments, the C5 gene-mediated disease or symptom can be caused by overexpression of the C5 gene or overproduction of C5 protein, and can be regulated by downregulating C5 gene expression. Treatment refers to alleviation, reduction, or cure of the C5 gene-mediated disease or symptom, such as a reduction in serum C5 levels. For example, the serum C5 content or concentration may be reduced by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%.

[0167] In some embodiments, the present invention also provides the use of the ligand-modified dsRNA molecule in the preparation of a liver-targeted drug; the liver-targeted drug can be used to treat liver diseases mediated by the C5 gene.

[0168] In another aspect, the present invention also provides methods and / or combination therapies for treating a subject having a condition that would benefit from inhibition or reduction of expression of the C5 gene, such as a complement component C5-associated disease, such as paroxysmal nocturnal hemoglobinuria (PNH) and atypical hemolytic uremic syndrome (aHUS), using RNAi compositions that affect RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of the complement component C5 gene.

[0169] The combination therapies of the invention comprise administering an RNAi agent of the invention and an additional therapeutic agent, such as an anti-complement component C5 antibody or antigen-binding fragment thereof, eculizumab, to a patient suffering from a complement component C5-associated disease. The combination therapies of the invention reduce C5 levels in the subject (e.g., by about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 99%) by targeting C5 mRNA with an RNAi agent of the invention, and thus, allow a reduction in the therapeutically (or prophylactically) effective amount of eculizumab required to treat the subject, thereby reducing treatment costs and allowing simpler and more convenient methods of administering eculizumab, such as subcutaneous administration.

[0170] In some embodiments, the additional therapeutic agent can be an anti-complement component C5 antibody or an antigen-binding fragment or derivative thereof.

[0171] The innovations of the present invention are as follows: 1. The modified dsRNA molecules have high stability and high inhibitory activity; 2. While maintaining high inhibitory activity and stability, the ligand-modified dsRNA molecules also have good liver targeting and the ability to promote cellular endocytosis, which can reduce the impact on other tissues or organs and reduce the amount of dsRNA molecules used, thereby achieving the goals of reducing toxicity and lowering costs; in addition, the ligand-modified dsRNA molecules can enter target cells and target tissues without the need for transfection reagents, reducing the negative effects of transfection reagents, such as cell or tissue toxicity, thereby providing the possibility of targeted therapy. Although many modifications can be attempted to improve the performance of dsRNA, these attempts generally have difficulty in demonstrating both RNA interference and improved stability in serum (e.g., increased resistance to nucleases and / or prolonged duration). The modified dsRNA of the present invention has high stability while maintaining high inhibitory activity, achieving unexpected technical effects.

[0172] definition:

[0173] One strand of siRNA that can complementarily pair with the target gene mRNA is called the antisense strand (AS), and the other strand is called the sense strand (SS).

[0174] "G," "C," "A," "T," and "U" generally represent nucleotides based on guanine, cytosine, adenine, thymine, and uracil, respectively.

[0175] REL (Relative expression level): relative expression level of mRNA

[0176] GalNAc: N-acetylgalactosamine

[0177] Modification: N = RNA; dN = DNA; Nm = 2'OMe modification; Nf = 2'F modification; (s) = PS backbone (i.e., 5'-thio-modified phosphate backbone)

[0178] "Complement component C5," used interchangeably with the term "C5," refers to the well-known gene and polypeptide, which are also known in the art as Prepro-C5, ECLZB, CPAMD4, C3 and PZP-like alpha-2-macroglobulin domain-containing proteins, anaphylatoxin C5a analogs, hemolytic complement (Hc), and complement C5; the sequence of the human C5 mRNA transcript can be found, for example, at GenBank Accession No. GI:38016946 (NM_001735.2; SEQ ID NO. 207). The sequence of the rhesus macaque C5 mRNA can be found, for example, at GenBank Accession No. GI:297270262 (XM_001095750.2; SEQ ID NO: 208). The sequence of the mouse C5 mRNA can be found, for example, at GenBank Accession No. GI:291575171 (NM_010406.2; SEQ ID NO: 209). The sequence of rat C5 mRNA can be found, for example, in GenBank Accession No. GI:392346248 (XM_345342.4; SEQ ID NO: 210).Additional examples of C5 mRNA sequences are readily obtained using publicly available databases such as GenBank.

[0179] Typically, the majority of the nucleotides in each strand of a dsRNA molecule are ribonucleotides, but as described in detail herein, each strand or both strands may also include one or more non-ribonucleotides, such as deoxyribonucleotides and / or modified nucleotides. Additionally, as used herein, an "RNAi agent" may include ribonucleotides with chemical modifications; an RNAi agent may include a variety of modifications on multiple nucleotides. Such modifications may include all types of modifications disclosed herein or known in the art. Any such modification as used in siRNA-type molecules is encompassed within an "RNAi agent" for the purposes of this specification and claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0180] Figure 1: dsRNA high-throughput screening results.

[0181] Figure 2: Single screening results of unmodified candidate dsRNA sequences in HepG2 cells.

[0182] Figure 3: Single screening results of modified dsRNA sequences in HepG2 cells.

[0183] Figure 4: IC of modified dsRNA in HepG2 cells 50 result.

[0184] Figure 5: Single-dose screening results of GalNAc-conjugated dsRNA in HepG2 cells.

[0185] Figure 6: Single-dose screening results of GalNAc-conjugated dsRNA in cynomolgus monkey primary hepatocytes.

[0186] Figure 7: In vivo C5 content detection results after a single dose of 1 mpk.

[0187] Figure 8: In vivo C5 content detection results of single-dose dose gradient.

[0188] Figure 9: In vivo C5 content detection results of single-dose cynomolgus monkeys.

[0189] Figure 10: Comparison of two modification motif antisense strands (Modification Motif 3 and Modification Motif 4). DETAILED DESCRIPTION

[0190] Example 1. C5-dsRNA activity screening experiment

[0191] 1. dsRNA Design

[0192] Based on the human C5 mRNA sequence, multiple C5 dsRNAs were designed at different sites. All designed individual dsRNAs targeted all transcripts of the target gene (Table 1). Sequence similarity software alignment of these sequences (Table 2) revealed minimal homology with all other non-target gene sequences. The sequence of Alnylam Pharmaceuticals' clinically investigated C5 dsRNA product, cemdisiran (patent sequence AD-62643), was used as the positive reference sequence in this invention. Based on the status of the related sequences (unmodified or modified, ligand-conjugated, etc.), they were designated as PC, PC-ESC, or GAL-PC.

[0193] Table 1: Target genes

[0194] Table 2: High-throughput screening of dsRNA sequences

[0195] 2. Synthesis and purification of dsRNA (conjugate)

[0196] The dsRNA of the present invention contains only ribonucleotides or 2'-methoxy or 2'-fluoro modified oligonucleotides, which are synthesized according to the theoretical yield of 1 μmol, using 1 μmol of a universal Frit vector ( All oligonucleotides were prepared on an LK-192X synthesizer using CPG vectors (Biocomma) or GalNAc derivative L96 with a protected group (Kailyn). According to sequence requirements, all phosphoramidite monomers corresponding to the nucleoside were diluted in anhydrous acetonitrile at a ratio of 1:40 (g / mL) and coupled twice for 3 minutes. Deprotection was performed using 3% TCA, activation was performed using 0.3 M benzylthiotetrazolyl in acetonitrile, and capping and oxidation were performed using CAPA / CAPB and 50 mM I2 solutions, respectively. After trityl-off synthesis, the solid support was transferred to a 2 mL centrifuge tube, 1.2 mL of ammonia was added, and the tube was heated in a 65°C oven for 3 hours to remove the protecting groups. The tube was then cooled to room temperature and concentrated under vacuum for 30 minutes. The solution was then filtered through a 0.22 μm filter into a sample vial. Single-stranded fragments were purified using a semi-preparative reverse-phase instrument with an elution gradient of 7% to 30% (ACN: 100 mM TEAA) over 10 minutes at a flow rate of 5 mL / min. After purification, the fragment was concentrated under vacuum and dried at room temperature. The sample was dissolved in water and purified on a GE Each solution was desalted on a Hi-Trap desalting column to elute the final oligonucleotide product. All identities and purity were confirmed using ESI-MS and IEX HPLC, respectively. Concentration was determined using a UV-visible microplate reader. Equimolar amounts of the sense and antisense strands were mixed and transferred to a new shipping tube. The mixture was heated at 95°C for 5 minutes, slowly annealed to room temperature, and finally dried using a vacuum concentrator at room temperature to yield the final product.

[0197] 3. High-throughput screening assay for C5-dsRNA in vitro activity

[0198] 1. Construction of detection plasmid

[0199] The recombinant plasmid was constructed using the psicheck-2 plasmid (GenScript Biotech), containing the target sequences of all C5 dsRNAs to be tested. The cloning sites were the 5' XhoI and 3' NotI sites of the psicheck-2 plasmid.

[0200] 2. Co-transfection of C5 dsRNA and recombinant plasmid into 293T cells

[0201] All cells were purchased from ATCC; other reagents were commercially available.

[0202] Cell line transfection: cells were cultured in DMEM medium containing 10% fetal bovine serum in a 5% CO2, 37°C constant temperature incubator. When the cells were in the logarithmic growth phase and in good condition (70% confluence), they were plated for transfection. The concentration of 293T human embryonic kidney cells was adjusted to 3×10 S / ml, add 0.1ml cell solution to each well of a 96-well plate and culture overnight. Prepare the transfection complex: mix 8μL Opti-MEM, 8ng recombinant plasmid and 2μL 10nM dsRNA, mix 9.5μL Opti-MEM and 0.5μL Lipofectamine 2000 transfection reagent, let it stand for 5 minutes, then mix the above two mixtures and let it stand for 20 minutes. Add the above transfection complex to a 96-well plate and incubate in a 5% CO2, 37°C constant temperature incubator for 6 hours. Aspirate the supernatant, add 0.1mL complete medium to each well, continue to culture for 24 hours and collect the samples. The experiments were repeated 3 times, and the relative expression level of mRNA in the transfection reagent only control group (Mock group) was set to 100%. The values ​​of other groups are all relative expression activities or expression levels relative to the Mock group.

[0203] 3. DLR detection and analysis

[0204] Dual-Luciferase Reporter Assay System kit (Promega) was used for detection. Cells were collected and processed according to the kit instructions for lysis. The fluorescence intensity of firefly (Photinus pyralis) luciferase and Renilla (Renilla reniformis) luciferase was detected in sequence using an Infinite Eplex microplate reader (TECAN). The ratio of Renilla (Renilla reniformis) luciferase to firefly (Photinus pyralis) luciferase fluorescence intensity was calculated and normalized using a mock group as a control. The activity of the mock group was 100%. Table 3 shows the results of the DLR detection, and the mean values ​​of the dual-luciferase reporter gene expression levels of the C5 dsRNA experimental group relative to the mock group were shown.

[0205] Table 3: High-throughput screening results in 293T cells

[0206] As shown in Figure 1, screening of C5 dsRNA in 293T cells revealed multiple optimal sequences. Five dsRNA molecules with excellent efficacy and sequences targeting both human and cynomolgus macaque C5 were retained as candidate sequences, numbered 5, 7, 17, 32, and 85. Furthermore, the unmodified positive control group, PC, also exhibited superior inhibitory activity.

[0207] 4. Real-time quantitative PCR analysis of target mRNA levels

[0208] 1. C5 dsRNA transfection into HepG2 cells

[0209] HepG2 cells were cultured in DMEM medium containing 10% fetal bovine serum in a 5% CO2, 37°C constant temperature incubator. When the cells were in the logarithmic growth phase and in good condition (70% confluence), they were plated for transfection. The cell density was adjusted to 2×10 cells per well. 5 Plate cells into a 24-well plate. Prepare the transfection complex: Mix 250 μL of Opti-MEM with 5 μL of 1 nM or 0.1 nM dsRNA, and 250 μL of Opti-MEM with 1.5 μL of RNAiMax transfection reagent. Let stand for 5 minutes, then combine the two mixtures and let stand for 20 minutes. Add the transfection complex to the 24-well plate and incubate in a 5% CO2, 37°C incubator for 6 hours. Aspirate the supernatant, add 1 mL of complete culture medium to each well, and continue incubation for an additional 24 hours.

[0210] 2. Real-time fluorescence quantitative PCR analysis

[0211] 24 hours after transfection, cells were lysed and total RNA was extracted using the Novagen FastPure Cell / Tissue Total RNA Isolation Kit V2 (refer to the Novagen RC112-01 instructions). Reverse transcription was performed into cDNA using Takara PrimeScript RT Master Mix RR036Q. Table 3 shows the primer sequences for qPCR. PCR reactions were performed using a Bio-Rad CFX96 fluorescence quantitative PCR instrument, using the human GAPDH gene as the internal reference gene. Mock controls were used for normalization, and the C5 mRNA expression level in the mock group was set to 1.

[0212] Table 4: QPCR primer sequence information

[0213] 4. Data Analysis

[0214] After the PCR reaction, the Ct error for each sample (three transfection replicates and three qPCR replicates per sample) was within ±0.5. Relative quantification was performed using CFX96 software using a reference gene as a standard, and statistical analysis was performed using GarphPad software. Table 5 shows the results of further validation of the five candidate dsRNA molecules screened above in HepG2 cells.

[0215] Table 5 Single-dose screening of unmodified dsRNA in HepG2 cells

[0216] The target positions of the candidate dsRNAs (relative to human C5 transcript NM_001735.3) are: No. 5: 147-167; No. 7: 173-193; No. 17: 332-352; No. 32: 598-618; No. 85: 2112-2132.

[0217] It should be understood that in the examples of this application, all dsRNAs with the same name and number have the same naked sequence (ie, base sequence).

[0218] Example 2, Optimization of C5-dsRNA

[0219] 1. Inhibitory activity detection

[0220] To further confirm the inhibitory activity of the five preferred dsRNA molecules described above, we optimized their sequence modifications (Table 6). Combinations of fluoro and methoxy modifications were performed at different positions in the candidate sequences. The overall modification strategy employed methoxy substitutions in the antisense strand whenever possible. Sequence designs are shown in Table 6. HepG2 cells were used for transfection, and the synthesis, transfection, and quantitative PCR detection procedures were the same as in Example 1. Tables 7 and 8 show the average target gene expression levels relative to the mock group (the relative mRNA expression level in the mock group is 1).

[0221] Table 6: Modified dsRNA sequences

[0222] Note: The numbers or letters to the left of “-” in Table 6 are the name codes.

[0223] Modification motif 1: XmsXmsXmXmXmXmXfXmXfXfXfXmXmXmXmXmXmXmXmXmXmXmXm

[0224] Modification motif 2: XmsXmsXfXmXfXmXfXfXfXfXmXfXmXfXmXfXmXfXmXmXmXm

[0225] Modification motif 3: XmsXfsXmXmXfXmXmXmXmXmXmXmXfXmXfXmXmXmXmXmXmsXmsXm

[0226] Modification motif 4: XmsXfsXmXmXmXmXmXmXmXmXmXmXmXfXmXfXmXmXmXmXmXmsXmsXm

[0227] Modification motif 5: XmsXfsXfXmXfXmXfXmXfXmXfXmXfXmXfXmXfXmXfXmXmXmsXmsXmdTdT

[0228] Table 7: Single-dose screening of modified dsRNA in HepG2 cells

[0229] Note: The numbers or letters on the left side of “-” in Table 7 are the name codes.

[0230] Table 8: IC of modified dsRNA in HepG2 hepatocytes 50 data

[0231] Note: The numbers or letters to the left of “-” in Table 8 are the name codes.

[0232] As shown in Figures 3 and 4, chemically modified 5-E05, 17-E05, E85-E05, and 85-E04 exhibited higher inhibitory activity in HepG2 cells, all superior to or equivalent to Yangshen PC-ESC. This also demonstrates that the modification scheme is important, as certain modifications can reduce inhibitory activity. When the sense strand is consistently modified, a comparison of the two modification motifs (Modification Motifs 3 and 4) of the antisense strand reveals that 5-E05, 17-E05, and E85-E05 are superior to the corresponding 5-E04, 17-E04, and E85-E04. This suggests that the strategy of employing 2'-methoxy substitutions (Modification Motif 4, see Figure 10) in the antisense strand is effective for enhancing inhibitory activity.

[0233] Example 3 In vitro effectiveness testing of GaINAc-dsRNA

[0234] The candidate modified dsRNAs were GalNAc-coupled to form GAL-dsRNA complexes, and the structures of the complexes are shown in Table 9. We further verified the activity of the complexes in primary cynomolgus monkey hepatocytes and HepG2 cells.

[0235] 1. Detection of mRNA expression levels in primary cynomolgus monkey hepatocytes

[0236] The 24-well plate was pre-coated with collagen I and rat tail. Primary cynomolgus monkey hepatocytes (purchased from Liwo Biotechnology) were plated into the 24-well plate at 2×10 5 The next day, the synthesis, transfection, and quantitative PCR detection steps were the same as in Example 1. The final concentration of GalNAc-dsRNA transfection was 10 nM, and the cynomolgus monkey primer sequences are shown in Table 3. As shown in Figure 5, the candidate sequence can effectively silence the expression of the C5 gene in primary cynomolgus monkey hepatocytes.

[0237] 2. Detection of mRNA expression levels in HepG2 cells

[0238] The detection steps are as in Example 1, with monkey GAPDH gene as the internal reference gene and the primers used for detection shown in Table 4. Tables 10 and 11 show the average expression levels of target genes relative to the Mock group (the relative expression level of mRNA in the Mock group is 1).

[0239] Table 9: GalNAc-coupled dsRNA sequences

[0240] Note 1: The numbers to the right of “E” in Table 9 are the name numbers. PC in GAL-PC is the name number.

[0241] Note 2: The 3' end of the sense strand of all sequences in Table 9 is connected to the L96 ligand.

[0242] Table 10: Single-dose screening of GalNAc-conjugated dsRNA in primary cynomolgus monkey hepatocytes

[0243] Note: The number to the right of “E” in Table 10 is the name number. PC in GAL-PC is the name number.

[0244] Table 11: Single-dose screening of GalNAc-conjugated dsRNA in HepG2 cells

[0245] Note: The numbers on the side of the "E" stone in Table 11 are the name numbers. The PC in GAL-PC is the name number.

[0246] The results are shown in Figures 5 and 6. The candidate GAL-E5, GAL-E85, and GAL-E85-1 all effectively silenced the expression of C5 in cells, and their activity was better than that of the Yangshen GAL-PC group.

[0247] Example 4: In vivo effectiveness testing

[0248] The experiment used SPF-grade humanized C5 mice (Shanghai South Model Organisms Science Co., Ltd.), 6 to 8 weeks old. They were randomly divided into 10 groups, half male and half female, and administered a single subcutaneous injection (see Tables 13 and 14 for dosing groups). Blood was collected on days -3 (before dosing), 3, 7, 12, 19, 26, 33, 40, and 54 (the first dose was day 0). Serum was collected from the back of the eye by bleeding for C5 protein analysis.

[0249] Table 12: 1 mpk single dose regimen

[0250] Note: The number to the right of “E” in Table 12 is the name number. PC in GAL-PC is the name number.

[0251] Table 13: Dose gradient single dose regimen

[0252] Note: The number to the right of “E” in Table 13 is the name number. PC in GAL-PC is the name number.

[0253] C5 protein ELISA detection

[0254] 1. Method

[0255] The serum was diluted 1:20,000 and the residual C5 content in the serum of each group was detected using the ab125963 ELISA kit. The specific operation steps were referred to the ab125963 ELISA test instructions. The absorbance value was measured at a wavelength of 450 nm using a microplate reader. The relative residual rate of each group relative to the Blank group was statistically analyzed using GraphPad software.

[0256] 2. Results

[0257] The experimental results show (Figure 7) that, in a single dose of 1 mpk, the levels of C5 in the serum of mice in the groups treated with the four candidate dsRNA molecules were significantly lower than those in the blank control group and better than those in the Yangshen control group. Further dose-finding test results (Figure 8) showed that compared with the Yangshen control GAL-PC (3 mpk), which returned to the pre-drug point on the 33rd day, GAL-E85 (0.3 mpk) extended the return to the pre-drug point to the 47th day, while the medium and high doses extended the time even longer, to 103 days. At the same time, the candidate GAL-E5 also showed the potential to be significantly more effective than the GAL-PC group. In summary, our results demonstrate that our candidate dsRNA molecules targeting the C5 target have a better inhibitory effect on C5 than cemdisiran (AD-62643), which is currently under clinical development, and have the potential to treat C5-related diseases.

[0258] Example 5: In vivo effectiveness testing in cynomolgus monkeys

[0259] Adult male cynomolgus macaques (3 per group) were administered a single subcutaneous injection (see Table 14 for dosing groups). Day -3 was used as the pre-drug point and day 0 as the dosing point, with blood drawn at designated time points. The collected serum was assayed for C5 protein content using the ab125963 ELISA kit, following the same procedures as in Example 4. The C5 residual rate in each group was calculated relative to the pre-drug point.

[0260] Table 14: 3 mpk single dose regimen

[0261] Note: The number to the right of “E” in Table 14 is the name number. PC in GAL-PC is the name number.

[0262] The experimental results (Figure 9) show that compared to the Yangshen control molecule GAL-PC, our candidate molecules GAL-E85 and GAL-E5 both exhibited stronger and more sustained inhibitory effects on the C5 protein. The highest inhibition rate of GAL-PC was 47.5%, while the highest inhibition rates of GAL-E85 and GAL-E5 were 90.2% and 85.5%, respectively.

[0263] In summary, it can be seen that when the dsRNA of the present application uses modification motif 1, the antisense chain using modification motif 4 can achieve better in vivo and in vitro inhibition efficiency compared to using modification motif 3.

[0264] The above description is only a preferred embodiment, which is only used as an example and does not limit the combination of features necessary for implementing the present application. The title provided is not intended to limit the various embodiments of the present application. Terms such as "comprising", "containing" and "including" are not intended to be limiting. In addition, unless otherwise specified, plural forms are included when there is no numeral modification, and "or" and "or" mean "and / or". Unless otherwise defined herein, the meaning of all technical and scientific terms used herein is the same as that generally understood by those skilled in the art. All publications and patents mentioned in this application are incorporated herein by reference. Without departing from the scope and spirit of the present application, various modifications and variations of the described methods and compositions of the present application are obvious to those skilled in the art. Although the present application is described by specific preferred embodiments, it should be understood that the present application claimed for protection should not be unduly limited to these specific embodiments. In fact, various variations of the described modes for implementing the present application that are obvious to those skilled in the relevant art are intended to be included in the scope of the appended claims.

Claims

1. A dsRNA molecule for inhibiting C5 gene expression, comprising a sense strand and an antisense strand which complement each other to form a double-stranded region, wherein the sense strand and / or the antisense strand comprises or consists of 15-25 nucleotides, the antisense strand is complementary to at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of a sequence as shown in any one of SEQ ID NOs: 1-98, the length of the double-stranded region is 15-25 bp, and at least one nucleotide in the dsRNA molecule is modified.

2. The dsRNA molecule according to claim 1, characterized in that: The nucleotide sequence of the sense strand is shown in any one of SEQ ID NOs: 1-98; wherein the nucleotide sequence of the antisense strand in the dsRNA molecule corresponding to the nucleotide sequence of the sense strand SEQ ID NOs: 1-98 is shown in SEQ ID NOs: 101 to 198, respectively.

3. The dsRNA molecule according to claim 1 or 2, characterized in that: The modification is selected from any one or more of the following: locked nucleic acid modification, open ring or non-locked nucleic acid modification, 2′-methoxyethyl modification, 2′-O-methyl modification, 2′-O-allyl modification, 2′-C-allyl modification, 2′-fluoro modification, 2′-deoxy modification, 2′-hydroxyl modification, thiophosphate backbone modification, DNA modification, fluorescent probe modification and ligand modification.

4. The dsRNA molecule according to claim 3, characterized in that: The modification methods of the dsRNA molecule include: (1) positive strand: 17-21 nt in length, preferably 21 nt; composed of 2′-O-methyl modified regions and 2′-fluoro modified regions alternately, each modified region is 1 to 3 nucleotides in length; the modification methods of the first modified region from the 5′ end and the 3′ end are the same; (2) antisense strand: 19-23 nt in length, preferably 23 nt; composed of 2′-O-methyl modified regions, 2′-fluoro modified regions, unmodified regions or DNA regions alternately, each modified region is 1 to 5 nucleotides in length; and the continuous nucleotide regions from the 2nd to the 5th position from the 5′ end and the continuous nucleotide regions from the 1st to the 3rd position from the 3′ end are all connected by a thiophosphate backbone; Preferably, (1) the sense strand is 2 nt in length, with 2′-fluoro modification at positions 7 and 9-11 from the 5′ end, and 2′-O-methyl modification at the remaining positions, and a continuous nucleotide region from positions 1 to 3 from the 5′ end is connected by a thiophosphate backbone; (2) the antisense strand is 23 nt in length; with 2′-fluoro modification at positions 2, 14, 16 and optionally at position 6 from the 5′ end, and 2′-O-methyl modification at the remaining positions, and a continuous nucleotide region from positions 1 to 3 from the 5′ end, and a continuous nucleotide region from positions 1 to 3 from the 3′ end are connected by a thiophosphate backbone.

5. The dsRNA molecule according to any one of claims 1 to 4, characterized in that: The naked sequence of the sense strand of the dsRNA molecule is as shown in (A1), (A2) or (A3); the naked sequence of the antisense strand of the dsRNA molecule is as shown in (A4), (A5) or (A6): (A1)GUGAUUCAAGUUUAUGGAUAC (SEQ ID NO: 5) (A2)UGUGUAUUUGGAAGUUGUAUC (SEQ ID NO: 17) (A3)GUGAAGAAAUGUUGUUACGAU (SEQ ID NO: 85) (A4)GUAUCCAUAAACUUGAAUCACAA (SEQ ID NO: 105) (A5)GAUACAACUUCCAAAUACACAUA (SEQ ID NO: 117) (A6)AUCGUAACAACAUUUCUUCACUA (SEQ ID NO: 185).

6. The dsRNA molecule according to claim 5, characterized in that: The sense strand of the dsRNA molecule has the modification shown in modification motif 1; the antisense strand of the dsRNA molecule has the modification shown in modification motif 3 or modification motif 4; wherein, Modification motif 1 is: XmsXmsXmXmXmXmXfXmXfXfXfXmXmXmXmXmXmXmXmXmXmXmXm; Modification motif 3 is: XmsXfsXmXmXmXfXmXmXmXmXmXmXmXfXmXfXmXmXmXmXmXmsXmsXm; Modification motif 4 is: XmsXfsXmXmXmXmXmXmXmXmXmXmXmXmXfXmXfXmXmXmXmXmXmsXmsXm; wherein, X in each modification motif represents the ribonucleotides from 5' to 3' of the sense chain from 5' to 3', respectively, Xm represents a ribonucleotide modified with 2'-O-methyl; Xf represents a ribonucleotide modified with 2'-fluoro; s represents the front and back two nucleotides connected by a thiophosphate backbone.

7. The dsRNA molecule according to claim 6, characterized in that: The dsRNA molecule further comprises a ligand connected to the 3' end of the sense strand of the dsRNA molecule, wherein the ligand is L96, wherein the structure of L96 is shown in Formula I:

8. The dsRNA molecule according to any one of claims 5 to 7, characterized in that: The sense strand has the modification shown in modification motif 1, and the antisense strand has the modification shown in modification motif 4.

9. A pharmaceutical composition comprising the dsRNA molecule according to any one of claims 1 to 8 and a pharmaceutically acceptable excipient, preferably the pharmaceutical composition further comprises another compound that inhibits complement proteins or the expression of complement proteins.

10. A use of dsRNA, selected from any one of the following groups: (I) Use of the dsRNA according to any one of claims 1 to 8 or the pharmaceutical composition according to claim 9 in inhibiting complement C5 gene expression or in preparing a product for inhibiting complement C5 gene expression; (II) Use of the dsRNA according to any one of claims 1 to 8 or the pharmaceutical composition according to claim 9 in the preparation of a product for reducing C5 protein in serum; (III) Use of the dsRNA according to any one of claims 1 to 8 or the pharmaceutical composition according to claim 9 for preventing and / or treating a disease mediated by the complement C5 gene or for preparing a product for preventing and / or treating a disease mediated by the complement C5 gene; (IV) Use of the dsRNA of any one of claims 1 to 8 or the pharmaceutical composition of claim 9 for alleviating the symptoms of a disease mediated by the complement C5 gene or for preparing a product for alleviating the symptoms of a disease mediated by the complement C5 gene; in, The diseases mediated by complement C5 gene are selected from any one or more of the following: ophthalmic diseases, blood diseases, cardiovascular diseases, autoimmune diseases, kidney diseases, neurological diseases or tumor diseases; the ophthalmic diseases include: dry / wet age-related macular degeneration (AMD), geographic atrophy (GA), etc.; the neurological diseases include: Alzheimer's disease (AD), myasthenia gravis (gMG), etc.; the kidney diseases include: typical hemolytic uremic syndrome (aHUS), C3 glomerulopathy (C3G), IgA nephropathy and lupus nephritis; the blood diseases include: paroxysmal nocturnal hemoglobinuria (PNH), thrombotic microangiopathy (TMAs), etc.; the autoimmune diseases include: rheumatoid arthritis, lupus erythematosus, etc.; the surgery-related diseases include: liver ischemia-reperfusion injury, burn repair, organ transplant rejection, etc.; the respiratory diseases include: asthma, idiopathic pulmonary fibrosis, chronic obstructive pulmonary disease (COPD), etc.; the tumor diseases include: complement-related liver cancer or lung cancer.

11. A double-stranded nucleic acid or a pharmaceutically acceptable salt thereof for inhibiting C5 gene expression, wherein the double-stranded nucleic acid comprises a first strand and a second strand. The first strand is: AUCGIAACAACAUUUCUUCACUA (SEQ ID NO: 185), The second strand is: GUGAAGAAAUGUUGUUACGAU (SEQ ID NO: 85); or The first strand is: GUAUCCAUAAACUUGAAUCACAA (SEQ ID NO: 105), The second strand is: GUGAUUCAAGUUUAUGGAUAC (SEQ ID NO: 5); The modification motif of the first strand is modification motif 4: XmsXfsXmXmXmXmXmXmXmXmXmXmXmXfXmXfXmXmXmXmXmXmsXmsXm; The second strand 3' connects L96 ligand and modification motif 1: XmsXmsXmXmXmXmXfXmXfXfXfXmXmXmXmXmXmXmXmXmXmXmXm; in, Xm represents ribonucleotide A, U, C or G modified by 2′-O-methyl; Xf represents ribonucleotide A, U, C or G modified by 2′-fluoro; (s) represents that the two nucleotides before and after are connected by a thiophosphate backbone; the second chain 3′ is connected to the L96 ligand in the following manner:

12. A pharmaceutical composition comprising the double-stranded nucleic acid according to claim 11 and a pharmaceutically acceptable carrier.

Images